Previous Contig 001467:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005B22Sequence491001467 (14)gb:AF518566_18077851e-71Glycine max methionine synthase mRNA, complete cds.760009104 (8)gb:AF220054_17782243e-97Coffea arabica methionine synthase mRNA, partial cds.
JMFF019D20Sequence594001467 (14)gb:AF439723_17999816e-88Zea mays methionine synthase mRNA, partial cds.730009104 (8)gb:AF220054_17782243e-95Coffea arabica methionine synthase mRNA, partial cds.
JMFF032I11Sequence532001467 (14)gb:AF518566_18077852e-78Glycine max methionine synthase mRNA, complete cds.735009104 (8)gb:AF220054_1778224e-105Coffea arabica methionine synthase mRNA, partial cds.
JMFS001D05Sequence577001467 (14)gb:AF439723_17999814e-89Zea mays methionine synthase mRNA, partial cds.
JMFS063B07Sequence627001467 (14)gb:AF082893_1766703e-103Solanum tuberosum methionine synthase (MS) mRNA, complete cds.
JMFS090D09Sequence634001467 (14)gb:AF082893_17667032e-97Solanum tuberosum methionine synthase (MS) mRNA, complete cds.
JMFS100C06Sequence537001467 (14)gb:AF439723_17999813e-84Zea mays methionine synthase mRNA, partial cds.
JMFS154A09Sequence624001467 (14)gb:AF082893_1766703e-100Solanum tuberosum methionine synthase (MS) mRNA, complete cds.
JMFS162G04Sequence563001467 (14)gb:AF439723_17999812e-87Zea mays methionine synthase mRNA, partial cds.
JMFS164E08Sequence595001467 (14)gb:AF439723_17999813e-92Zea mays methionine synthase mRNA, partial cds.
JMFS169B10Sequence609001467 (14)gb:AF082893_17667032e-94Solanum tuberosum methionine synthase (MS) mRNA, complete cds.
JMSF008C13Sequence359001467 (14)gb:AF518566_18077853e-46Glycine max methionine synthase mRNA, complete cds.738009104 (8)gb:AF220054_17782241e-98Coffea arabica methionine synthase mRNA, partial cds.
JMSF033F13Sequence636001467 (14)gb:AF082893_17667034e-97Solanum tuberosum methionine synthase (MS) mRNA, complete cds.741009104 (8)gb:AF220054_17782246e-98Coffea arabica methionine synthase mRNA, partial cds.
JMSF037G01Sequence697001467 (14)gb:AF082893_1766703e-107Solanum tuberosum methionine synthase (MS) mRNA, complete cds.603009104 (8)gb:AF466201_18022435e-73Sorghum bicolor clone SBTXS_0032H17 putative cytochrome P450-like protein, putat

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS063B07+ GAAGCACCAGCACCCT
JMSF037G01+ GGNTCATCAAACTGGATCCAAGAAGCACCAGCACCCT
                      ____________________________________________________________
consensus GGNTCATCAAACTGGATCCAAGAAGCACCAGCACCCT
 
. : . : . : . : . : . :
JMFS063B07+ TCAATTCAGAAATAACTTCCTTGTAGATTGGAAGGATCTTGTCAAGGAGAGACAAAAGAG
JMFS154A09+ AATAACTTCCTTGTAGATTGGAAGGATCTTGTCAAGGAGAGACAAAAGAG
JMSF037G01+ TCAATTCAGAAATAACTTCCTTGTAGATTGGAAGGATCTTGTCAAGGAGAGACAAAAGAG
JMFS090D09+ TTGGAAGGATCTTGTCAAGGAGAGACAAAAGAG
JMFS164E08+ AAAAGAG
JMFS169B10+ GTCAAGGAGAGACAAAAGAG
JMSF033F13+ AGATTGGAAGGATCTTGTCAAGGAGAGACAAAAGAG
                      ____________________________________________________________
consensus TCAATTCAGAAATAACTTCCTTGTAGATTGGAAGGATCTTGTCAAGGAGAGACAAAAGAG
 
