Previous Contig 001448:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006B10Sequence524001448 (137)gb:AY205084_15891294e-53Solanum tuberosum sucrose synthase 2 mRNA, complete cds.742001448 (137)gb:STU537575_17231052e-89Solanum tuberosum subsp. tuberosum mRNA for sucrose synthase 4 (sus4 gene).
JMFF006B15Sequence565001448 (137)gb:AY205084_15891295e-84Solanum tuberosum sucrose synthase 2 mRNA, complete cds.764001448 (137)gb:STU537575_17231051e-93Solanum tuberosum subsp. tuberosum mRNA for sucrose synthase 4 (sus4 gene).
JMFF006I08Sequence524001448 (137)gb:AY205084_15891292e-52Solanum tuberosum sucrose synthase 2 mRNA, complete cds.716001448 (137)gb:STU537575_17231052e-82Solanum tuberosum subsp. tuberosum mRNA for sucrose synthase 4 (sus4 gene).
JMFF009B11Sequence597001448 (137)gb:AY205084_15891293e-62Solanum tuberosum sucrose synthase 2 mRNA, complete cds.650001448 (137)gb:STU537575_17231055e-74Solanum tuberosum subsp. tuberosum mRNA for sucrose synthase 4 (sus4 gene).
JMFF010C21Sequence523001448 (137)gb:AY205084_15891294e-53Solanum tuberosum sucrose synthase 2 mRNA, complete cds.761001448 (137)gb:STU537575_1723105e-100Solanum tuberosum subsp. tuberosum mRNA for sucrose synthase 4 (sus4 gene).
JMFF015O13Sequence179001448 (137)
JMFF017A07Sequence601001448 (137)gb:CAR575256_1645424e-108Coffea arabica partial mRNA for sucrose synthase (sus1 gene).678001448 (137)gb:STU537575_17231052e-82Solanum tuberosum subsp. tuberosum mRNA for sucrose synthase 4 (sus4 gene).
JMFF017E12Sequence197001448 (137)
JMFF022A18Sequence515001448 (137)gb:AY205084_15891292e-79Solanum tuberosum sucrose synthase 2 mRNA, complete cds.762001448 (137)gb:STU537575_1723105e-100Solanum tuberosum subsp. tuberosum mRNA for sucrose synthase 4 (sus4 gene).
JMFF022F01Sequence374001448 (137)gb:AY205084_15891291e-26Solanum tuberosum sucrose synthase 2 mRNA, complete cds.684001448 (137)gb:STU537575_17231052e-84Solanum tuberosum subsp. tuberosum mRNA for sucrose synthase 4 (sus4 gene).
JMFF027B20Sequence522001448 (137)gb:AY205084_15891292e-52Solanum tuberosum sucrose synthase 2 mRNA, complete cds.697001448 (137)gb:STU537575_17231051e-89Solanum tuberosum subsp. tuberosum mRNA for sucrose synthase 4 (sus4 gene).
JMFF029A05Sequence491001448 (137)gb:AY205084_15891292e-47Solanum tuberosum sucrose synthase 2 mRNA, complete cds.684001448 (137)gb:STU537575_17231055e-84Solanum tuberosum subsp. tuberosum mRNA for sucrose synthase 4 (sus4 gene).
JMFF029L11Sequence206001448 (137)gb:AY205084_15891292e-18Solanum tuberosum sucrose synthase 2 mRNA, complete cds.723001448 (137)gb:STU537575_17231056e-89Solanum tuberosum subsp. tuberosum mRNA for sucrose synthase 4 (sus4 gene).
JMFF031G02Sequence410001448 (137)gb:AY205084_15891292e-30Solanum tuberosum sucrose synthase 2 mRNA, complete cds.584001448 (137)gb:STU537575_17231055e-67Solanum tuberosum subsp. tuberosum mRNA for sucrose synthase 4 (sus4 gene).
JMFF032C16Sequence570001448 (137)gb:AY205084_15891291e-56Solanum tuberosum sucrose synthase 2 mRNA, complete cds.725001448 (137)gb:STU537575_17231056e-94Solanum tuberosum subsp. tuberosum mRNA for sucrose synthase 4 (sus4 gene).
JMFF040E13Sequence484001448 (137)gb:AY205084_15891295e-47Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFF041B23Sequence619001448 (137)gb:AY205084_15891293e-68Solanum tuberosum sucrose synthase 2 mRNA, complete cds.623001448 (137)gb:STU537575_17231051e-62Solanum tuberosum subsp. tuberosum mRNA for sucrose synthase 4 (sus4 gene).
JMFF045I15Sequence620001448 (137)gb:AY205084_15891294e-77Solanum tuberosum sucrose synthase 2 mRNA, complete cds.518001448 (137)gb:STU537575_17231054e-33Solanum tuberosum subsp. tuberosum mRNA for sucrose synthase 4 (sus4 gene).
JMFF047H14Sequence598001448 (137)gb:CAR575256_1645424e-108Coffea arabica partial mRNA for sucrose synthase (sus1 gene).509001448 (137)gb:STU537575_17231057e-40Solanum tuberosum subsp. tuberosum mRNA for sucrose synthase 4 (sus4 gene).
JMFF047P13Sequence610001448 (137)gb:AY205084_15891291e-66Solanum tuberosum sucrose synthase 2 mRNA, complete cds.454001448 (137)gb:STU537575_17231055e-29Solanum tuberosum subsp. tuberosum mRNA for sucrose synthase 4 (sus4 gene).
JMFF048E20Sequence288001448 (137)gb:AY205084_15891295e-21Solanum tuberosum sucrose synthase 2 mRNA, complete cds.247001448 (137)
JMFN017E14Sequence528001448 (137)gb:STU537575_17231056e-53Solanum tuberosum subsp. tuberosum mRNA for sucrose synthase 4 (sus4 gene).
JMFN042P11Sequence622001448 (137)gb:STU537575_1723105e-110Solanum tuberosum subsp. tuberosum mRNA for sucrose synthase 4 (sus4 gene).
JMFS001F03Sequence591001448 (137)gb:AY205084_15891291e-65Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS002C01Sequence594001448 (137)gb:STU24087_1722997e-104Solanum tuberosum clone gPOSS16 sucrose synthase gene, complete cds.
JMFS003E06Sequence561001448 (137)gb:AY205084_15891295e-73Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS011H07Sequence627001448 (137)gb:AY205084_15891299e-72Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS013B08Sequence584001448 (137)gb:AY205084_15891297e-57Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS025F05Sequence613001448 (137)gb:LES011534_1684458e-110Lycopersicon esculentum sus3 gene (partial), exons 9-14.
JMFS026E01Sequence621001448 (137)gb:STU537575_1723105e-111Solanum tuberosum subsp. tuberosum mRNA for sucrose synthase 4 (sus4 gene).
JMFS026E05Sequence628001448 (137)gb:AY205084_15891294e-75Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS027C09Sequence571001448 (137)gb:AY205084_15891291e-61Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS027H06Sequence565001448 (137)gb:AY205084_15891291e-59Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS028F12Sequence619001448 (137)gb:STU537575_1723105e-111Solanum tuberosum subsp. tuberosum mRNA for sucrose synthase 4 (sus4 gene).
JMFS029A06Sequence607001448 (137)gb:AY205084_15891292e-58Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS031G05Sequence554001448 (137)gb:AY205084_15891294e-59Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS032D05Sequence558001448 (137)gb:AY205084_15891293e-59Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS032D07Sequence529001448 (137)gb:AY205084_15891294e-57Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS037B09Sequence596001448 (137)gb:STU537575_17231052e-57Solanum tuberosum subsp. tuberosum mRNA for sucrose synthase 4 (sus4 gene).
JMFS037H08Sequence626001448 (137)gb:LES011319_1684455e-111Lycopersicum esculentum mRNA for sucrose synthase.
JMFS040F10Sequence622001448 (137)gb:AY205084_15891298e-73Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS040H11Sequence627001448 (137)gb:AY205084_15891293e-76Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS041C04Sequence623001448 (137)gb:AY205084_15891294e-69Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS042C09Sequence608001448 (137)gb:AY205084_15891293e-68Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS044B05Sequence627001448 (137)gb:AY205084_15891299e-72Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS048D11Sequence585001448 (137)gb:AY205084_15891291e-58Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS051F05Sequence609001448 (137)gb:AY205084_15891293e-68Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS051G04Sequence593001448 (137)gb:AY205084_15891294e-63Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS057B02Sequence620001448 (137)gb:AY205084_15891291e-73Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS060C05Sequence614001448 (137)gb:STU537575_1723105e-109Solanum tuberosum subsp. tuberosum mRNA for sucrose synthase 4 (sus4 gene).
JMFS060D01Sequence642001448 (137)gb:AY205084_15891291e-77Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS063B05Sequence627001448 (137)gb:AY205084_15891292e-72Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS063C01Sequence627001448 (137)gb:AY205084_15891299e-72Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS065F09Sequence627001448 (137)gb:LES011319_1684455e-109Lycopersicum esculentum mRNA for sucrose synthase.
JMFS065G06Sequence627001448 (137)gb:AY205084_15891299e-72Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS066F11Sequence619001448 (137)gb:AY205084_15891295e-70Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS067C09Sequence620001448 (137)gb:AY205084_15891291e-94Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS068D07Sequence627001448 (137)gb:AY205084_15891291e-74Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS071D05Sequence635001448 (137)gb:AY205084_15891294e-75Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS073G08Sequence627001448 (137)gb:AY205084_15891296e-86Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS074A03Sequence627001448 (137)gb:AY205084_15891294e-70Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS076C03Sequence626001448 (137)gb:AY205084_15891296e-97Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS084C01Sequence618001448 (137)sp|P49039|SUS2_SOLTUe-110Sucrose synthase (EC 2.4.1.13) (Sucrose-UDP glucosyltransferase) (SS65).>gb:STU2
JMFS085E02Sequence581001448 (137)gb:STU537575_17231051e-80Solanum tuberosum subsp. tuberosum mRNA for sucrose synthase 4 (sus4 gene).
JMFS086A08Sequence628001448 (137)gb:AY205084_15891291e-71Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS088C02Sequence605001448 (137)gb:AY205084_15891294e-64Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS090F08Sequence627001448 (137)gb:AY205084_15891294e-72Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS090H06Sequence626001448 (137)gb:AY205084_15891291e-73Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS091F03Sequence614001448 (137)gb:AY205084_15891293e-68Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS092B05Sequence616001448 (137)gb:AY205084_15891292e-72Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS094E02Sequence627001448 (137)gb:AY205084_15891299e-72Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS097C06Sequence621001448 (137)gb:AY205084_15891291e-73Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS099F04Sequence609001448 (137)gb:AY205084_15891293e-68Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS100G01Sequence634001448 (137)gb:AY205084_15891291e-73Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS101B07Sequence614001448 (137)gb:AY205084_15891295e-83Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS102E03Sequence621001448 (137)gb:AY205084_15891294e-72Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS107A06Sequence627001448 (137)gb:AY205084_15891299e-72Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS108G02Sequence613001448 (137)gb:AY205084_15891296e-72Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS110H03Sequence625001448 (137)gb:AB055497_1521477e-111Nicotiana tabacum SUSY mRNA for sucrose synthase, partial cds.
JMFS111F11Sequence625001448 (137)gb:LES011319_1684455e-113Lycopersicum esculentum mRNA for sucrose synthase.
JMFS114A11Sequence567001448 (137)gb:AY205084_15891291e-59Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS114G07Sequence573001448 (137)gb:STU537575_1723105e-103Solanum tuberosum subsp. tuberosum mRNA for sucrose synthase 4 (sus4 gene).
JMFS114H08Sequence573001448 (137)gb:STU24087_1722997e-100Solanum tuberosum clone gPOSS16 sucrose synthase gene, complete cds.
JMFS116F10Sequence566001448 (137)gb:AY205084_15891291e-59Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS116G06Sequence564001448 (137)gb:AY205084_15891294e-59Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS117H09Sequence586001448 (137)gb:AY205084_15891291e-62Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS119B09Sequence633001448 (137)gb:AY205084_15891295e-68Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS119E06Sequence627001448 (137)gb:AY205084_15891292e-74Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS121D09Sequence588001448 (137)gb:AY205084_15891296e-59Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS121E01Sequence575001448 (137)gb:AY205084_15891293e-68Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS125B09Sequence575001448 (137)gb:AY205084_15891298e-65Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS128H11Sequence626001448 (137)gb:AY205084_15891293e-82Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS130C11Sequence625001448 (137)gb:AY205084_15891291e-73Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS130G02Sequence626001448 (137)gb:STU24087_1722997e-102Solanum tuberosum clone gPOSS16 sucrose synthase gene, complete cds.
JMFS135D04Sequence561001448 (137)gb:STU537575_1723105e-100Solanum tuberosum subsp. tuberosum mRNA for sucrose synthase 4 (sus4 gene).
JMFS136A03Sequence596001448 (137)gb:AY205084_15891293e-64Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS137H03Sequence604001448 (137)gb:AY205084_15891293e-68Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS138D01Sequence613001448 (137)gb:AY205084_15891294e-64Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS138H02Sequence611001448 (137)gb:AY205084_15891291e-68Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS140C06Sequence626001448 (137)gb:AY205084_15891299e-71Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS147A04Sequence622001448 (137)gb:AY205084_15891291e-94Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS147B11Sequence626001448 (137)gb:AY205084_15891295e-67Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS148C02Sequence626001448 (137)gb:AY205084_15891294e-72Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS150H12Sequence623001448 (137)sp|P10691|SUS1_SOLTUe-110Sucrose synthase (EC 2.4.1.13) (Sucrose-UDP glucosyltransferase) (SS16).>pir|A29
JMFS152E06Sequence620001448 (137)gb:AY205084_15891298e-73Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS153A02Sequence618001448 (137)gb:AY205084_15891292e-72Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS153A03Sequence604001448 (137)gb:AY205084_15891293e-67Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS154F03Sequence642001448 (137)gb:AY205084_15891292e-78Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS154H09Sequence550001448 (137)gb:STU537575_17231057e-49Solanum tuberosum subsp. tuberosum mRNA for sucrose synthase 4 (sus4 gene).
JMFS157G11Sequence463001448 (137)gb:AY205084_15891291e-46Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS158D02Sequence465001448 (137)gb:AY205084_15891291e-46Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS158E11Sequence437001448 (137)gb:AY205084_15891293e-43Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS161F07Sequence557001448 (137)gb:AY205084_15891291e-59Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS162C01Sequence548001448 (137)gb:AY205084_15891296e-59Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS167A12Sequence627001448 (137)gb:AY205084_15891296e-71Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS168D04Sequence621001448 (137)gb:AY205084_15891296e-73Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMFS168F04Sequence627001448 (137)gb:AY205084_15891293e-71Solanum tuberosum sucrose synthase 2 mRNA, complete cds.
JMSF042N23Sequence734001448 (137)gb:AY205084_15891293e-89Solanum tuberosum sucrose synthase 2 mRNA, complete cds.753001448 (137)gb:STU537575_1723105e-102Solanum tuberosum subsp. tuberosum mRNA for sucrose synthase 4 (sus4 gene).

