Previous Contig 001464:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011M10Sequence579001464 (5)gb:AC137997_17439073e-08Oryza sativa chromosome 3 BAC OJ1499_D04 genomic sequence, complete sequence.>gb763013763 (5)gb:AC137997_17439071e-56Oryza sativa chromosome 3 BAC OJ1499_D04 genomic sequence, complete sequence.>gb
JMFF032H13Sequence478001464 (5)gb:AC137997_17439072e-05Oryza sativa chromosome 3 BAC OJ1499_D04 genomic sequence, complete sequence.>gb588013763 (5)gb:AC137997_17439077e-27Oryza sativa chromosome 3 BAC OJ1499_D04 genomic sequence, complete sequence.>gb
JMFF051J12Sequence429001464 (5)gb:AP003904_18350034e-05Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ10233013763 (5)
JMSF002H10Sequence486001464 (5)gb:AC137997_17439072e-06Oryza sativa chromosome 3 BAC OJ1499_D04 genomic sequence, complete sequence.>gb749013763 (5)gb:AC137997_17439078e-57Oryza sativa chromosome 3 BAC OJ1499_D04 genomic sequence, complete sequence.>gb
JMSF048E04Sequence698001464 (5)gb:AC137997_17439072e-18Oryza sativa chromosome 3 BAC OJ1499_D04 genomic sequence, complete sequence.>gb761013763 (5)gb:AC137997_17439076e-44Oryza sativa chromosome 3 BAC OJ1499_D04 genomic sequence, complete sequence.>gb

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF048E04+ CTCAAGGAACCGTACACAGGCCTTAATACACTCCTCAAATATCAACTTC
                      ____________________________________________________________
consensus CTCAAGGAACCGTACACAGGCCTTAATACACTCCTCAAATATCAACTTC
 
. : . : . : . : . : . :
JMFF011M10+ TCGTCGCCGAATAGTCG
JMSF048E04+ AGAGCTACCTCAAGCAATGACAGCGCTGTTGAAACGCTATCTATCGTCGCCGAATAGTCG
                      ____________________________________________________________
consensus AGAGCTACCTCAAGCAATGACAGCGCTGTTGAAACGCTATCTATCGTCGCCGAATAGTCG
 
. : . : . : . : . : . :
JMSF002H10+ CCGGA
JMFF011M10+ TCTGTATAGAGAAGTTGAAGAACAGTGATGTGGTCGTCGATTGATCTAGGCGTATCCGGA
JMSF048E04+ TCTGTATAGAGAAGTTGAAGAACAGTGATGTGGTCGTCGATTGATCTAGGCGTATCCGGA
                      ____________________________________________________________
consensus TCTGTATAGAGAAGTTGAAGAACAGTGATGTGGTCGTCGATTGATCTAGGCGTATCCGGA
 
. : . : . : . : . : . :
JMSF002H10+ ACGCCGAGACTAAACCGGTGCATCTTAGATGCGCTTCCAGAATCCCCCGCAGTGTCCTTT
JMFF011M10+ ACGCCGAGACTAAACCGGTGCATCTTAGATGCGCTTCCAGAATCCCCCGCAGTGTCCTTT
JMSF048E04+ ACGCCGAGACTAAACCGGTGCATCTTAGATGCGCTTCCAGAATCCCCCGCAGTGTCCTTT
                      ____________________________________________________________
consensus ACGCCGAGACTAAACCGGTGCATCTTAGATGCGCTTCCAGAATCCCCCGCAGTGTCCTTT
 
. : . : . : . : . : . :
JMSF002H10+ GACTCATTCAACCACCGCTCAGACAAAAGAGCCTCGAAGTACTCGCAGCGGCGAAGCACA
JMFF011M10+ GACTCATTCAACCACCGCTCAGACAAAAGAGCCTCGAAGTACTCGCAGCGGCGAAGCACA
JMSF048E04+ GACTCATTCAACCACCGCTCAGACAAAAGAGCCTCGAAGTACTCGCAGCGGCGAAGCACA
JMFF051J12+ CGAAGCACA
JMFF032H13+ CTCATTCAACCACCGCTCAGACAAAAGAGCCTCGAAGTACTCGCAGCGGCGAAGCACA
                      ____________________________________________________________
consensus GACTCATTCAACCACCGCTCAGACAAAAGAGCCTCGAAGTACTCGCAGCGGCGAAGCACA
 
. : . : . : . : . : . :
JMSF002H10+ TCGGAATGGAGATAGATCTGGACATCGGACTGGTCCAGAGAATCGACGGCTGAGATCGAC
JMFF011M10+ TCGGAATGGAGATAGATCTGGACATCGGACTGGTCCAGAGAATCGACGGCTGAGATCGAC
JMSF048E04+ TCGGAATGGAGATAGATCTGGACATCGGACTGGTCCAGAGAATCGACGGCTGAGATCGAC
JMFF051J12+ TCGGAATGGAGATAGATCTGGACATCGGACTGGTCCAGAGAATCGACGGCTGAGATCGAC
JMFF032H13+ TCGGAATGGAGATAGATCTGGACATCGGACTGGTCCAGAGAATCGACGGCTGAGATCGAC
                      ____________________________________________________________
consensus TCGGAATGGAGATAGATCTGGACATCGGACTGGTCCAGAGAATCGACGGCTGAGATCGAC
 