. : . : . : . : . : . :
JMFS063B07+ GGAAAGATTTCTCAACTCCCTTGGCAGGTTTGGATAGCAACAAGTATGATACTGGACCAA
JMFS154A09+ GGAAAGATTTCTCAACTCCCTTGGCAGGTTTGGATAGCAACAAGTATGATACTGGACCAA
JMSF037G01+ GGAAAGATTTCTCAACTCCCTTGGCAGGTTTGGATAGCAACAAGTATGATACTGGACCAA
JMFS090D09+ GGAAAGATTTCTCAACTCCCTTGGCAGGTTTGGATAGCAACAAGTATGATACTGGACCAA
JMFS164E08+ GGAAAGATTTCTCAACTCCCTTGGCAGGTTTGGATAGCAACAAGTATGATACTGGACCAA
JMFS169B10+ GGAAAGATTTCTCAACTCCCTTGGCAGGTTTGGATAGCAACAAGTATGATACTGGACCAA
JMFS162G04+ GGCAGGTTTGGATAGCAACAAGTATGATACTGGACCAA
JMFS100C06+ AACAAGTATGATACTGGACCAA
JMFF019D20+ CTTGGCAGGTTTGGATAGCAACAAGTATGATACTGGACCAA
JMFS001D05+ TCAACTCCCTTGGCAGGTTTGGATAGCAACAAGTATGATACTGGACCAA
JMSF033F13+ GGAAAGATTTCTCAACTCCCTTGGCAGGTTTGGATAGCAACAAGTATGATACTGGACCAA
                      ____________________________________________________________
consensus GGAAAGATTTCTCAACTCCCTTGGCAGGTTTGGATAGCAACAAGTATGATACTGGACCAA
 
. : . : . : . : . : . :
JMFS063B07+ CAAGAACTGGGACAGTTTCAACACCAAGCGCCTTAGCCTCCTTGTATTCGGTCACTGCTT
JMFS154A09+ CAAGAACTGGGACAGTTTCAACACCAAGCGCCTTAGCCTCCTTGTATTCGGTCACTGCTT
JMSF037G01+ CAAGAACTGGGACAGTTTCAACACCAAGCGCCTTAGCCTCCTTGTATTCGGTCACTGCTT
JMFS090D09+ CAAGAACTGGGACAGTTTCAACACCAAGCGCCTTAGCCTCCTTGTATTCGGTCACTGCTT
JMFS164E08+ CAAGAACTGGGACAGTTTCAACACCAAGCGCCTTAGCCTCCTTGTATTCGGTCACTGCTT
JMFS169B10+ CAAGAACTGGGACAGTTTCAACACCAAGCGCCTTAGCCTCCTTGTATTCGGTCACTGCTT
JMFS162G04+ CAAGAACTGGGACAGTTTCAACACCAAGCGCCTTAGCCTCCTTGTATTCGGTCACTGCTT
JMFS100C06+ CAAGAACTGGGACAGTTTCAACACCAAGCGCCTTAGCCTCCTTGTATTCGGTCACTGCTT
JMFF019D20+ CAAGAACTGGGACAGTTTCAACACCAAGCGCCTTAGCCTCCTTGTATTCGGTCACTGCTT
JMFS001D05+ CAAGAACTGGGACAGTTTCAACACCAAGCGCCTTAGCCTCCTTGTATTCGGTCACTGCTT
JMSF033F13+ CAAGAACTGGGACAGTTTCAACACCAAGCGCCTTAGCCTCCTTGTATTCGGTCACTGCTT
JMFF005B22+ CGGTCACTGCTT
JMFF032I11+ GGGACAGTTTCAACACCAAGCGCCTTAGCCTCCTTGTATTCGGTCACTGCTT
                      ____________________________________________________________
consensus CAAGAACTGGGACAGTTTCAACACCAAGCGCCTTAGCCTCCTTGTATTCGGTCACTGCTT
 