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF006I08- T
                      ____________________________________________________________
consensus T
 
. : . : . : . : . : . :
rJMFF006I08- TCATTCTGGTATTTTTAATGCCAACAATTTTGAATTTTCAAATTTCCAATCTTCTTCCCT
rJMFF022F01- AATTTTGAATTTTC-AATTTCCAATCTTCTTCCCT
rJMFF029A05- ATCTTCTTCCCT
rJMFF041B23- AATGCCAACAATTTTGAATTTTCAAATTTCCAATCTTCTTCCCT
JMFN017E14+ GCCAACAATTTTGAATTTTCAAATTTCCAATCTTCTTCCCT
rJMFF048E20- AATTTTGAATTTTCAAATTTCCAATCTTCTTCCCT
JMFS154H09- AATGCCAACAATTTTGAATTTTCAAATTTCCAATCTTCTTCCCT
rJMFF047H14- AATGCCAACAATTTTGAATTTTCAAATTTCCAATCTTCTTCCCT
rJMFF047P13- AATGCCAACAATTTTGAATTTTCAAATTTCCAATCTTCTTCCCT
rJMFF006B10- TTTTTAATGCCAACAATTTTGAATTTTCAAATTTCCAATCTTCTTCCCT
rJMFF032C16- TTTTGAATTTTC-NATTTCCAATCTTCTTCCCT
rJMFF027B20- ATTTTC-AATTTCC-ATCTTCTTCCCT
rJMFF006B15- TTTTG-ATTTTC-AATTTCC-ATCTTCTTCCCT
rJMFF029L11- TTTTG-ATTTTC-AATTTCC-ATCTTCTTCCCT
rJMFF017A07- TTTTG-ATTTTC-AATTTCCAATCTTCTTCCCT
rJMFF009B11- ATTTTC-AATTTCCAATCTTCTTCCCT
rJMFF031G02- ATTTTC-AATTTCCAATCTTCTTCCCT
rJMFF010C21- TTTTG-ATTTTC-AATTTCCAATCTTCTTCCCT
rJMFF022A18- TTTG-ATTTTC-AATTTCC-ATCTTCTTCCCT
rJMSF042N23- C-ATCTTCTT-CCT
                      ____________________________________________________________
consensus TCATTCTGGTATTTTTAATGCCAACAATTTTGAATTTTC-AATTTCCAATCTTCTTCCCT
 
. : . : . : . : . : . :
rJMFF006I08- AAATACACAGAAATTGAAAAG-CAAAAAAAATACAAAACAAACGAGAATCATTCGTTAAA
rJMFF022F01- AAATACACAGAAATTGAAAAG-CAAAAAAAATACAAAACAAACGAGAATCATTCGTTAAA
rJMFF029A05- AAATACACAGAAATTGAAAAG-CAAAAAAAATACAAAACAAACGAGAATCATTCGTTAAA
rJMFF041B23- AAATACACAGAAATTGAAAAG-CAAAAAAAATACAAAACAAACGAGAATCATTCGTTAAA
JMFN017E14+ AAATACACAGAAATTGAAAAG-CAAAAAAAATACAAAACAAACGAGAATCATTCGTTAAA
rJMFF048E20- AAATACACAGAAATTGAAAAGCCAAAAAAAATACAAAACAAACGAAAATCATTCGTTAAA
JMFS154H09- AAATACACAGAAATTGAAAAG-CAAAAAAAATACAAAACAAACGAGAATCATTCGTTAAA
rJMFF047H14- AAATACACAGAAATTGAAAAG-CAAAAAAAATACAAAACAAACGAGAATCATTCGTTAAA
JMFS037B09+ G-CAAAAAAAATTCAAAACAACGANGAATCATTCGTTAAN
rJMFF047P13- AAATACACAGAAATTGAAAAG-CAAAAAAAATACAAAACAAACGAGAATCATTCGTTAAA
rJMFF006B10- AAATACACAGAAATTGAAAAG-CAAAAAAAATACAAAACAAACGAGAATCATTCGTTAAA
rJMFF032C16- AAATACACAGAAATTGAAAAG-CAAAAAAAATACAAAACAAACGAGAATCATTCGTTAAA
rJMFF027B20- AAATACACAGAAATTGAAAAG-CAAAAAAAATACAAAACAAACGAGAATCATTCGTTAAA
rJMFF006B15- AAATACACAGAAATTGAAAAG-CAAAAAAAATACAAAACAAACGAGAATCATTCGTTAAA
rJMFF029L11- AAATACACAGAAATTGAAAAG-CAAAAAAAATACAAAACAAACGAGAATCATTCGTTAAA
rJMFF045I15- TCGTTAAA
rJMFF017A07- AAATACACAGAAATTGAAAAG-CAAAAAAAATACAAAACAAACGAGAATCATTCGTTAAA
rJMFF009B11- AAATACACAGAAATTGAAAAG-CAAAAAAAATACAAAACAAACGAGAATCATTCGTTAAA
rJMFF031G02- AAATACACAGAAATTGAAAAG-AAAAAAAAATACAAAACAAACGAGAATCATTCGTTAAA
rJMFF010C21- AAATACACAGAAATTGAAAAG-CAAAAAAAATACAAAACAAACGAGAATCATTCGTTAAA
rJMFF022A18- AAATACACAGAAATTGAAAAG-CAAAAAAAATACAAAACAAACGAGAATCATTCGTTAAA
rJMSF042N23- AAATACACAGAAATTGAAAAG-CAAAAAAAATACAAAACAAACGAGAATCATTCGTTAAA
                      ____________________________________________________________
consensus AAATACACAGAAATTGAAAAG-CAAAAAAAATACAAAACAAACGAGAATCATTCGTTAAA
 
. : . : . : . : . : . :
rJMFF006I08- CAGAAGCAGCCTCTTGAAATGATGAAAATCTCAGATTGGTTTTTCTTATTTATTCATTCA
rJMFF022F01- CAGAAGCAGCCTCTTGAAATGATGAAAATCTCAGATTGGTTTTTCTTATTTATTCATTCA
rJMFF029A05- CAGAAGCAGCCTCTTGAAATGATGAAAATCTCAGATTGGTTTTTCTTATTTATTCATTCA
rJMFF041B23- CAGAAGCAGCCTCTTGAAATGATGAAAATCTCAGATTGGTTTTTCTTATTTATTCATTCA
JMFN017E14+ CAGAAGCAGCCTCTTGAAATGATGAAAATCTCAGATTGGTTTTTCTTATTTATTCATTCA
rJMFF048E20- CAGAAGCCGCCTCTTGAAATGAGGAAAATCTCAAAAGGGTTTTTCTTATTTATTCATTCA
JMFS154H09- CAGAAGCAGCCTCTTGAAATGATGAAAATCTCAGATGGGTTTTTCTTATTTATTCATTCA
rJMFF047H14- CAGAAGCAGCCTCTTGAAATGATGAAAATCTCAGATTGGTTTTTCTTATTTATTCATTCA
JMFS037B09+ CAGAAGCAGCCTCTTGAAATGATGAAAATCTCAGATTGGTTTTTCTTATTTATTCATTCA
rJMFF047P13- CAGAAGCAGCCTCTTGAAATGATGAAAATCTCAGATTGGTTTTTCTTATTTATTCATTCA
rJMFF006B10- CAGAAGCAGCCTCTTGAAATGATGAAAATCTCAGATTGGTTTTTCTTATTTATTCATTCA
rJMFF032C16- CAGAAGCAGCCTCTTGAAATGATGAAAATCTCAGATTGGTTTTTCTTATTTATTCATTCA
rJMFF027B20- CAGAAGCAGCCTCTTGAAATGATGAAAATCTCAGATTGGTTTTTCTTATTTATTCATTCA
rJMFF006B15- CAGAAGCAGCCTCTTGAAATGATGAAAATCTCAGATTGGTTTTTCTTATTTATTCATTCA
rJMFF029L11- CAGAAGCAGCCTCTTGAAATGATGAAAATCTCAGATTGGTTTTTCTTATTTATTCATTCA
rJMFF045I15- CAGAAGCAGCCTCTTGAAATGATGAAAATCTCAGATTGGTTTTTCTTATTTATTCA-TAA
rJMFF017A07- CAGAAGCAGCCTCTTGAAATGATGAAAATCTCAGATTGGTTTTTCTTATTTATTCATTCA
rJMFF009B11- CAGAAGCAGCCTCTTGAAATGATGAAAATCTCAGATTGGTTTTTCTTATTTATTCATTCA
rJMFF031G02- CAGAAGCAGCCTCTTGAAATGATGAAAATCTCAGATTGGTTTTTCTTATTTATTCATTCA
rJMFF010C21- CAGAAGCAGCCTCTTGAAATGATGAAAATCTCAGATTGGTTTTTCTTATTTATTCATTCA
rJMFF022A18- CAGAAGCAGCCTCTTGAAATGATGAAAATCTCAGATTGGTTTTTCTTATTTATTCATTCA
rJMSF042N23- CAGAAGCAGCCTCTTGAAATGATGAAAATCTCAGATTGGTTTTTCTTATTTATTCATTCA
                      ____________________________________________________________
consensus CAGAAGCAGCCTCTTGAAATGATGAAAATCTCAGATTGGTTTTTCTTATTTATTCATTCA
 
. : . : . : . : . : . :
rJMFF006I08- AATTCAGCCTCTCTCCCTCCGGGCATTGCCTTCTTCTTCATCTTCTTTACTCCTCTGCCA
rJMFF022F01- AATTCAGCCTCTCTCCCTCCGGGCATTGCCTTCTTCTTCATCTTCTTTACTCCTCTGCCA
rJMFF029A05- AATTCAGCCTCTCTCCCTCCGGGCATTGCCTTCCTCTTCATCTTCTTTACTCCTCTGCCA
rJMFF041B23- AATTCAGCCTCTCTCCCTCCGGGCATTGCCTTCTTCTTCATCTTCTTTACTCCTCTGCCA
JMFN017E14+ AATTCAGCCTCTCTCCCTCCGGGCATTGCCTTCTTCTTCATCTTCTTTACTCCTCTGCCA
rJMFF048E20- AATTCCGCCTCTCTCCCTCGGGGGATTGGCTTCTTCTTCATCTTCTTTACTCCCCTGCCA
JMFS154H09- AATTCAGCCTCTCTCCCTCCGGGCATTGCCTTCTTCTTCATCTTCTTTACTCCTCTGCCA
rJMFF047H14- AATTCAGCCTCTCTCCCTCCGGGCATTGCCTTCTTCTTCATCTTCTTTACTCCTCTGCCA
JMFS037B09+ AATTCAGCCTCTCTCCCTCCGGGCATTGCCTTCTTCTTCATCTTCTTTACTCCTCTGCCA
rJMFF047P13- AATTCAGCCTCTCTCCCTCCGGGCATTGCCTTCTTCTTCATCTTCTTTACTCCTCTGCCA
rJMFF006B10- AATTCAGCCTCTCTCCCTCCGGGCATTGCCTTCTTCTTCATCTTCTTTACTCCTCTGCCA
rJMFF032C16- AATTCAGCCTCTCTCCCTCCGGGCATTGCCTTCTTCTTCATCTTCTTTACTCCTCTGCCA
rJMFF027B20- AATTCAGCCTCTCTCCCTCCGGGCATTGCCTTCTTCTTCATCTTCTTTACTCCTCTGCCA
rJMFF006B15- AATTCAGCCTCTCTCCCTCCGGGCATTGCCTTCTTCTTCATCTTCTTTACTCCTCTGCCA
rJMFF029L11- AATTCAGCCTCTCTCCCTCCGGGCATTGCCTTCTTCTTCATCTTCTTTACTCCTCTGCCA
rJMFF045I15- AATTCCTCCTCTCTCCCTCCGGGCATTGCCTTCTTCTTCATCTTCTTTACTCCTCTGCCA
rJMFF017A07- AATTCAGCCTCTCTCCCTCCGGGCATTGCCTTCTTCTTCATCTTCTTTACTCCTCTGCCA
rJMFF009B11- AATTCAGCCTCTCTCCCTCCGGGCATTGCCTTCTTCTTCATCTTCTTTACTCCTCTGCCA
rJMFF031G02- AATTCAGCCTCTCTCCCTCCGGGCATTGCCTTCTTCTTCATCTTCTTTACTCCTCTGCCA
rJMFF010C21- AATTCAGCCTCTCTCCCTCCGGGCATTGCCTTCTTCTTCATCTTCTTTACTCCTCTGCCA
rJMFF022A18- AATTCAGCCTCTCTCCCTCCGGGCATTGCCTTCTTCTTCATCTTCTTTACTCCTCTGCCA
rJMSF042N23- AATTCAGCCTCTCTCCCTCCGGGCATTGCCTTCTTCTTCATCTTCTTTACTCCTCTGCCA
                      ____________________________________________________________
consensus AATTCAGCCTCTCTCCCTCCGGGCATTGCCTTCTTCTTCATCTTCTTTACTCCTCTGCCA
 