. : . : . : . : . : . :
JMSF002H10+ TCGGCGTCATCGTCATCGAAGGGACAATCAACGTAGAGCCGGAGGACGGTATCAGCGGAT
JMFF011M10+ TCGGCGTCATCGTCATCGAAGGGACAATCAACGTAGAGCCGGAGGACGGTATCAGCGGAT
JMSF048E04+ TCGGCGTCATCGTCATCGAAGGGACAATCAACGTAGAGCCGGAGGACGGTATCAGCGGAT
JMFF051J12+ TCGGCGTCATCGTCATCGAAGGGACAATCAACGTAGAGCCGGAGGACGGTATCAGCGGAT
JMFF032H13+ TCGGCGTCATCGTCATCGAAGGGACAATCAACGTAGAGCCGGAGGACGGTATCAGCGGAT
                      ____________________________________________________________
consensus TCGGCGTCATCGTCATCGAAGGGACAATCAACGTAGAGCCGGAGGACGGTATCAGCGGAT
 
. : . : . : . : . : . :
JMSF002H10+ GCCGAATCATTAAACGCGCCGCGCGAGGAGATCGGAAGATGAGAGTGAGAGGCGGTGCGC
JMFF011M10+ GCCGAATCATTAAACGCGCCGCGCGAGGAGATCGGAAGATGAGAGTGAGAGGCGGTGCGC
JMSF048E04+ GCCGAATCATTAAACGCGCCGCGCGAGGAGATCGGAAGATGAGAGTGAGAGGCGGTGCGC
JMFF051J12+ GCCGAATCATTAAACGCGCCGCGCGAGGAGATCGGAAGATGAGAGTGAGAGGCGGTGCGC
JMFF032H13+ GCCGAATCATTAAACGCGCCGCGCGAGGAGATCGGAAGATGAGAGTGAGAGGCGGTGCGC
                      ____________________________________________________________
consensus GCCGAATCATTAAACGCGCCGCGCGAGGAGATCGGAAGATGAGAGTGAGAGGCGGTGCGC
 
. : . : . : . : . : . :
JMSF002H10+ CGAAGAGCAGATGGTTTGTGAGAACATTCGTCCAGGATTTCGTCGGGACGGGAGGAATCA
JMFF011M10+ CGAAGAGCAGATGGTTTGTGAGAACATTCGTCCAGGATTTCGTCGGGACGGGAGGAATCA
JMSF048E04+ CGAAGAGCAGATGGTTTGTGAGAACATTCGTCCAGGATTTCGTCGGGACGGGAGGAATCA
JMFF051J12+ CGAAGAGCAGATGGTTTGTGAGAACATTCGTCCAGGATTTCGTCGGGACGGGAGGAATCA
JMFF032H13+ CGAAGAGCAGATGGTTTGTGAGAACATTCGTCCAGGATTTCGTCGGGACGGGAGGAATCA
                      ____________________________________________________________
consensus CGAAGAGCAGATGGTTTGTGAGAACATTCGTCCAGGATTTCGTCGGGACGGGAGGAATCA
 
. : . : . : . : . : . :
JMSF002H10+ ATGGCTGCGACGGTGGAGGACAGACGGTTGCTGCTTCCGGTACGTTGTCTCTTCTTCGCC
JMFF011M10+ ATGGCTGCGACGGTGGAGGACAGACGGTTGCTGCTTCCGGTACGTTGTCTCTTCTTCGCC
JMSF048E04+ ATGGCTGCGACGGTGGAGGACAGACGGTTGCTGCTTCCGGTACGTTGTCTCTTCTTCGCC
JMFF051J12+ ATGGCTGCGACGGTGGAGGACAGACGGTTGCTGCTTCCGGTACGTTGTCTCTTCTTCGCC
JMFF032H13+ ATGGCTGCGACGGTGGAGGACAGACGGTTGCTGCTTCCGGTACGTTGTCTCTTCTTCGCC
                      ____________________________________________________________
consensus ATGGCTGCGACGGTGGAGGACAGACGGTTGCTGCTTCCGGTACGTTGTCTCTTCTTCGCC
 
. : . : . : . : . : . :
JMSF002H10+ GCAACACCGGTTGCGCCACCACCACCACCAATCTTCATTTGCGGTATCGATCGAGAATTC
JMFF011M10+ GCAACACCGGTTGCGCCACCACCACCACCAATCTTCATTTGCGGTATCGATCGAGAATTC
JMSF048E04+ GCAACACCGGTTGCGCCACCACCACCACCAATCTTCATTTGCGGTATCGATCGAGAATTC
JMFF051J12+ GCAACACCGGTTGCGCCACCACCACCACCAATCTTCATTTGCGGTATCGATCGAGAATTC
JMFF032H13+ GCAACACCGGTTGCGCCACCACCACCACCAATCTTCATTTGCGGTATCGATCGAGAATTC
                      ____________________________________________________________
consensus GCAACACCGGTTGCGCCACCACCACCACCAATCTTCATTTGCGGTATCGATCGAGAATTC
 
. : . : . : . : . : . :
JMFF011M10+ AAGGAATGATTGAAATTGCAAT
JMSF048E04+ AAGGAATGATTGAAATTGCAATACTACTTCACCGAAACAGGTTATCC
JMFF051J12+ AAGGAATGATTGAAATTGCAATACTACTTCACCGAAACAGGTTATCCAATCTTATCTTCC
JMFF032H13+ AAGGAATGATTGAAATTGCAATACTACTTCACCGAAACAGGTTATCCAATCTTATCTTCC
                      ____________________________________________________________
consensus AAGGAATGATTGAAATTGCAATACTACTTCACCGAAACAGGTTATCCAATCTTATCTTCC