. : . : . : . : . : . :
JMFS063B07+ TGTGGGAAGCATAAGAGAATTTGACATCAGGACCCAACTCAGGGACAATGAAGTGGTAGT
JMFS154A09+ TGTGGGAAGCATAAGAGAATTTGACATCAGGACCCAACTCAGGGACAATGAAGTGGTAGT
JMSF037G01+ TGTGGGAAGCATAAGAGAATTTGACATCAGGACCCAACTCAGGGACAATGAAGTGGTAGT
JMFS090D09+ TGTGGGAAGCATAAGAGAATTTGACATCAGGACCCAACTCAGGGACAATGAAGTGGTAGT
JMFS164E08+ TGTGGGAAGCATAAGAGAATTTGACATCAGGACCCAACTCAGGGACAATGAAGTGGTAGT
JMFS169B10+ TGTGGGAAGCATAAGAGAATTTGACATCAGGACCCAACTCAGGGACAATGAAGTGGTAGT
JMFS162G04+ TGTGGGAAGCATAAGAGAATTTGACATCAGGACCCAACTCAGGGACAATGAAGTGGTAGT
JMFS100C06+ TGTGGGAAGCATAAGAGAATTTGACATCAGGACCCAACTCAGGGACAATGAAGTGGTAGT
JMFF019D20+ TGTGGGAAGCATAAGAGAATTTGACATCAGGACCCAACTCAGGGACAATGAAGTGGTAGT
JMFS001D05+ TGTGGGAAGCATAAGAGAATTTGACATCAGGACCCAACTCAGGGACAATGAAGTGGTAGT
JMSF033F13+ TGTGGGAAGCATAAGAGAATTTGACATCAGGACCCAACTCAGGGACAATGAAGTGGTAGT
JMFF005B22+ TGTGGGAAGCATAAGAGAATTTGACATCAGGACCCAACTCAGGGACAATGAAGTGGTAGT
JMFF032I11+ TGTGGGAAGCATAAGAGAATTTGACATCAGGACCCAACTCAGGGACAATGAAGTGGTAGT
                      ____________________________________________________________
consensus TGTGGGAAGCATAAGAGAATTTGACATCAGGACCCAACTCAGGGACAATGAAGTGGTAGT
 
. : . : . : . : . : . :
JMFS063B07+ TGGTATCGAACCACTTGGTCATTTCCATGGCAGGGACAGAGGCATTTCCTCTGGCCATGG
JMFS154A09+ TGGTATCGAACCACTTGGTCATTTCCATGGCAGGGACAGAGGCATTTCCTCTGGCCATGG
JMSF037G01+ TGGTATCGAACCACTTGGTCATTTCCATGGCAGGGACAGAGGCATTTCCTCTGGCCATGG
JMFS090D09+ TGGTATCGAACCACTTGGTCATTTCCATGGCAGGGACAGAGGCATTTCCTCTGGCCATGG
JMFS164E08+ TGGTATCGAACCACTTGGTCATTTCCATGGCAGGGACAGAGGCATTTCCTCTGGCCATGG
JMFS169B10+ TGGTATCGAACCACTTGGTCATTTCCATGGCAGGGACAGAGGCATTTCCTCTGGCCATGG
JMFS162G04+ TGGTATCGAACCACTTGGTCATTTCCATGGCAGGGACAGAGGCATTTCCTCTGGCCATGG
JMFS100C06+ TGGTATCGAACCACTTGGTCATTTCCATGGCAGGGACAGAGGCATTTCCTCTGGCCATGG
JMFF019D20+ TGGTATCGAACCACTTGGTCATTTCCATGGCAGGGACAGAGGCATTTCCTCTGGCCATGG
JMFS001D05+ TGGTATCGAACCACTTGGTCATTTCCATGGCAGGGACAGAGGCATTTCCTCTGGCCATGG
JMSF033F13+ TGGTATCGAACCACTTGGTCATTTCCATGGCAGGGACAGAGGCATTTCCTCTGGCCATGG
JMFF005B22+ TGGTATCGAACCACTTGGTCATTTCCATGGCAGGGACAGAGGCATTTCCTCTGGCCATGG
JMFF032I11+ TGGTATCGAACCACTTGGTCATTTCCATGGCAGGGACAGAGGCATTTCCTCTGGCCATGG
                      ____________________________________________________________
consensus TGGTATCGAACCACTTGGTCATTTCCATGGCAGGGACAGAGGCATTTCCTCTGGCCATGG
 