. : . : . : . : . : . :
rJMFF006I08- ATGGCACAGCCTCGGCCAATTTGCGGTATTTGAGAGCATAAAACATTTCCAGATAGCGAC
rJMFF022F01- ATGGCACAGCCTCGGCCAATTTGCGGTATTTGAGAGCATAAAACATTTCCAGATAGCGAC
rJMFF029A05- ATGGCACAGCCTCGGCCAATTTGCGGTATTTGAGAGCATAAAACATTTCCAGATAGCGAC
rJMFF041B23- ATGGCACAGCCTCGGCCAATTTGCGGTATTTGAGAGCATAAAACATTTCCAGATAGCGAC
JMFN017E14+ ATGGCACAGCCTCGGCCAATTTGCGGTATTTGAGAGCATAAAACATTTCCAGATAGCGAC
rJMFF048E20- AGGGCACAGCCTCGGCAAATTTG
JMFS154H09- ATGGCACAGCCTCGGCCAATTTGCGGTATTTGAGAGCATAAAACATTTCCAGATAGCGAC
rJMFF047H14- ATGGCACAGCCTCGGCCAATTTGCGGTATTTGAGAGCATAAAACATTTCCAGATAGCGAC
JMFS037B09+ ATGGCACAGCCTCGGCCAATTTGCGGTATTTGAGAGCATAAAACATTTCCAGATAGCGAC
rJMFF047P13- ATGGCACAGCCTCGGCCAATTTGCGGTATTTGAGAGCATAAAACATTTCCAGATAGCGAC
rJMFF006B10- ATGGCACAGCCTCGGCCAATTTGCGGTATTTGAGAGCATAAAACATTTCCAGATAGCGAC
rJMFF032C16- ATGGCACAGCCTCGGCCAATTTGCGGTATTTGAGAGCATAAAACATTTCCAGATAGCGAC
rJMFF027B20- ATGGCACAGCCTCGGCCAATTTGCGGTATTTGAGAGCATAAAACATTTCCAGATAGCGAC
rJMFF006B15- ATGGCACAGCCTCGGCCAATTTGCGGTATTTGAGAGCATAAAACATTTCCAGATAGCGAC
rJMFF029L11- ATGGCACAGCCTCGGCCAATTTGCGGTATTTGAGAGCATAAAACATTTCCAGATAGCGAC
rJMFF045I15- ATGGCCCACCCTCGGGCAATTTGCGGTATTTGAGAGCATAAAACATTTCCAGATAGGGAC
rJMFF017A07- ATGGCACAGCCTCGGCCAATTTGCGGTATTTGAGAGCATAAAACATTTCCAGATAGCGAC
rJMFF009B11- ATGGCACAGCCTCGGCCAATTTGCGGTATTTGAGAGCATAAAACATTTCCAGATAGCGAC
rJMFF031G02- ATGGCACAGCCTCGGCCAATTTGCGGTATTTGAGAGCATAAAACATTTCCAGATAGCGAC
rJMFF010C21- ATGGCACAGCCTCGGCCAATTTGCGGTATTTGAGAGCATAAAACATTTCCAGATAGCGAC
rJMFF022A18- ATGGCACAGCCTCGGCCAATTTGCGGTATTTGAGAGCATAAAACATTTCCAGATAGCGAC
rJMSF042N23- ATGGCACAGCCTCGGCCAATTTGCGGTATTTGAGAGCATAAAACATTTCCAGATAGCGAC
JMFS114G07+ ATTTGAGAGCATAAAACATTTCCAGATAGCGAC
JMFS026E01+ GCATAAAACA-TTCCAGATAGCGAC
                      ____________________________________________________________
consensus ATGGCACAGCCTCGGCCAATTTGCGGTATTTGAGAGCATAAAACATTTCCAGATAGCGAC
 
. : . : . : . : . : . :
rJMFF006I08- GGATCTCCAGGCGATCCAGCTTCGAAACATGCTTCCAGAACCCATAAACAGCCGCCAGTG
rJMFF022F01- GGATCTCCAGGCGATCCAGCTTCGAAACATGCTTCCAGAACCCATAAACAGCCGCCAGTG
rJMFF029A05- GGATCTCCAGGCGATCCAGCTTCGAAACATGCTTCCAGAACCCATAAACAGCCGCCAGTG
rJMFF041B23- GGATCTCCAGGCGATCCAGCTTCGAAACATGCTTCCAGAACCCATAAACAGCCGCCAGTG
JMFN017E14+ GGATCTCCAGGCGATCCAGCTTCGAAACATGCTTCCAGAACCCATAAACAGCCGCCAGTG
JMFS154H09- GGATCTCCAGGCGATCCAGCTTCGAAACATGCTTCCAGAACCCATAAACAGCCGCCAGTG
rJMFF047H14- GGATCTCCAGGCGATCCAGCTTCGAAACATGCTTCCAGAACCCATAAACAGCCGCCAGTG
JMFS037B09+ GGATCTCCAGGCGATCCAGCTTCGAAACATGCTTCCAGAACCCATAAACAGCCGCCAGTG
rJMFF047P13- GGATCTCCAGGCGATCCAGCTTCGAAACATGCTTCCAGAACCCATAAACAGCCGCCAGTG
rJMFF006B10- GGATCTCCAGGCGATCCAGCTTCGAAACATGCTTCCAGAACCCATAAACAGCCGCCAGTG
rJMFF032C16- GGATCTCCAGGCGATCCAGCTTCGAAACATGCTTCCAGAACCCATAAACAGCCGCCAGTG
rJMFF027B20- GGATCTCCAGGCGATCCAGCTTCGAAACATGCTTCCAGAACCCATAAACAGCCGCCAGTG
rJMFF006B15- GGATCTCCAGGCGATCCAGCTTCGAAACATGCTTCCAGAACCCATAAACAGCCGCCAGTG
rJMFF029L11- GGATCTCCAGGCGATCCANCTTCGAAACATGCTTCCAGAACCCATAAACAGCCGCCAGTG
rJMFF045I15- GGATCTCCAGGCGATCCGGCTTCTAAACATGCTTCCAGAATCCCTAAAAAGCCGCCAGTG
rJMFF017A07- GGATCTCCAGGCGATCCAGCTTCGAAACATGCTTCCAGAACCCATAAACAGCCGCCAGTG
rJMFF009B11- GGATCTCCAGGCGATCCAGCTTCGAAACATGCTTCCAGAACCCATAAACAGCCGCCAGTG
rJMFF031G02- GGATCTCCAGGCGATCCAGCTTCGAAACATGCTTCCAGAACCCATAAACAGCCGCCAGTG
rJMFF010C21- GGATCTCCAGGCGATCCAGCTTCGAAACATGCTTCCAGAACCCATAAACAGCCGCCAGTG
rJMFF022A18- GGATCTCCAGGCGATCCAGCTTCGAAACATGCTTCCAGAACCCATAAACAGCCGCCAGTG
rJMSF042N23- GGATCTCCAGGCGATCCAGCTTCGAAACATGCTTCCAGAACCCATAAACAGCCGCCAGTG
JMFS114G07+ GGATCTCCAGGCGATCCAGCTTCGAAACATGCTTCCAGAACCCATAAACAGCCGCCAGTG
JMFS026E01+ GGATCTCCAGGCGATCCAGCTTCGAAACATGCTTCCAGAACCCATAAACAGCCGCCAGTG
JMFN042P11+ GATCCAGCTTCGAAACATGCTCNCAGAACCCATAAACAGCCGCCAGTG
JMFS060C05+ CAGCCGCCAGTG
JMFS028F12+ CAGCCGCCAGTG
                      ____________________________________________________________
consensus GGATCTCCAGGCGATCCAGCTTCGAAACATGCTTCCAGAACCCATAAACAGCCGCCAGTG
 
. : . : . : . : . : . :
rJMFF006I08- TCAACAGCCGGTCTGAATATATCTGCCATGTATACTTCTCCTGGATACGTTTCAACCCGC
rJMFF022F01- TCAACAGCCGGTCTGAATATATCTGCCATGTATACTTCTCCTGGATACGTTTCAACCCGC
rJMFF029A05- TCAACAGCCGGTCTGAATATATCTGCCATGTATACTTCTCCTGGATACGTTTCAACCCGC
rJMFF041B23- TCAACAGCCGGTCTGAATATATCTGCCATGTATACTTCTCCTGGATACGTTTCAACCCGC
JMFN017E14+ TCAACAGCCGGTCTGAATATATCTGCCATGTATACTTCTCCTGGATACGTTTCAACCCGC
JMFS154H09- TCAACAGCCGGTCTGAATATATCTGCCATGTATACTTCTCCTGGATACGTTTCAACCCGC
rJMFF047H14- TCAACAGCCGGTCTGAATATATCTGCCATGTATACTTCTCCTGGATACGTTTCAACCCGC
JMFS037B09+ TCAACAGCCGGTCTGAATATATCTGCCATGTATACTTCTCCTGGATACGTTTCAACCCGC
rJMFF047P13- TCAACAGCCGGTCTGAATATATCTGCCATGTATACTTCTCCTGGATACGTTTCAACCCGC
rJMFF006B10- TCAACAGCCGGTCTGAATATATCTGCCATGTATACTTCTCCTGGATACGTTTCAACCCGC
rJMFF032C16- TCAACAGCCGGTCTGAATATATCTGCCATGTATACTTCTCCTGGATACGTTTCAACCCGC
rJMFF027B20- TCAACAGCCGGTCTGAATATATCTGCCATGTATACTTCTCCTGGATACGTTTCAACCCGC
rJMFF006B15- TCAACAGCCGGTCTGAATATATCTGCCATGTATACTTCTCCTGGATACGTTTCAACCCGC
rJMFF029L11- TCAACAGCCGGTCTGAATATATCTGCCATGTATACTTCTCCTGGATACGTTTCAACCCGC
rJMFF045I15- TCAACAGCCGGCCTGAATAAATCTGCCATGAAAACTTCTCCTGGATACGTTTCAACCCGC
rJMFF017A07- TCAACAGCCGGTCTGAATATATCTGCCATGTATACTTCTCCTGGATACGTTTCAACCCGC
rJMFF009B11- TCAACAGCCGGTCTGAATATATCTGCCATGTATACTTCTCCTGGATACGTTTCAACCCAC
rJMFF031G02- TCAACAGCCGGTCTGAATATATCTGCCATGTATACTTCTCCTGGATACGTTTCAACCCGC
rJMFF010C21- TCAACAGCCGGTCTGAATATATCTGCCATGTATACTTCTCCTGGATACGTTTCAACCCGC
rJMFF022A18- TCAACAGCCGGTCTGAATATATCTGCCATGTATACTTCTCCTGGATACGTTTCAACCCGC
rJMSF042N23- TCAACAGCCGGTCTGAATATATCTGCCATGTATACTTCTCCTGGATACGTTTCAACCCGC
JMFS114G07+ TCAACAGCCGGTCTGAATATATCTGCCATGTATACTTCTCCTGGATACGTTTCAACCCGC
JMFS085E02+ TACTTCTCCTGGATACGTTTCAACCCGC
JMFS026E01+ TCAACAGCCGGTCTGAATATATCTGCCATGTATACTTCTCCTGGATACGTTTCAACCCGC
JMFN042P11+ TCAACAGCCGGTCTGAATATATCTGCCATGTATACTTCTCCTGGATACGTTTCAACCCGC
JMFS060C05+ TCAACAGCCGGTCTGAATATATCTGCCATGTATACTTCTCCTGGATACGTTTCAACCCGC
JMFS135D04+ CTGCCATGTATACTTCTCCTGGATACGTTTCAACCCGC
JMFS028F12+ TCAACAGCCGGTCTGAATATATCTGCCATGTATACTTCTCCTGGATACGTTTCAACCCGC
JMFS150H12+ GATACGTTTCAACCCGC
                      ____________________________________________________________
consensus TCAACAGCCGGTCTGAATATATCTGCCATGTATACTTCTCCTGGATACGTTTCAACCCGC
 
. : . : . : . : . : . :
rJMFF006I08- CCGCTGAGATGGTTTCCCAGTGGGAAGGATCCTTCTTGGACTTCTCGAAGAAATCAACGA
rJMFF022F01- CCGCTGAGATGGTTTCCCAGTGGGAAGGATCCTTCTTGGACTTCTCGAAGAAATCAACGA
rJMFF029A05- CCGCTGAGATGGTTTCCCAGTGGGAAGGATCCTTCTTGGACTTCTCGAAGAAATCAACGA
rJMFF041B23- CCGCTGAGATGGTTTCCCAGTGGGAAGGATCCTTCTTGGACTTCTCGAAGAAATCAACGA
JMFN017E14+ CCGCTGAGATGGTTTCCCAGTGGGAAGGATCCTTCTTGGACTTCTCGAAGAAATCAACGA
JMFS154H09- CCGCTGAGATGGTTTCCCAGTGGGAAGGATCCTTCTTGGACTTCTCGAAGAAATCAACGA
rJMFF047H14- CCGCTGAGATGGTTTCCCAGTGGGAAGGATCCTTCTTGGACTTCTCGAAGAAATCAACGA
JMFS037B09+ CCGCTGAGATGGTTTCCCAGTGGGAAGGATCCTTCTTGGACTTCTCGAAGAAATCAACGA
rJMFF047P13- CCGCTG
rJMFF006B10- CCGCTGAGATGGTTTCCCAGTGGGAAGGATCCTTCTTGGACTTCTCGAAGAAATCAACGA
rJMFF032C16- CCGCTGAGATGGTTTCCCAGTGGGAAGGATCCTTCTTGGACTTCTCGAAGAAATCAACGA
rJMFF027B20- CCGCTGAGATGGTTTCCCAGTGGGAAGGATCCTTCTTGGACTTCTCGAAGAAATCAACGA
rJMFF006B15- CCGCTGAGATGGTTTCCCAGTGGGAAGGATCCTTCTTGGACTTCTCGAAGAAATCAACGA
rJMFF029L11- CCGCTGAGATGGTTTCCCAGTGGGAAGGATCCTTCTTGGACTTCTCGAAGAAATCAACGA
rJMFF045I15- CCGCTGAGATGGTTTCCCAGCGGGAAGGATCCTTCTTGGACTTCTCCAACACATCCACGA
rJMFF017A07- CCGCTGAGATGGTTTCCCAGTGGGAAGGATCCTTCTTGGACTTCTCGAAGAAATCAACGA
rJMFF009B11- CCGCTGAGATGGTTTCCCAGTGGGAAGGATCCTTCTTGGACTTCTCGAAGAAATCAACGA
rJMFF031G02- CCGCTGAGATGGTTTCCCAGTGGGAAGGATCCTTCTTGGACTTCTCGAAGAAATCAACGA
rJMFF010C21- CCGCTGAGATGGTTTCCCAGTGGGAAGGATCCTTCTTGGACTTCTCGAAGAAATCAACGA
rJMFF022A18- CCGCTGAGATGGTTTCCCAGTGGGAAGGATCCTTCTTGGACTTCTCGAAGAAATCAACGA
rJMSF042N23- CCGCTGAGATGGTTTCCCAGTGGGAAGGATCCTTCTTGGACTTCTCGAAGAAATCAACGA
JMFS114G07+ CCGCTGAGATGGTTTCCCAGTGGGAAGGATCCTTCTTGGACTTCTCGAAGAAATCAACGA
JMFS085E02+ CCGCTGAGATGGTTTCCCAGTGGGAAGGATCCTTCTTGGACTTCTCGAAGAAATCAACGA
JMFS026E01+ CCGCTGAGATGGTTTCCCAGTGGGAAGGATCCTTCTTGGACTTCTCGAAGAAATCAACGA
JMFN042P11+ CCGCTGAGATGGTTTCCCAGTGGGAAGGATCCTTCTTGGACTTCTCGAAGAAATCAACGA
JMFS060C05+ CCGCTGAGATGGTTTCCCAGTGGGAAGGATCCTTCTTGGACTTCTCGAAGAAATCAACGA
JMFS135D04+ CCGCTGAGATGGTTTCCCAGTGGGAAGGATCCTTCTTGGACTTCTCGAAGAAATCAACGA
JMFS028F12+ CCGCTGAGATGGTTTCCCAGTGGGAAGGATCCTTCTTGGACTTCTCGAAGAAATCAACGA
JMFS150H12+ CCGCTGAGATGGTTTCCCAGTGGGAAGGATCCTTCTTGGACTTCTCGAAGAAATCAACGA
                      ____________________________________________________________
consensus CCGCTGAGATGGTTTCCCAGTGGGAAGGATCCTTCTTGGACTTCTCGAAGAAATCAACGA
 
. : . : . : . : . : . :
rJMFF006I08- GGAGCTCGGCGGCCTGTTCACCGTGGTATGGATCAATGTGGAAG-CCAGACTTGCCATGG
rJMFF022F01- GGAGCTCGGCGGCCTGTTCACCGTGGTATGGATCAATGTGGAAG-CCAGACTTGCCATGG
rJMFF029A05- GGAGCTCGGCGGCCTGTTCACCGTGGTATGGATCAATGTGGAAG-CCAGACTTGCCATGG
rJMFF041B23- GGAGCTCGGCGGCCTGTTCACCGTGGTATGGATCAATGTGGAAG-CCAGACTTGCCATGG
JMFN017E14+ GGAGCTCGGCGGCCTGTTCACCGTGGTATGGATCAATGTGGAAG-CCAGACTTGCCATGG
JMFS154H09- GGAGCTCGGCGGCCTGTTCACCGTGGTATGGATCAATGTGGAAG-CC
rJMFF047H14- GGAGC
JMFS037B09+ GGAGCTCGGCGGCCTGTTCACCGTGGTATGGATCAATGTGGAAG-CCAGACTTGCCATGG
rJMFF006B10- GGAGCTCGGCGGCCTGTTCACCGTGGTATGGATCAATGTGGAAG-CCAGACTTGCCATGG
rJMFF032C16- GGAGCTCGGCGGCCTGTTCACCGTGGTATGGATCAATGTGGAAG-CCAGACTTGCCATGG
rJMFF027B20- GGAGCTCGGCGGCCTGTTCACCGTGGTATGGATCAATGTGGAAG-CCAGACTTGCCATGG
rJMFF006B15- GGAGCTCGGCGGCCTGTTCACCGTGGTATGGATCAATGTGGAAG-CCAGACTTGCCATGG
rJMFF029L11- GGAGCTCGGCGGCCTGTTCACCGTGGTATGGATCAATGTGGAAG-CCAGACTTGCCATGG
rJMFF045I15- GGAGCTCTTCCGCCTGGACACCATGCTATGGATCAATGTGGAAGAACATACTTGCCATGG
rJMFF017A07- GGAGCTCGGCGGCCTGTTCACCGTGCTATGGATCAATGTGGAAG-CCAGACTTGCCATGG
rJMFF009B11- GGAGCTCGGCGGCCTGTTCACCGTGGTATGGATCAATGTGGAAG-CCAGACTTGCCATGG
rJMFF031G02- GGAGCTCGGCGGCCTGTTCACCGTGGTATGGATCAATGTGGAAG-CCAGACTTGCCATGG
rJMFF010C21- GGAGCTCGGCGGCCTGTTCACCGTGGTATGGATCAATGTGGAAG-CCAGACTTGCCATGG
rJMFF022A18- GGAGCTCGGCGGCCTGTTCACCGTGGTATGGATCAATGTGGAAG-CCAGACTTGCCATGG
rJMSF042N23- GGAGCTCGGCGGCCTGTTCACCGTGGTATGGATCAATGTGGAAG-CCAGACTTGCCATGG
JMFS114G07+ GGAGCTCGGCGGCCTGTTCACCGTGGTATGGATCAATGTGGAAG-CCAGACTTGCCATGG
JMFS085E02+ GGAGCTCGGCGGCCTGTTCACCGTGGTATGGATCAATGTGGAAG-CCAGACTTGCCATGG
JMFS026E01+ GGAGCTCGGCGGCCTGTTCACCGTGGTATGGATCAATGTGGAAG-CCAGACTTGCCATGG
JMFN042P11+ GGAGCTCGGCGGCCTGTTCACCGTGGTATGGATCAATGTGGAAG-CCAGACTTGCCATGG
JMFS060C05+ GGAGCTCGGCGGCCTGTTCACCGTGGTATGGATCAATGTGGAAG-CCAGACTTGCCATGG
JMFS135D04+ GGAGCTCGGCGGCCTGTTCACCGTGGTATGGATCAATGTGGAAG-CCAGACTTGCCATGG
JMFS028F12+ GGAGCTCGGCGGCCTGTTCACCGTGGTATGGATCAATGTGGAAG-CCAGACTTGCCATGG
JMFS150H12+ GGAGCTCGGCGGCCTGTTCACCGTGGTATGGATCAATGTGGAAG-CCAGACTTGCCATGG
JMFS111F11+ CGTGGTATGGATCAATGTGGAAG-CCAGACTTGCCATGG
JMFS065F09+ ATGG
                      ____________________________________________________________
consensus GGAGCTCGGCGGCCTGTTCACCGTGGTATGGATCAATGTGGAAG-CCAGACTTGCCATGG
 
. : . : . : . : . : . :
rJMFF006I08- ACGATGATCTCGGCTGGGCCTCCTTGGTTAGTAGCGAAGGTGGGCAAACCACAGGTCATG
rJMFF022F01- ACGATGATCTCGGCTGGGCCTCCTTGGTTAGTAGCGAAGGTGGGCAAACCACAGGTCATG
rJMFF029A05- ACGATGATCTCGGCTGGGCCTCCTTGGTTAGTAGCGAAGGTGGGCAAACCACAGGTCATG
rJMFF041B23- ACGATGATCTCGGCTGGGCCTCCTTGGTTAGTAGCGAAGGTGGGCAAACCACAGGT
JMFN017E14+ ACGATGATC
JMFS037B09+ ACGATGATCCCGGCTGGGCCTCCTT
rJMFF006B10- ACGATGATCTCGGCTGGGCCTCCTTGGTTAGTAGCGAAGGTGGGCAAACCACAGGTCATG
rJMFF032C16- ACGATGATCTCGGCTGGGCCTCCTTGGTTAGTAGCGAAGGTGGGCAAACCACAGGTCATG
rJMFF027B20- ACGATGATCTCGGCTGGGCCTCCTTGGTTAGTAGCGAAGGTGGGCAAACCACAGGTCATG
rJMFF006B15- ACGATGATCTCGGCTGGGCCTCCTTGGTTAGTAGCGAAGGTGGGCAAACCACAGGTCATG
rJMFF029L11- ACGATGATCTCGGCTGGGCCTCCTTGGTTAGTAGCGAANGTGGGCAAACCACAGGTCATG
rJMFF045I15- ACGAT
rJMFF017A07- ACGATGATCTCGGCTGGGCCTCCTTGGTTAGTAGCGAAGGTGGGCAAACCACAGGTCATG
rJMFF009B11- ACGATGATCTCGGCTGGGCCTCCTTGGTTAGTAGCGAAGGTGGGCAAACCACAGGTCATG
rJMFF031G02- ACGATGATCTCGGCTGGGCCTCCTTGGTTAGTAGCGAAGGTGGGCAAACCACAGGTCATG
rJMFF010C21- ACGATGATCTCGGCTGGGCCTCCTTGGTTAGTAGCGAAGGTGGGCAAACCACAGGTCATG
rJMFF022A18- ACGATGATCTCGGCTGGGCCTCCTTGGTTAGTAGCGAAGGTGGGCAAACCACAGGTCATG
rJMSF042N23- ACGATGATCTCGGCTGGGCCTCCTTGGTTAGTAGCGAAGGTGGGCAAACCACAGGTCATG
JMFS114G07+ ACGATGATCTCGGCTGGGCCTCCTTGGTTAGTAGCGAAGGTGGGCAAACCACAGGTCATG
JMFS085E02+ ACGATGATCTCGGCTGGGCCTCCTTGGTTAGTAGCGAAGGTGGGCAAACCACAGGTCATG
JMFS026E01+ ACGATGATCTCGGCTGGGCCTCCTTGGTTAGTAGCGAAGGTGGGCAAACCACAGGTCATG
JMFN042P11+ ACGATGATCTCGGCTGGGCCTCCTTGGTTAGTAGCGAAGGTGGGCAAACCACAGGTCATG
JMFS060C05+ ACGATGATCTCGGCTGGGCCTCCTTGGTTAGTAGCGAAGGTGGGCAAACCACAGGTCATG
JMFS135D04+ ACGATGATCTCGGCTGGGCCTCCTTGGTTAGTAGCGAAGGTGGGCAAACCACAGGTCATG
JMFS028F12+ ACGATGATCTCGGCTGGGCCTCCTTGGTTAGTAGCGAAGGTGGGCAAACCACAGGTCATG
JMFS150H12+ ACGATGATCTCGGCTGGGCCTCCTTGGTTAGTAGCGAAGGTGGGCAAACCACAGGTCATG
JMFS111F11+ ACGATGATCTCGGCTGGGCCTCCTTGGTTAGTAGCGAAGGTGGGCAAACCACAGGTCATG
JMFS065F09+ ACGATGATCTCGGCTGGGCCTCCTTGGTTAGTAGCGAAGGTGGGCAAACCACAGGTCATG
                      ____________________________________________________________
consensus ACGATGATCTCGGCTGGGCCTCCTTGGTTAGTAGCGAAGGTGGGCAAACCACAGGTCATG
 