. : . : . : . : . : . :
JMFS063B07+ AGAAGTAAGTATCAAATCCAATCTCACCGCCAGCCCAGTTGTACCTTGGGGGTACAGCAC
JMFS154A09+ AGAAGTAAGTATCAAATCCAATCTCACCGCCAGCCCAGTTGTACCTTGGGGGTACAGCAC
JMSF037G01+ AGAAGTAAGTATCAAATCCAATCTCACCGCCAGCCCAGTTGTACCTTGGGGGTACAGCAC
JMFS090D09+ AGAAGTAAGTATCAAATCCAATCTCACCGCCAGCCCAGTTGTACCTTGGGGGTACAGCAC
JMFS164E08+ AGAAGTAAGTATCAAATCCAATCTCACCGCCAGCCCAGTTGTACCTTGGGGGTACAGCAC
JMFS169B10+ AGAAGTAAGTATCAAATCCAATCTCACCGCCAGCCCAGTTGTACCTTGGGGGTACAGCAC
JMFS162G04+ AGAAGTAAGTATCAAATCCAATCTCACCGCCAGCCCAGTTGTACCTTGGGGGTACAGCAC
JMFS100C06+ AGAAGTAAGTATCAAATCCAATCTCACCGCCAGCCCAGTTGTACCTTGGGGGTACAGCAC
JMFF019D20+ AGAAGTAAGTATCAAATCCAATCTCACCGCCAGCCCAGTTGTACCTTGGGGGTACAGCAC
JMFS001D05+ AGAAGTAAGTATCAAATCCAATCTCACCGCCAGCCCAGTTGTACCTTGGGGGTACAGCAC
JMSF033F13+ AGAAGTAAGTATCAAATCCAATCTCACCGCCAGCCCAGTTGTACCTTGGGGGTACAGCAC
JMFF005B22+ AGAAGTAAGTATCAAATCCAATCTCACCGCCAGCCCAGTTGTACCTTGGGGGTACAGCAC
JMSF008C13+ GAAGTAAGTATCAAATCCAATCTCACCGCCAGCCCAGTTGTACCTTGGGGGTACAGCAC
JMFF032I11+ AGAAGTAAGTATCAAATCCAATCTCACCGCCAGCCCAGTTGTACCTTGGGGGTACAGCAC
                      ____________________________________________________________
consensus AGAAGTAAGTATCAAATCCAATCTCACCGCCAGCCCAGTTGTACCTTGGGGGTACAGCAC
 
. : . : . : . : . : . :
JMFS063B07+ CGAGCATGGCAGTGGTGTCGAGCACGTGATCATAGTAAGAGAAAGTGTTGCTGGGAATGA
JMFS154A09+ CGAGCATGGCAGTGGTGTCGAGCACGTGATCATAGTAAGAGAAAGTGTTGCTGGGAATGA
JMSF037G01+ CGAGCATGGCAGTGGTGTCGAGCACGTGATCATAGTAAGAGAAAGTGTTGCTGGGAATGA
JMFS090D09+ CGAGCATGGCAGTGGTGTCGAGCACGTGATCATAGTAAGAGAAAGTGTTGCTGGGAATGA
JMFS164E08+ CGAGCATGGCAGTGGTGTCGAGCACGTGATCATAGTAAGAGAAAGTGTTGCTGGGAATGA
JMFS169B10+ CGAGCATGGCAGTGGTGTCGAGCACGTGATCATAGTAAGAGAAAGTGTTGCTGGGAATGA
JMFS162G04+ CGAGCATGGCAGTGGTGTCGAGCACGTGATCATAGTAAGAGAAAGTGTTGCTGGGAATGA
JMFS100C06+ CGAGCATGGCAGTGGTGTCGAGCACGTGATCATAGTAAGAGAAAGTGTTGCTGGGAATGA
JMFF019D20+ CGAGCATGGCAGTGGTGTCGAGCACGTGATCATAGTAAGAGAAAGTGTTGCTGGGAATGA
JMFS001D05+ CGAGCATGGCAGTGGTGTCGAGCACGTGATCATAGTAAGAGAAAGTGTTGCTGGGAATGA
JMSF033F13+ CGAGCATGGCAGTGGTGTCGAGCACGTGATCATAGTAAGAGAAAGTGTTGCTGGGAATGA
JMFF005B22+ CGAGCATGGCAGTGGTGTCGAGCACGTGATCATAGTAAGAGAAAGTGTTGCTGGGAATGA
JMSF008C13+ CGAGCATGGCAGTGGTGTCGAGCACGTGATCATAGTAAGAGAAAGTGTTGCTGGGAATGA
JMFF032I11+ CGAGCATGGCAGTGGTGTCGAGCACGTGATCATAGTAAGAGAAAGTGTTGCTGGGAATGA
                      ____________________________________________________________
consensus CGAGCATGGCAGTGGTGTCGAGCACGTGATCATAGTAAGAGAAAGTGTTGCTGGGAATGA
 