. : . : . : . : . : . :
rJMFF006I08- GCCTCCACCACAGTCAACCCGAAGG-CCTCATAGAAGGCGGGTTGAACGAAGGCTCCCCG
rJMFF022F01- GCCTCCACCACAGTCAACCCGAAGG-CCTCATAGAAGGCGGGTTGAACGAAGGCTCCCCG
rJMFF029A05- GCCTCCACCACAGTCAACCCGAAGG-CCTCATAGAAGG-GGGTTGAACGAAGGCTCCCCG
rJMFF006B10- GCCTCCACCACAGTCAACCCGAAGG-CCTCATAGAAGGCGGGTTGAACGAAGGCTCCCCG
rJMFF032C16- GCCTCCACCACAGTCAACCCGAAGG-CCTCATAGAAGGCGGGTTGAACGAAGGCTCCCCG
rJMFF027B20- GCCTCCACCACAGTCAACCCGAAGG-CCTCATAGAAGGCGGGTTGAACGAAGGCTCCCCG
rJMFF006B15- GCCTCCACCACAGTCAACCCGAAGG-CCTCATAGAAGGCGGGTTGAACGAAGGCTCCCCG
rJMFF029L11- GCCTCCACCACAGTCAACCCGAAGG-CCTCATAGAAGGCGGGTTGAACGAAGGCTCCCCG
rJMFF017A07- GCCTCCACCACAGTCAACCCGAAGG-CCTCATAGAAGGCGGGTTGAACGAAGGCTCCCCG
rJMFF009B11- GCCTCCACCACAGTCAACCCGAAGGCCCTCATAGAAGGCGGGTTGAACGAAGGCTCCCCG
rJMFF031G02- GCCTCCACCACAGTCAACCC
rJMFF010C21- GCCTCCACCACAGTCAACCCGAAGG-CCTCATAGAAGGCGGGTTGAACGAAGGCTCCCCG
rJMFF022A18- GCCTCCACCACAGTCAACCCGAAGG-CCTCATAGAAGGCGGGTTGAACGAAGGCTCCCCG
rJMSF042N23- GCCTCCACCACAGTCAACCCGAAGG-CCTCATAGAAGGCGGGTTGAACGAAGGCTCCCCG
JMFS114G07+ GCCTCCACCACAGTCAACCCGAAGG-CCTCATAGAAGGCGGGTTGAACGAAGGCTCCCCG
JMFS085E02+ GCCTCCACCACAGTCAACCCGAAGG-CCTCATAGAAGGCGGGTTGAACGAAGGCTCCCCG
JMFS026E01+ GCCTCCACCACAGTCAACCCGAAGG-CCTCATAGAAGGCGGGTTGAACGAAGGCTCCCCG
JMFN042P11+ GCCTCCACCACAGTCAACCCGAAGG-CCTCATAGAAGGCGGGTTGAACGAAGGCTCCCCG
JMFS060C05+ GCCTCCACCACAGTCAACCCGAAGG-CCTCATAGAAGGCGGGTTGAACGAAGGCTCCCCG
JMFS135D04+ GCCTCCACCACAGTCAACCCGAAGG-CCTCATAGAAGGCGGGTTGAACGAAGGCTCCCCG
JMFS028F12+ GCCTCCACCACAGTCAACCCGAAGG-CCTCATAGAAGGCGGGTTGAACGAAGGCTCCCCG
JMFS150H12+ GCCTCCACCACAGTCAACCCGAAGG-CCTCATAGAAGGCGGGTTGAACGAAGGCTCCCCG
JMFS111F11+ GCCTCCACCACAGTCAACCCGAAGG-CCTCATAGAAGGCGGGTTGAACGAAGGCTCCCCG
JMFS065F09+ GCCTCCACCACAGTCAACCCGAAGG-CCTCATAGAAGGCGGGTTGAACGAAGGCTCCCCG
                      ____________________________________________________________
consensus GCCTCCACCACAGTCAACCCGAAGG-CCTCATAGAAGGCGGGTTGAACGAAGGCTCCCCG
 
. : . : . : . : . : . :
rJMFF006I08- GGTGTCACAGATGTATCTGTACAGCTCCCCGTTCCTCACACGG
rJMFF022F01- GGTGTCACAGATGTATCTGTACAGCTCCCCGTTCCTCACACGGTTCATCTGGG
rJMFF029A05- GGTGTCACAGATGTATCTGTACAGCTCCCCGTTCCTCACACGGTTCATCTGGGAAGAGAT
rJMFF006B10- GGTGTCACAGATGTATCTGTACAGCTCCCCGTTCCTCACACGGTTCATCTGGGAAGAGAT
rJMFF032C16- GGTGTCACAGATGTATCTGTACAGCTCCCCGTTCCTCACACGGTTCATCTGGGAAGAGAT
rJMFF027B20- GGTGTCACAGATGTATCTGTACAGCTCCCCGTTCCTCACACGGTTCATCTGGGAAGAGAT
rJMFF006B15- GGTGTCACAGATGTATCTGTACAGCTCCCCGTTCCTCACACGGTTCATCTGGGAAGAGAT
rJMFF029L11- GGTGTCACAGATGTATCTGTACAGCTCCCCGTTCCTCACACGGTTCATCTGGGAAGAGAT
rJMFF017A07- GGTGTCACAGATGTATCTGTACAGCTCCCCGTTCCTCACACGGTTCATCT
rJMFF009B11- GGTGTCACAGATGTATCTGTACAGC
rJMFF010C21- GGTGTCACAGATGTATCTGTACAGCTCCCCGTTCCTCACACGGTTCATCTGGGAAGAGAT
rJMFF022A18- GGTGTCACAGATGTATCTGTACAGCTCCCCGTTCCTCACACGGTTCATCTGGGAAGAGAT
rJMSF042N23- GGTGTCACAGATGTATCTGTACAGCTCCCCGTTCCTCACACGGTTCATCTGGGAAGAGAT
JMFS114G07+ GGTGTCACAGATGTATCTGTACAGCTCCCCGTTCCTCACACGGTTCATCTGGGAAGAGAT
JMFS085E02+ GGTGTCACAGATGTATCTGTACAGCTCCCCGTTCCTCACACGGTTCATCTGGGAAGAGAT
JMFS026E01+ GGTGTCACAGATGTATCTGTACAGCTCCCCGTTCCTCACACGGTTCATCTGGGAAGAGAT
JMFN042P11+ GGTGTCACAGATGTATCTGTACAGCTCCCCGTTCCTCACACGGTTCATCTGGGAAGAGAT
JMFS060C05+ GGTGTCACAGATGTATCTGTACAGCTCCCCGTTCCTCACACGGTTCATCTGGGAAGAGAT
JMFS135D04+ GGTGTCACAGATGTATCTGTACAGCTCCCCGTTCCTCACACGGTTCATCTGGGAAGAGAT
JMFS028F12+ GGTGTCACAGATGTATCTGTACAGCTCCCCGTTCCTCACACGGTTCATCTGGGAAGAGAT
JMFS150H12+ GGTGTCACAGATGTATCTGTACAGCTCCCCGTTCCTCACACGGTTCATCTGGGAAGAGAT
JMFS111F11+ GGTGTCACAGATGTATCTGTACAGCTCCCCGTTCCTCACACGGTTCATCTGGGAAGAGAT
JMFS065F09+ GGTGTCACAGATGTATCTGTACAGCTCCCCGTTCCTCACACGGTTCATCTGGGAAGAGAT
                      ____________________________________________________________
consensus GGTGTCACAGATGTATCTGTACAGCTCCCCGTTCCTCACACGGTTCATCTGGGAAGAGAT
 
. : . : . : . : . : . :
rJMFF029A05- CCACCTGAACTG-CCCG
rJMFF006B10- CCACCTGAACTG-CCCG
rJMFF032C16- CCACCTGAACTG-CCCGTTCA-GGTTGTGCGTCTCG-AT
rJMFF027B20- CCACCTGAACTG-CCC
rJMFF006B15- CCACCTGAACTG-CCCGTTCA-NGTTGTGCGTCTCGAATCAGCTCGTGCATCTTCTTCAT
rJMFF029L11- CCACCTGAACTGCCCCGTTCANGGTTGTGCGTCTC
rJMFF010C21- CCACCTGAACTG-CCCGTTCA-GGTTGTGCGTCTCG-ATCAGCTCGTGCATCTTCTTCAT
rJMFF022A18- CCACCTGAACTG-CCCGTTCA-GGTTGTGCGTCTCG-ATCAGCTCGTGCATCTTCTTCAT
rJMSF042N23- CCACCTGAACTG-CCCGTTCA-GGTTGTGCGTCTCG-ATCAGCTCGTGCATCTTCTTCAT
JMFS114G07+ CCACCTGAACTG-CCCGTTCA-GGTTGTGCGTCTCG-ATCAGCTGGTGCATCTTCTTCAT
JMFS085E02+ CCACCTGAACTG-CCCGTTCA-GGTTGTGCGTCTCG-ATCAGCTCGTGCATCTTCTTCAT
JMFS026E01+ CCACCTGAACTG-CCCGTTCA-GGTTGTGCGTCTCG-ATCAGCTCGTGCATCTTCTTCAT
JMFN042P11+ CCACCTGAACTG-CCCGTTCA-GGTTGTGCGTCTCG-ATCAGCTCGTGCATCTTCTTCAT
JMFS060C05+ CCACCTGAACTG-CCCGTTCA-GGTTGTGCGTCTCG-ATCAGCTCGTGCATCTTCTTCAT
JMFS135D04+ CCACCTGAACTG-CCCGTTCA-GGTTGTGCGTCTCG-ATCAGCTCGTGCATCTTCTTCAT
JMFS028F12+ CCACCTGAACTG-CCCGTTCA-GGTTGTGCGTCTCG-ATCAGCTCGTGCATCTTCTTCAT
JMFS150H12+ CCACCTGAACTG-CCCGTTCA-GGTTGTGCGTCTCG-ATCAGCTCGTGCATCTTCTTCAT
JMFS111F11+ CCACCTGAACTG-CCCGTTCA-GGTTGTGCGTCTCG-ATCAGCTCGTGCATCTTCTTCAT
JMFS065F09+ CCACCTGAACTG-CCCGTTCA-GGTTGTGCGTCTCG-ATCAGCTCGTGCATCTTCTTCAT
                      ____________________________________________________________
consensus CCACCTGAACTG-CCCGTTCA-GGTTGTGCGTCTCG-ATCAGCTCGTGCATCTTCTTCAT
 
. : . : . : . : . : . :
rJMFF006B15- CTCCGCCTGCTC
rJMFF010C21- CTCCGCCTGCTCCTC
rJMFF022A18- CTCCGCCTGCTCCTCCAGG
rJMSF042N23- CTCCGCCTGCTCCTCCAGGTCCTTCGA
JMFS114G07+ CTCCGCCTGCTCCTCCAGGTCCTTCGACTCCTTCCTCCTGTCGCCCCCGACCACCACCAA
JMFS085E02+ CTCCGCCTGCTCCTCCAGGTCCTTCGACTCCTTCCTCCTGTCGCCCCCGACCACCACCAA
JMFS026E01+ CTCCGCCTGCTCCTCCAGGTCCTTCGACTCCTTCCTCCTGTCGCCCCCGACCACCACCAA
JMFN042P11+ CTCCGCCTGCTCTTCCAGGTCCTTCGACTCCTTCCTCCTGTCGCCCCCGACCACCACCAA
JMFS060C05+ CTCCGCCTGCTCCTCCAGGTCCTTCGACTCCTTCCTCCTGTCGCCCCCGACCACCACCAA
JMFS135D04+ CTCCGCCTGCTCCTCCAGGTCCTTCGACTCCTTCCTCCTGTCGCCCCCGACCACCACCAA
JMFS028F12+ CTCCGCCTGCTCCTCCAGGTCCTTCGACTCCTTCCTCCTGTCGCCCCCGACCACCACCAA
JMFS150H12+ CTCCGCCTGCTCCTCCAGGTCCTTCGACTCCTTCCTCCTGTCGCCCCCGACCACCACCAA
JMFS111F11+ CTCCGCCTGCTCCTCCAGGTCCTTCGACTCCTTCCTCCTGTCGCCCCCGACCACCACCAA
JMFS065F09+ CTCCGCCTGCTCCTCCAGGTCCTTCGACTCCTTCCTCCTGTCGCCCCCGACCACCACCAA
JMFS025F05+ CGACCACCACCAA
                      ____________________________________________________________
consensus CTCCGCCTGCTCCTCCAGGTCCTTCGACTCCTTCCTCCTGTCGCCCCCGACCACCACCAA
 
. : . : . : . : . : . :
JMFS114G07+ ATTCA
JMFS085E02+ ATTCACCAGCTCCCTCAGCTTCGGG
JMFS026E01+ ATTCACCAGCTCCCTCAGCTTCGGGTTCTTGGCGTACCACTCTACAAGCCCGGTTAAGTT
JMFN042P11+ ATTCACCAGCTCCCTCAGCTTCGGGTTCTTGGCGTACCACTCTACAAGCCCGGTTAAGTT
JMFS060C05+ ATTCACCAGCTCCCTCAGCTTCGGGTTCTTGGCGTACCACTCTACAAGCCCGGTTAAGTT
JMFS135D04+ ATTCACCAGCTCCCTCAGCTTCGGGTTCTTGGCGTACCACTCTACAAGCCCGGTTAAGTT
JMFS028F12+ ATTCACCAGCTCCCTCAGCTTCGGGTTCTTGGCGTACCACTCTACAAGCCCGGTTAAGTT
JMFS150H12+ ATTCACCAGCTCCCTCAGCTTCGGGTTCTTGGCGTACCACTCTACAAGCCCGGTTAAGTT
JMFS111F11+ ATTCACCAGCTCCCTCAGCTTCGGGTTCTTGGCGTACCACTCTACAAGCCCGGTTAAGTT
JMFS065F09+ ATTCACCAGCTCCCTCAGCTTCGGGTTCTTGGCGTACCACTCTACAAGCCCGGTTAAGTT
JMFS025F05+ ATTCACCAGCTCCCTCAGCTTCGGGTTCTTGGCGTACCACTCTACAAGCCCGGTTAAGTT
                      ____________________________________________________________
consensus ATTCACCAGCTCCCTCAGCTTCGGGTTCTTGGCGTACCACTCTACAAGCCCGGTTAAGTT
 
. : . : . : . : . : . :
JMFS026E01+ CT
JMFN042P11+ CTTCACACGGTCCAACCTCGCCATCGTGAACAAGATGGG
JMFS060C05+ CTTCACACGGTCCAACCTCGCCATCGTGAACAAGATGGGCTTGCTCCTATCCTTTAGCAC
JMFS135D04+ CTTCACACGGTCCAACCTCGCCATCGTGAACAAGATGGGCTTGCTCCT
JMFS028F12+ CTTCACACGGTCCAACCTCGCCATCGTGAACAAGATGGGCTTGCTCCTATCCTTTAGCAC
JMFS150H12+ CTTCACACGGTCCAACCTCGCCATCGTGAACAAGATGGGCTTGCTCCTATCCTTTAGCAC
JMFS111F11+ CTTCACACGGTCCAACCTCGCCATCGTGAACAAGATGGGCTTGCTCCTATCCTTTAGCAC
JMFS065F09+ CTTCACACGGTCCAACCTCGCCATCGTGAACAAGATGGGCTTGCTCCTATCCTTTAGCAC
JMFS025F05+ CTTCACACGGTCCAACCTCGCCATCGTGAACAAGATGGGCTTGCTCCTATCCTTTAGCAC
JMFS037H08+ CCTTTAGCAC
                      ____________________________________________________________
consensus CTTCACACGGTCCAACCTCGCCATCGTGAACAAGATGGGCTTGCTCCTATCCTTTAGCAC
 
. : . : . : . : . : . :
JMFS060C05+ ACACAGA
JMFS028F12+ ACACAGATGCTC
JMFS150H12+ ACACAGATGCTCCTCATTCTCGACATCACTATATAGCAAGTCCTCGATTTCGGGGTGAAG
JMFS111F11+ ACACAGATGCTCCTCATTCTCGACATCACTATATAGCAAGTCCTCGATTTCGGGGTGAAG
JMFS065F09+ ACACAGATGCTCCTCATTCTCGACATCACTATATAGCAAGTCCTCGATTTCGGGGTGAAG
JMFS025F05+ ACACAGATGCTCCTCATTCTCGACATCACTATATAGCAAGTCCTCGATTTCGGGGTGAAG
JMFS037H08+ ACACAGATGCTCCTCATTCTCGACATCACTATATAGCAAGTCCTCGATTTCGGGGTGAAG
                      ____________________________________________________________
consensus ACACAGATGCTCCTCATTCTCGACATCACTATATAGCAAGTCCTCGATTTCGGGGTGAAG
 
. : . : . : . : . : . :
JMFS150H12+ GGCTGTCAGCC
JMFS111F11+ GGCTGTCAGCCTCTTCTCCTTCTCGGAGTAAGGGAAGTAGAGATTCATATCAGCTCCTGG
JMFS065F09+ GGCTGTCAGCCTCTTCTCCTTCTCGGAGTAAGGGAAGTAGAGATTCATATCAGCTCCTGG
JMFS025F05+ GGCTGTCAGCCTCTTCTCCTTCTCGGAGTAAGGGAAGTAGAGATTCATATCAGCTCCTGG
JMFS037H08+ GGCTGTCAGCCTCTTCTCCTTCTCGGAGTAAGGGAAGTAGAGATTCATATCAGCTCCTGG
JMFS110H03+ TCGGAGTAAGGGAAGTAGAGATTCATATCAGCTCCTGG
                      ____________________________________________________________
consensus GGCTGTCAGCCTCTTCTCCTTCTCGGAGTAAGGGAAGTAGAGATTCATATCAGCTCCTGG
 
. : . : . : . : . : . :
JMFS111F11+ GGAAACAATGTTGAATTTCGGGTCGAAAACATCGATTCCATGGACAACTCT
JMFS065F09+ GGAAACAATGTTGAATTTCGGGTCGAAAACATCGATTCCATGGACAACTCTGTACAGTTC
JMFS025F05+ GGAAACAATGTTGAATTTCGGGTCGAAAACATCGATTCCATGGACAACTCTGTACAGTCC
JMFS037H08+ GGAAACAATGTTGAATTTCGGGTCGAAAACATCGATTCCATGGACAACTCTGTACAGTCC
JMFS110H03+ GGAAACAATGTTGAATTTCGGGTCGAAAACATCGATTCCATGGACAACTCTGTACAGTCC
                      ____________________________________________________________
consensus GGAAACAATGTTGAATTTCGGGTCGAAAACATCGATTCCATGGACAACTCTGTACAGTCC
 
. : . : . : . : . : . :
JMFS065F09+ AGGCATT
JMFS025F05+ AGGCATTGTGAATGCCTGATGGCTCTCATACTGCCCAACAGTGTCCTTGCTGCCAGCTAT
JMFS037H08+ AGGCATTGTGAATGCCTGATGGCTCTCATACTGCCCAACAGTGTCCTTGCTGCCAGCTAT
JMFS110H03+ AGGCATTGTGAATGCCTGATGGCTCTCATACTGCCCAACAGTGTCCTTGCTGCCAGCTAT
                      ____________________________________________________________
consensus AGGCATTGTGAATGCCTGATGGCTCTCATACTGCCCAACAGTGTCCTTGCTGCCAGCTAT
 
. : . : . : . : . : . :
JMFS025F05+ CTCCTGGAAGGTGCTGGTGATGATAAAATCAGTGTGGTTCATAGCAATCAGATCAGCAGT
JMFS037H08+ CTCCTGGAAGGTGCTGGTGATGATAAAATCAGTGTGGTTCATAGCAATCAGATCAGCAGT
JMFS110H03+ CTCCTGGAAGGTGCTGGTGATGATAAAATCAGTGTGGTTCATAGCAATCAGATCAGCAGT
JMFF047H14+ ATGATAAAATCAGTGTGGTTCATAGCAATCAGATCAGCAGT
JMFF017A07+ GTGATGATAAAATCAGTGTGGTTCATAGCAATCAGATCAGCAGT
JMFS084C01+ AGCAATCAGATCAGCAGT
                      ____________________________________________________________
consensus CTCCTGGAAGGTGCTGGTGATGATAAAATCAGTGTGGTTCATAGCAATCAGATCAGCAGT
 
. : . : . : . : . : . :
JMFS025F05+ GAATTGGCATGAGAAGTGATATTTCTCATCAAACTTCTTCAAGTAAATGTCTGAATCTGG
JMFS037H08+ GAATTGGCATGAGAAGTGATATTTCTCATCAAACTTCTTCAAGTAAATGTCTGAATCTGG
JMFS110H03+ GAATTGGCATGAGAAGTGATATTTCTCATCAAACTTCTTCAAGTAAATGTCTGAATCTGG
JMFF047H14+ GAATTGGCATGAGAAGTGATATTTCTCATCAAACTTCTTCAAGTAAATGTCTGAATCTGG
JMFF017A07+ GAATTGGCATGAGAAGTGATATTTCTCATCAAACTTCTTCAAGTAAATGTCTGAATCTGG
JMFS084C01+ GAATTGGCATGAGAAGTGATATTTCTCATCAAACTTCTTCAAGTAAATGTCTGAATCTGG
                      ____________________________________________________________
consensus GAATTGGCATGAGAAGTGATATTTCTCATCAAACTTCTTCAAGTAAATGTCTGAATCTGG
 
. : . : . : . : . : . :
JMFS025F05+ ATACTTCGTCTTCTCCAATGCGTGGGCAATGGTGCACTGTGTAACACCCAACTTGTGAGC
JMFS037H08+ ATACTTCGTCTTCTCCAATGCGTGGGCAATGGTGCACTGTGTAACACCCAACTTGTGAGC
JMFS110H03+ ATACTTCGTCTTCTCCAATGCGTGGGCAATGGTGCACTGTGTAACACCCAACTTGTGAGC
JMFF047H14+ ATACTTCGTCTTCTCCAATGCGTGGGCAATGGTGCACTGTGTAACACCCAACTTGTGAGC
JMFF017A07+ ATACTTCGTCTTCTCCAATGCGTGGGCAATGGTGCACTGTGTAACACCCAACTTGTGAGC
JMFS084C01+ ATACTTCGTCTTCTCCAATGCGTGGGCAATGGTGCACTGTGTAACACCCAACTTGTGAGC
                      ____________________________________________________________
consensus ATACTTCGTCTTCTCCAATGCGTGGGCAATGGTGCACTGTGTAACACCCAACTTGTGAGC
 
. : . : . : . : . : . :
JMFS025F05+ CAGCAATGAGGCAACAAGATTTCCCTCACTGTAGTTTCCGATAATCAGATCGGGCTTAGC
JMFS037H08+ CAGCAATGAGGCAACAAGATTTCCCTCACTGTAGTTTCCGATAATCAGATCGGGCTTAGC
JMFS110H03+ CAGCAATGAGGCAACAAGATTTCCCTCACTGTAGTTTCCGATAATCAGATCGGGCTTAGC
JMFF047H14+ CAGCAATGAGGCAACAAGATTTCCCTCACTGTAGTTTCCGATAATCAGATCGGGCTTAGC
JMFF017A07+ CAGCAATGAGGCAACAAGATTTCCCTCACTGTAGTTTCCGATAATCAGATCGGGCTTAGC
JMFS084C01+ CAGCAATGAGGCAACAAGATTTCCCTCACTGTAGTTTCCGATAATCAGATCGGGCTTAGC
                      ____________________________________________________________
consensus CAGCAATGAGGCAACAAGATTTCCCTCACTGTAGTTTCCGATAATCAGATCGGGCTTAGC
 
. : . : . : . : . : . :
JMFS037H08+ CTGCAGCTCTGCAGTGATCTCCTTTGCAACATCCTCGGTGAAAGTCTCCATGTATGGCCA
JMFS110H03+ CTGCAGCTCTGCAGTGATCTCCTTTGCAACATCCTCGGTGAAAGTCTCCATGTATGGCCA
JMFF047H14+ CTGCAGCTCTGCAGTGATCTCCTTTGCAACATCCTCGGTGAAAGTCTCCATGTATGGCCA
JMFF017A07+ CTGCAGCTCTGCAGTGATCTCCTTTGCAACATCCTCGGTGAAAGTCTCCATGTATGGCCA
JMFS084C01+ CTGCAGCTCTGCAGTGATCTCCTTTGCAACATCCTCGGTGAAAGTCTCCATGTATGGCCA
JMFS114H08+ GTGAAAGTCTCCATGTATGGCCA
JMFS002C01+ GTCTCCATGTATGGCCA
                      ____________________________________________________________
consensus CTGCAGCTCTGCAGTGATCTCCTTTGCAACATCCTCGGTGAAAGTCTCCATGTATGGCCA
 
. : . : . : . : . : . :
JMFS037H08+ GACTTCGAACCTAGAGATCCATGGGCGAACCATTCCCTTCTCAGTCCTGAAAGGAACTCT
JMFS110H03+ GACTTCGAACCTAGAGATCCATGGGCGAACCATTCCCTTCTCAGTCCTGAAAGGAACTCT
JMFF047H14+ GACTTCGAACCTAGAGATCCATGGGCGAACCATTCCCTTCTCAGTCCTGAAAGGAACTCT
JMFF017A07+ GACTTCGAACCTAGAGATCCATGGGCGAACCATTCCCTTCTCAGTCCTGAAAGGAACTCT
JMFS084C01+ GACTTCGAACCTAGAGATCCATGGGCGAACCATTCCCTTCTCAGTCCTGAAAGGAACTCT
JMFS114H08+ GACTTCGAACCTAGAGATCCATGGGCGAACCATTCCCTTCTCAGTCCTGAAAGGAACTCT
JMFS002C01+ GACTTCGAACCTAGAGATCCATGGGCGAACCATTCCCTTCTCAGTCCTGAAAGGAACTCT
                      ____________________________________________________________
consensus GACTTCGAACCTAGAGATCCATGGGCGAACCATTCCCTTCTCAGTCCTGAAAGGAACTCT
 
. : . : . : . : . : . :
JMFS037H08+ CAGAATGTGCGAGT
JMFS110H03+ CAGAATGTGCGAGTACTCTGCCCCGTATACTTTCTCAAGACGCTGCCCGCAGGTGGTTCC
JMFF047H14+ CAGAATGTGCGAGTACTCTGCCCCGTATACTTTCTCAAGACGCTGCCCGCAGGTGGTTCC
JMFF017A07+ CAGAATGTGCGAGTACTCTGCCCCGTATACTTTCTCAAGACGCTGCCCGCAGGTGGTTCC
JMFS084C01+ CAGAATGTGCGAGTACTCTGCCCCGTATACTTTCTCAAGACGCTGCCCGCAGGTGGTTCC
JMFS114H08+ CAGAATGTGCGAGTACTCTGCCCCGTATACTTTCTCAAGACGCTGCCCGCAGGTGGTTCC
JMFS002C01+ CAGAATGTGCGAGTACTCTGCCCCGTATACTTTCTCAAGACGCTGCCCGCAGGTGGTTCC
                      ____________________________________________________________
consensus CAGAATGTGCGAGTACTCTGCCCCGTATACTTTCTCAAGACGCTGCCCGCAGGTGGTTCC
 
. : . : . : . : . : . :
JMFS110H03+ AACAGCATCCGGCAGCAACCTAGTTATAATGAGGATTCGGGGTTTGA
JMFF047H14+ AACAGCATCCGGCAGCAACCTAGTTATAATGAGGATTCGGGGTTTGATGTCAAGCCCTTG
JMFF017A07+ AACAGCATCCGGCAGCAACCTAGTTATAATGAGGATTCGGGGTTTGATGTCAAGCCCTTG
JMFS084C01+ AACAGCATCCGGCAGCAACCTAGTTATAATGAGGATTCGGGGTTTGATGTCAAGCCCTTG
JMFS114H08+ AACAGCATCCGGCAGCAACCTAGTTATAATGAGGATTCGGGGTTTGATGTCAAGCCCTTG
JMFS002C01+ AACAGCATCCGGCAGCAACCTAGTTATAATGAGGATTCGGGGTTTGATGTCAAGCCCTTG
                      ____________________________________________________________
consensus AACAGCATCCGGCAGCAACCTAGTTATAATGAGGATTCGGGGTTTGATGTCAAGCCCTTG
 