. : . : . : . : . : . :
JMFS063B07+ ACTTGATCCCAGCATCAGCCATCTGTTTCCATATGGATGCCCTGAGGTCAGCTGACACCT
JMFS154A09+ ACTTGATCCCAGCATCAGCCATCTGTTTCCATATGGATGCCCTGAGGTCAGCTGACACCT
JMSF037G01+ ACTTGATCCCAGCATCAGCCATCTGTTTCCATATGGATGCCCTGAGGTCAGCTGACACCT
JMFS090D09+ ACTTGATCCCAGCATCAGCCATCTGTTTCCATATGGATGCCCTGAGGTCAGCTGACACCT
JMFS164E08+ ACTTGATCCCAGCATCAGCCATCTGTTTCCATATGGATGCCCTGAGGTCAGCTGACACCT
JMFS169B10+ ACTTGATCCCAGCATCAGCCATCTGTTTCCATATGGATGCCCTGAGGTCAGCTGACACCT
JMFS162G04+ ACTTGATCCCAGCATCAGCCATCTGTTTCCATATGGATGCCCTGAGGTCAGCTGACACCT
JMFS100C06+ ACTTGATCCCAGCATCAGCCATCTGTTTCCATATGGATGCCCTGAGGTCAGCTGACACCT
JMFF019D20+ ACTTGATCCCAGCATCAGCCATCTGTTTCCATATGGATGCCCTGAGGTCAGCTGACACCT
JMFS001D05+ ACTTGATCCCAGCATCAGCCATCTGTTTCCATATGGATGCCCTGAGGTCAGCTGACACCT
JMSF033F13+ ACTTGATCCCAGCATCAGCCATCTGTTTCCATATGGATGCCCTGAGGTCAGCTGACACCT
JMFF005B22+ ACTTGATCCCAGCATCAGCCATCTGTTTCCATATGGATGCCCTGAGGTCAGCTGACACCT
JMSF008C13+ ACTTGATCCCAGCATCAGCCATCTGTTTCCATATGGATGCCCTGAGGTCAGCTGACACCT
JMFF032I11+ ACTTGATCCCAGCATCAGCCATCTGTTTCCATATGGATGCCCTGAGGTCAGCTGACACCT
                      ____________________________________________________________
consensus ACTTGATCCCAGCATCAGCCATCTGTTTCCATATGGATGCCCTGAGGTCAGCTGACACCT
 
. : . : . : . : . : . :
JMFS063B07+ TCTGCAGATCCTCAGCACTGCTCTTCCCATCCCAAAAAGACTCAAGAGCAAATTTGAGCT
JMFS154A09+ TCTGCAGATCCTCAGCACTGCTCTTCCCATCCCAAAAAGACTCAAGAGCAAATTTGAGCT
JMSF037G01+ TCTGCAGATCCTCAGCACTGCTCTTCCCATCCCAAAAAGACTCAAGAGCAAATTTGAGCT
JMFS090D09+ TCTGCAGATCCTCAGCACTGCTCTTCCCATCCCAAAAAGACTCAAGAGCAAATTTGAGCT
JMFS164E08+ TCTGCAGATCCTCAGCACTGCTCTTCCCATCCCAAAAAGACTCAAGAGCAAATTTGAGCT
JMFS169B10+ TCTGCAGATCCTCAGCACTGCTCTTCCCATCCCAAAAAGACTCAAGAGCAAATTTGAGCT
JMFS162G04+ TCTGCAGATCCTCAGCACTGCTCTTCCCATCCCAAAAAGACTCAAGAGCAAATTTGAGCT
JMFS100C06+ TCTGCAGATCCTCAGCACTGCTCTTCCCATCCCAAAAAGACTCAAGAGCAAATTTGAGCT
JMFF019D20+ TCTGCAGATCCTCAGCACTGCTCTTCCCATCCCAAAAAGACTCAAGAGCAAATTTGAGCT
JMFS001D05+ TCTGCAGATCCTCAGCACTGCTCTTCCCATCCCAAAAAGACTCAAGAGCAAATTTGAGCT
JMSF033F13+ TCTGCAGATCCTCAGCACTGCTCTTCCCATCCCAAAAAGACTCAAGAGCAAATTTGAGCT
JMFF005B22+ TCTGCAGATCCTCAGCACTGCTCTTCCCATCCCAAAAAGACTCAAGAGCAAATTTGAGCT
JMSF008C13+ TCTGCAGATCCTCAGCACTGCTCTTCCCATCCCAAAAAGACTCAAGAGCAAATTTGAGCT
JMFF032I11+ TCTGCAGATCCTCAGCACTGCTCTTCCCATCCCAAAAAGACTCAAGAGCAAATTTGAGCT
                      ____________________________________________________________
consensus TCTGCAGATCCTCAGCACTGCTCTTCCCATCCCAAAAAGACTCAAGAGCAAATTTGAGCT
 