. : . : . : . : . : . :
JMFF047H14+ CTCCTTAATGCGCTTAATCATCTCGCGCTCCAAGGCAGGAACTTGATCCAAGATGTAAAC
JMFF017A07+ CTCCTTAATGCGCTTAATCATCTCGCGCTCCAAGGCAGGAACTTGATCCAAGATGTAAAC
JMFS084C01+ CTCCTTAATGCGCTTAATCATCTCGCGCTCCAAGGCAGGAACTTGATCCAAGATGTAAAC
JMFS114H08+ CTCCTTAATGCGCTTAATCATCTCGCGCTCCAAGGCAGGAACTTGATCCAAGATGTAAAC
JMFS002C01+ CTCCTTAATGCGCTTAATCATCTCGCGCTCCAAGGCAGGAACTTGATCCAAGATGTAAAC
                      ____________________________________________________________
consensus CTCCTTAATGCGCTTAATCATCTCGCGCTCCAAGGCAGGAACTTGATCCAAGATGTAAAC
 
. : . : . : . : . : . :
JMFF047H14+ AACCTGGCCACCGGTGTCGGGGTATCCCAACACATTCTCCTGGGCGAAATAGCCGTGGGG
JMFF017A07+ AACCTGGCCACCGGTGTCGGGGTATCCCAACACATTCTCCTGGGCGAAATAGCCGTGGGG
JMFS084C01+ AACCTGGCCACCGGTGTCGGGGTATCCCAACACATTCTCCTGGGCGAAATAGCCGTGGGG
JMFS114H08+ AACCTGGCCACCGGTGTCGGGGTATCCCAACACATTCTCCTGGGCGAAATAGCCGTGGGG
JMFS002C01+ AACCTGGCCACCGGTGTCGGGGTATCCCAACACATTCTCCTGGGCGAAATAGCCGTGGGG
                      ____________________________________________________________
consensus AACCTGGCCACCGGTGTCGGGGTATCCCAACACATTCTCCTGGGCGAAATAGCCGTGGGG
 
. : . : . : . : . : . :
JMFF047H14+ GGAAAGAATGACAACAT
JMFF017A07+ GGAAAGAATGACAACAT
JMFS084C01+ GGAAAGAATGACAACATTGAACACCATAGGAATCCTGCCCAAGAACTTCTCGAGAGTGCA
JMFS114H08+ GGAAAGAATGACAACATTGAACACCATAGGAATCCTGCCCAAGAACTTCTCGAGAGTGCA
JMFS002C01+ GGAAAGAATGACAACATTGAACACCATAGGAATCCTGCCCAAGAACTTCTCGAGAGTGCA
JMFS130G02+ ATAGGAATCCTGCCCAAGAACTTCTCGAGAGTGCA
                      ____________________________________________________________
consensus GGAAAGAATGACAACATTGAACACCATAGGAATCCTGCCCAAGAACTTCTCGAGAGTGCA
 
. : . : . : . : . : . :
JMFS114H08+ CGAATCGGGGGCTTCAAGGAGGTCAAGAAGCATACAGATCATCTCCAGAACACGCTCCGC
JMFS002C01+ CGAATCGGGGGCTTCAAGGAGGTCAAGAAGCATACAGATCATCTCCAGAACACGCTCCGC
JMFS130G02+ CGAATCGGGGGCTTCAAGGAGGTCAAGAAGCATACAGATCATCTCCAGAACACGCTCCGC
                      ____________________________________________________________
consensus CGAATCGGGGGCTTCAAGGAGGTCAAGAAGCATACAGATCATCTCCAGAACACGCTCCGC
 
. : . : . : . : . : . :
JMFS114H08+ GGTGTCTCCCCACCCCCTCTCCAACCCGATTTCCTGGAACCTATGTTCGAATTCGGAGTA
JMFS002C01+ GGTGTCTCCCCACCCCCTCTCCAACCCGATTTCCTGGAACCTATGTTCGAATTCGGAGTA
JMFS130G02+ GGTGTCTCCCCACCCCCTCTCCAACCCGATTTCCTGGAACCTATGTTCGAATTCGGAGTA
JMFS076C03+ TCGGAGTA
                      ____________________________________________________________
consensus GGTGTCTCCCCACCCCCTCTCCAACCCGATTTCCTGGAACCTATGTTCGAATTCGGAGTA
 
. : . : . : . : . : . :
JMFS114H08+ CGGTGTGTCTGCAGGGAGTGTTGTTAGGTACTCCTCGGCCTTCCTCAGCACATTTTGCAG
JMFS002C01+ CGGTGTGTCTGCAGGGAGTGTTGTTAGGTACTCCTCGGCCTTCCTCAGCACATTTTGCAG
JMFS130G02+ CGGTGTGTCTGCAGGGAGTGTTGTTAGGTACTCCTCGGCCTTCCTCAGCACATTTTGCAG
JMFS076C03+ CGGTGTGTCTGCAGGGAGTGTTGTTAGGTACTCCTCGGCCTTCCTCAGCACATTTTGCAG
                      ____________________________________________________________
consensus CGGTGTGTCTGCAGGGAGTGTTGTTAGGTACTCCTCGGCCTTCCTCAGCACATTTTGCAG
 
. : . : . : . : . : . :
JMFS114H08+ AGTGTTTAGG
JMFS002C01+ AGTGTTTAGGTTCTGAATCCTGTCATTCAACATCATC
JMFS130G02+ AGTGTTTAGGTTCTGAATCCTGTCATTCAACATCATCGTCTTCCCCTTGTACTGGTGAAC
JMFS076C03+ AGTGTTTAGGTTCTGAATCCTGTCATTCAACATCATCGTCTTCCCCTTGTACTGGTGAAC
JMFS067C09+ AATCCTGTCATTCAACATCATCGTCTTCCCCTTGTACTGGTGAAC
JMFS147A04+ AATCCTGTCATTCAACATCATCGTCTTCCCCTTGTACTGGTGAAC
JMFS073G08+ AC
JMSF042N23+ CCCCTTGTACTGGTGAAC
                      ____________________________________________________________
consensus AGTGTTTAGGTTCTGAATCCTGTCATTCAACATCATCGTCTTCCCCTTGTACTGGTGAAC
 
. : . : . : . : . : . :
JMFS130G02+ CCGGAGGAAGTCTAGGAGAGGAGCCATGCTCTCCTTGTCATGGAACATTTTAGCAGAGAG
JMFS076C03+ CCGGAGGAAGTCTAGGAGAGGAGCCATGCTCTCCTTGTCATGGAACATTTTAGCAGAGAG
JMFF006B15+ TAGGAGAGGAGCCATGCTCTCCTTGTCATGGAACATTTTAGCAGAGAG
JMFF022A18+ CTAGGAGAGGAGCCATGCTCTCCTTGTCATGGAACATTTTAGCAGAGAG
JMFS067C09+ CCGGAGGAAGTCTAGGAGAGGAGCCATGCTCTCCTTGTCATGGAACATTTTAGCAGAGAG
JMFS147A04+ CCGGAGGAAGTCTAGGAGAGGAGCCATGCTCTCCTTGTCATGGAACATTTTAGCAGAGAG
JMFS154F03+ GAACATTTTAGCAGAGAG
JMFS040H11+ TTTAGCAGAGAG
JMFF045I15+ TTTAGCAGAGAG
JMFS060D01+ ACATTTTAGCAGAGAG
JMFS119E06+ G
JMFS026E05+ G
JMFS071D05+ AG
JMFS073G08+ CCGGAGGAAGTCTAGGAGAGGAGCCATGCTCTCCTTGTCATGGAACATTTTAGCAGAGAG
JMFS128H11+ GCCATGCTCTCCTTGTCATGGAACATTTTAGCAGAGAG
JMFS068D07+ TTGTCATGGAACATTTTAGCAGAGAG
JMFS101B07+ AGGAGCCATGCTCTCCTTGTCATGGAACATTTTAGCAGAGAG
JMSF042N23+ CCGGAGGAAGTCTAGGAGAGGAGCCATGCTCTCCTTGTCATGGAACATTTTAGCAGAGAG
                      ____________________________________________________________
consensus CCGGAGGAAGTCTAGGAGAGGAGCCATGCTCTCCTTGTCATGGAACATTTTAGCAGAGAG
 
. : . : . : . : . : . :
JMFS130G02+ ATGTCTGTTAAGGAACTCAACTCCATTCCCAATAGACTTGGTGAGAGTTGGCTTGGGAAA
JMFS076C03+ ATGTCTGTTAAGGAACTCAACTCCATTCCCAATAGACTTGGTGAGAGTTGGCTTGGGAAA
JMFF006B15+ ATGTCTGTTAAGGAACTCAACTCCATTCCCAATAGACTTGGTGAGAGTTGGCTTGGGAAA
JMFF022A18+ ATGTCTGTTAAGGAACTCAACTCCATTCCCAATAGACTTGGTGAGAGTTGGCTNGGGAAA
JMFS067C09+ ATGTCTGTTAAGGAACTCAACTCCATTCCCAATAGACTTGGTGAGAGTTGGCTTGGGAAA
JMFS147A04+ ATGTCTGTTAAGGAACTCAACTCCATTCCCAATAGACTTGGTGAGAGTTGGCTTGGGAAA
JMFS154F03+ ATGTCTGTTAAGGAACTCAACTCCATTCCCAATAGACTTGGTGAGAGTTGGCTTGGGAAA
JMFS040H11+ ATGTCTGTTAAGGAACTCAACTCCATTCNCAATAGACTTGGTGAGAGTTGGCTTGGGAAA
JMFS003E06+ TAAGGAACTCAACTCCATTCCCAATAGACTTGGTGAGAGTTGGCTTGGGAAA
JMFF045I15+ ATGTCTGTTAAGGAACTCAACTCCATTCCCAATAGACTTGGTGAGAGTTGGCTTGGGAAA
JMFS060D01+ ATGTCTGTTAAGGAACTCAACTCCATTCCCAATAGACTTGGTGAGAGTTGGCTTGGGAAA
JMFS119E06+ ATGTCTGTTAAGGAACTCAACTCCATTCNCAATAGACTTGGTGAGAGTTGGCTTGGGAAA
JMFS097C06+ TGTTAAGGAACTCAACTCCATTCCCAATAGACTTGGTGAGAGTTGGCTTGGGAAA
JMFS152E06+ GTTAAGGAACTCAACTCCATTCNCAATAGACTTGGTGAGAGTTGGCTTGGGAAA
JMFS092B05+ AGGAACTCAACTCCATTCCCAATAGACTTGGTGAGAGTTGGCTTGGGAAA
JMFS153A02+ TAAGGAACTCACNTCCATTCCCAATAGACTTGGTGAGAGTTGGCTTGGGAAA
JMFS026E05+ ATGTCTGTTAAGGAACTCAACTCCATTCCCAATAGACTTGGTGAGAGTTGGCTTGGGAAA
JMFS090H06+ TGTTAAGGAACTCAACTCCATTCCCAATAGACTTGGTGAGAGTTGGCTTGGGAAA
JMFS130C11+ GTTAAGGAACTCAACTCCATTCCCAATAGACTTGGTGAGAGTTGGCTTGGGAAA
JMFS168D04+ TTAAGGAACTCAACTCCATTCCCAATAGACTTGGTGAGAGTTGGCTTGGGAAA
JMFS071D05+ ATGTCTGTTAAGGAACTCAACTCCATTCCCAATAGACTTGGTGAGAGTTGGCTTGGGAAA
JMFS063B05+ GGAACTCAACTCCATTCCCAATAGACTTGGTGAGAGTTGGCTTGGGAAA
JMFS119B09+ GTTAAGGAACTCAACTCCATTCCCAATAGACTTGGTGAGAGTTGGC-TGGGAAA
JMFS148C02+ AAGGAACTCAACTCCATTCNCAATAGACTTGGTGAGAGTTGGCTTGGGAAA
JMFS090F08+ AAGGAACTCAACTCCATTCNCAATAGACTTGGTGAGAGTTGGCTTGGGAAA
JMFS147B11+ GTTAAGGAACTCAACTCCATTCNCAATAGACTTGGTGAGAGTTGGCTTGGGAAA
JMFS100G01+ GTTAAGGAACTCAACTCCATTCCCAATAGACTTGGTGAGAGTTGGCTTGGGAAA
JMFS168F04+ CAACTCCATTCCCAATAGACTTGGTGAGAGTTGGCTTGGGAAA
JMFS107A06+ AACTCAACTCCATTCCCAATAGACTTGGTGAGAGTTGGCTTGGGAAA
JMFS065G06+ AACTCAACTCCATTCCCAATAGACTTGGTGAGAGTTGGCTTGGGAAA
JMFS094E02+ AACTCAACTCCATTCCCAATAGACTTGGTGAGAGTTGGCTTGGGAAA
JMFS167A12+ AACTCAACTCCATTCNCAATAGACTTGGTGAGAGTTGGCTTGGGAAA
JMFS138H02+ CCAATAGACTTGGTGAGAGTTGGCTTGGGAAA
JMFS011H07+ AACTCAACTCCATTCCCAATAGACTTGGTGAGAGTTGGCTTGGGAAA
JMFS073G08+ ATGTCTGTTAAGGAACTCAACTCCATTCCCAATAGACTTGGTGAGAGTTGGCTTGGGAAA
JMFS063C01+ ACTCAACTCCATTCCCAATAGACTTGGTGAGAGTTGGCTTGGGAAA
JMFS074A03+ CTCAACTCCATTCNCAATAGACTTGGTGAGAGTTGGCTTGGGAAA
JMFS066F11+ CATTCCCAATAGACTTGGTGAGAGTTGGCTTGGGAAA
JMFS044B05+ CTCAACTCCATTCCCAATAGACTTGGTGAGAGTTGGCTTGGGAAA
JMFS041C04+ CCATTCCCAATAGACTTGGTGAGAGTTGGCTTGGGAAA
JMFS140C06+ CTCCATTCCCAATAGACTTGGTGAGAGTTGGCTTGGGAAA
JMFS086A08+ GAACTCAACTCCATTCNCAATAGACTTGGTGAGAGTTGGCTTGGGAAA
JMFS128H11+ ATGTCTGTTAAGGAACTCAACTCCATTCCCAATAGACTTGGTGAGAGTTGGCTTGGGAAA
JMFS057B02+ GTTAAGGAACTCAACTCCATTCCCAATAGACTTGGTGAGAGTTGGCTTGGGAAA
JMFS068D07+ ATGTCTGTTAAGGAACTCAACTCCATTCCCAATAGACTTGGTGAGAGTTGGCTTGGGAAA
JMFS091F03+ TAGACTTGGTGAGAGTTGGCTTGGGAAA
JMFF047P13+ TGAGAGTTGGCTTGGGAAA
JMFS108G02+ TAGACTTGGTGAGAGTTGGCTTGGGAAA
JMFS099F04+ TAGACTTGGTGAGAGTTGGCTTGGGAAA
JMFS153A03+ TGGTGAGAGTTGGCTTGGGAAA
JMFS137H03+ TAGACTTGGTGAGAGTTGGCTTGGGAAA
JMFS001F03+ AGTTGGCTTGGGAAA
JMFS117H09+ AA
JMFS051G04+ GGCTTGGNAAA
JMFS121D09+ CTTGGGAAA
JMFS013B08+ TTGGGAAA
JMFS125B09+ CTTGGGAAA
JMFF041B23+ TAGACTTGGTGAGAGTTGGCTTGGGAAA
JMFS040F10+ GTTAAGGAACTCAACTCCATTCNCAATAGACTTGGTGAGAGTTGGCTTGGGAAA
JMFS102E03+ AAGGAACTCAACTCCATTCNCAATAGACTTGGTGAGAGTTGGCTTGGGAAA
JMFS101B07+ ATGTCTGTTAAGGAACTCAACTCCATTCCCAATAGACTTGGTGAGAGTTGGCTTGGGAAA
JMFS051F05+ TAGACTTGGTGAGAGTTGGCTTGGGAAA
JMFS042C09+ TAGACTTGGTGAGAGTTGGCTTGGGAAA
JMFS136A03+ AGTTGGC-TGGGAAA
JMFS138D01+ TAGACTTGGTGAGAGTTGGC-TGGGAAA
JMFS088C02+ GACTTGGTGAGAGTTGGC-TGGGAAA
JMFS029A06+ TAGACTTGGTGAGAGTTGGC-TGGGAAA
JMFS121E01+ TAGACTTGGTGAGAGTTGGCTTGGGAAA
JMSF042N23+ ATGTCTGTTAAGGAACTCAACTCCATTCCCAATAGACTTGGTGAGAGTTGGCTTGGGAAA
                      ____________________________________________________________
consensus ATGTCTGTTAAGGAACTCAACTCCATTCCCAATAGACTTGGTGAGAGTTGGCTTGGGAAA
 