. : . : . : . : . : . :
JMFS063B07+ CTCTCTTCGGGCCCATACGGGGATATCCAACAATGTGAGATGCCATTTTTTCTGTTCTTT
JMFS154A09+ CTCTCTTCGGGCCCATACGGGGATATCCAACAATGTGAGATGCCATTTTTTCTGTTCTTT
JMSF037G01+ CTCTCTTCGGGCCCATACGGGGATATCCAACAATGTGAGATGCCATTTTTTCTGTTCTTT
JMFS090D09+ CTCTCTTCGGGCCCATACGGGGATATCCAACAATGTGAGATGCCATTTTTTCTGTTCTTT
JMFS164E08+ CTCTCTTCGGGCCCATACGGGGATATCCAACAATGTGAGATGCCATTTTTTCTGTTCTTT
JMFS169B10+ CTCTCTTCGGGCCCATACGGGGATATCCAACAATGTGAGATGCCATTTTTTCTGTTCTTT
JMFS162G04+ CTCTCTTCGGGCCCATACGGGGATATCCAACAATGTGAGATGCCATTTTTTCTGTTCTTT
JMFS100C06+ CTCTCTTCGGGCCCATACGGGGATATCCAACAATGTGAGATGCCATTTT-----TTCTTT
JMFF019D20+ CTCTCTTCGGGCCCATACGGGGATATCCAACAATGTGAGATGCCATTTTT
JMFS001D05+ CTCTCTTCGGGCCCATACGGGGATATCCAACAATGTGAGATGCCATTTTTTCTGTTCTTT
JMSF033F13+ CTCTCTTCGGGCCCATACGGGGATATCCAACAATGTGAGATGCCATTTTTTCTGTTCTTT
JMFF005B22+ CTCTCTTCGGGCCCATACGGGGATATCCAACAATGTGAGATGCCATTTTTTCTGTTCTTT
JMSF008C13+ CTCTCTTCGGGCCCATACGGGGATATCCAACAATGTGAGATGCCATTTTTTCTGTTCTTT
JMFF032I11+ CTCTCTTCGGGCCCATACGGGGATATCCAACAATGTGAGATGCCATTTTTTCTGTTCTTT
                      ____________________________________________________________
consensus CTCTCTTCGGGCCCATACGGGGATATCCAACAATGTGAGATGCCATTTTTTCTGTTCTTT
 
. : . : . : . : . : . :
JMFS063B07+ AAGGGAAAAGA
JMFS154A09+ AAGGGAAAAGAGGAAGCTGTTCGTTCACAGATAC
JMSF037G01+ AAGGGAAAAGAGGAAGCTGTTCGTTCACAGATACGGAGTAGAAGAGAAGGGGCCGACGCC
JMFS090D09+ AAGGGAAAAGAGGAAGCTGTTCGTTCACAGATACGGAGTAGAAGAG
JMFS164E08+ AAGGGAAAAGAGGAAGCTGTTCGTTCACAGATACGGAGTAGAAGAGAA
JMFS169B10+ AAGGGAAAAGAGGAAGCTGTTCGTTCACAGATACGGAGTAGAAGAGAAG
JMFS162G04+ AAGGGAAAAGAGGAAGCTGTTCGTTCACAGATACGGAGTAGAAGA
JMFS100C06+ AAGGGAAAAGAGGAAGCTGTTCGTTCACAGATACGGAGTA
JMFS001D05+ AAGGGAAAAGAGGAAGCTGTTCGTTCACAGATACGGAGTAGAAGAGAA
JMSF033F13+ AAGGGAAAAGAGGAAGCTGTTCGTTCACAGATACGGAGTAGAAGAGAAGGGGCCGACGCC
JMFF005B22+ AAGGGAAAAGAGGAAGCTGTTCGTTCACAGATACGGAGTAGAAGAGAAGGGGCCGACGC
JMSF008C13+ AAGGGAAAAGAGGAAGCTGTTCGTTCACAGATACGGAGTAGAAGAGAAGGGGCCGACGCC
JMFF032I11+ AAGGGAAAAGAGGAAGCTGTTCGTTCACAGATACGGAGTAGAAGAGAAGGGGCCGACGCC
                      ____________________________________________________________
consensus AAGGGAAAAGAGGAAGCTGTTCGTTCACAGATACGGAGTAGAAGAGAAGGGGCCGACGCC