. : . : . : . : . : . :
JMFS130G02+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS076C03+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFF006B15+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFF022A18+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS067C09+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS147A04+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS154F03+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS040H11+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS003E06+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFF045I15+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS060D01+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS119E06+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS097C06+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS152E06+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS092B05+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS153A02+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS026E05+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS090H06+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS130C11+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS168D04+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS071D05+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS063B05+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS119B09+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS148C02+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS090F08+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS147B11+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS100G01+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS168F04+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS107A06+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS065G06+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS094E02+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS167A12+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS138H02+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS011H07+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS073G08+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS063C01+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS074A03+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS066F11+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS044B05+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS041C04+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAGAGTTGCCAT-TGCCATTTCCAT
JMFS140C06+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS086A08+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS128H11+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS057B02+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS068D07+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS091F03+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFF047P13+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS108G02+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCTATTTCCAT
JMFS099F04+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS153A03+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS137H03+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS001F03+ GNATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS117H09+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS051G04+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS121D09+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACANAGTTGCCAT-TGCCATTTCCAT
JMFS013B08+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS125B09+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFF041B23+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS040F10+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS102E03+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS101B07+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS051F05+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS042C09+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS136A03+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS138D01+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS088C02+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS029A06+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACANAGTTGCCAT-TGCCATTTCCAT
JMFS121E01+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMSF042N23+ GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS114A11+ GGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS116F10+ GCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS027H06+ CTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS116G06+ TCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS027C09+ CTCAAAATCCAGTTCCAGAACANAGTTGCCAT-GNCCATTTCCAT
JMFS161F07+ GCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS031G05+ TCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS162C01+ AACAAAGTTGCCAT-GNCCATTTCCAT
JMFS032D05+ TCCAGTTCCAGAACAAAG-TGCCATGNNCCATTTCCAT
JMFS048D11+ AGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFS032D07+ ATTTCCAT
JMFF009B11+ GATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
JMFF032C16+ TCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
                      ____________________________________________________________
consensus GGATGCAGTAAATGGCTCAAAATCCAGTTCCAGAACAAAGTTGCCAT-TGCCATTTCCAT
 
. : . : . : . : . : . :
JMFS130G02+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS076C03+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFF006B15+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFF022A18+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS067C09+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS147A04+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS154F03+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS040H11+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS003E06+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFF045I15+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS060D01+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS119E06+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS097C06+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS152E06+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS092B05+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS153A02+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS026E05+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS090H06+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS130C11+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS168D04+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS071D05+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS063B05+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS119B09+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS148C02+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS090F08+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS147B11+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS100G01+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS168F04+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS107A06+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS065G06+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS094E02+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS167A12+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS138H02+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS011H07+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS073G08+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS063C01+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS074A03+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS066F11+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS044B05+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS041C04+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS140C06+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS086A08+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS128H11+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS057B02+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS068D07+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS091F03+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFF047P13+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS108G02+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS099F04+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS153A03+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS137H03+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS001F03+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS117H09+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS051G04+ TCACAAGCTCTTCTTTGAAATGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS121D09+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS013B08+ TCACAAGCTCTTCTNTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS125B09+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFF041B23+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS040F10+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS102E03+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS101B07+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS051F05+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS042C09+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS136A03+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS138D01+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS088C02+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS029A06+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS121E01+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMSF042N23+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS114A11+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS116F10+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS027H06+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS116G06+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS027C09+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS161F07+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS031G05+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS162C01+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS032D05+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS048D11+ TCACAAGCTTTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFS032D07+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFF009B11+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFF029A05+ CAACAGCTAAAG
JMFS158D02+ AG
JMFF006B10+ TGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFF010C21+ GAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFF027B20+ AACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFF006I08+ TGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
JMFF040E13+ TAAAG
JMFS157G11+ AG
JMFF032C16+ TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
                      ____________________________________________________________
consensus TCACAAGCTCTTCTTTGAACTGCAGATACTGAGGAACAGTCAATTCCTCAACAGCTAAAG
 
. : . : . : . : . : . :
JMFS130G02+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS076C03+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFF006B15+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFF022A18+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS067C09+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS147A04+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS154F03+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS040H11+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS003E06+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFF045I15+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS060D01+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS119E06+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS097C06+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS152E06+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS092B05+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS153A02+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS026E05+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS090H06+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS130C11+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS168D04+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS071D05+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS063B05+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS119B09+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS148C02+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS090F08+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS147B11+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS100G01+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS168F04+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS107A06+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS065G06+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS094E02+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS167A12+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS138H02+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS011H07+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS073G08+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS063C01+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS074A03+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS066F11+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS044B05+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS041C04+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS140C06+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS086A08+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS128H11+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS057B02+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS068D07+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS091F03+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFF047P13+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS108G02+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS099F04+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS153A03+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS137H03+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS001F03+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS117H09+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS051G04+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS121D09+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS013B08+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS125B09+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFF041B23+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS040F10+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS102E03+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS101B07+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS051F05+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS042C09+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS136A03+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS138D01+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS088C02+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS029A06+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS121E01+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMSF042N23+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS114A11+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS116F10+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS027H06+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS116G06+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS027C09+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS161F07+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS031G05+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS162C01+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS032D05+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS048D11+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAT
JMFS032D07+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFF009B11+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFF029A05+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS158D02+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS158E11+ GGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFF006B10+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFF010C21+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFF027B20+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFF006I08+ CATTCACATCAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFF040E13+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFS157G11+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
JMFF032C16+ CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
                      ____________________________________________________________
consensus CATTCACATTAACTCGGACATATTCCCAGACACCCGGCCTTAAACGGATAGCAAGAGCAA
 
. : . : . : . : . : . :
JMFS130G02+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAA
JMFS076C03+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFF006B15+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFF022A18+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS067C09+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS147A04+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS154F03+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS040H11+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS003E06+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFF045I15+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS060D01+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS119E06+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS097C06+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS152E06+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS092B05+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS153A02+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS026E05+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS090H06+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS130C11+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS168D04+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS071D05+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS063B05+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS119B09+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS148C02+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS090F08+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS147B11+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS100G01+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS168F04+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS107A06+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS065G06+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS094E02+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS167A12+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS138H02+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS011H07+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS073G08+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS063C01+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS074A03+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS066F11+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS044B05+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS041C04+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS140C06+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS086A08+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS128H11+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS057B02+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS068D07+ CCCACGGCGACAAAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS091F03+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFF047P13+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS108G02+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS099F04+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS153A03+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS137H03+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFF031G02+ AC-AAAACTATCGCTTCCTGTGTGCATTNGAGAACTTCCTGAAAGGCATGA
JMFF022F01+ CCTGAAAGGCATGA
JMFS001F03+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS117H09+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS051G04+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS121D09+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS013B08+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS125B09+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFF041B23+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS040F10+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS102E03+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS101B07+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS051F05+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS042C09+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS136A03+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS138D01+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS088C02+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS029A06+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS121E01+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMSF042N23+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS114A11+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS116F10+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS027H06+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS116G06+ CCCAAGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS027C09+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS161F07+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS031G05+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS162C01+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS032D05+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS048D11+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS032D07+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFF009B11+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFF029A05+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS158D02+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS158E11+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFF006B10+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFF010C21+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFF027B20+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFF006I08+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFF040E13+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFS157G11+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
JMFF032C16+ CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
                      ____________________________________________________________
consensus CCCACGGCGAC-AAAACTATCGCTTCCTGTGTGCATTTGAGAACTTCCTGAAAGGCATGA
 
. : . : . : . : . : . :
JMFS076C03+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFF006B15+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFF022A18+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS067C09+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS147A04+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS154F03+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS040H11+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS003E06+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFF045I15+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS060D01+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS119E06+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS097C06+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS152E06+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS092B05+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS153A02+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS026E05+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS090H06+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS130C11+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS168D04+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS071D05+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS063B05+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS119B09+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS148C02+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS090F08+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS147B11+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS100G01+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS168F04+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS107A06+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS065G06+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS094E02+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS167A12+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS138H02+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS011H07+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS073G08+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS063C01+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS074A03+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCGGCAGTTCATGA
JMFS066F11+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS044B05+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS041C04+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS140C06+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS086A08+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS128H11+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS057B02+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS068D07+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS091F03+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFF047P13+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS108G02+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS099F04+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS153A03+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS137H03+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFF031G02+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFF022F01+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS001F03+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS117H09+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS051G04+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS121D09+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS013B08+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS125B09+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFF048E20+ TTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFF041B23+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS040F10+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS102E03+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS101B07+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS051F05+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS042C09+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS136A03+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS138D01+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS088C02+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS029A06+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS121E01+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMSF042N23+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS114A11+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS116F10+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS027H06+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS116G06+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS027C09+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS161F07+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS031G05+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS162C01+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS032D05+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS048D11+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS032D07+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFF009B11+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFF029A05+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS158D02+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS158E11+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFF006B10+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFF010C21+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFF027B20+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFF006I08+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFF040E13+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFS157G11+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
JMFF029L11+ ATCCTGGTCAGTTTTGCAGATAGCTTCAAANTCAGCCAGCAGTTCANGA
JMFF032C16+ TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
                      ____________________________________________________________
consensus TCGTTGAGTTTATCCTGGTCAGTTTTGCAGATAGCTTCAAACTCAGCCAGCAGTTCATGA
 
. : . : . : . : . : . :
JMFS076C03+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFF006B15+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFF022A18+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS067C09+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS147A04+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS154F03+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS040H11+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS003E06+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFF045I15+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS060D01+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS119E06+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS097C06+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS152E06+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS092B05+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS153A02+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS026E05+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS090H06+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS130C11+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS168D04+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS071D05+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS063B05+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS119B09+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS148C02+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS090F08+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS147B11+ TGCTTCAAGATTCCTTTCCCATGG--GTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS100G01+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS168F04+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS107A06+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS065G06+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS094E02+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS167A12+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS138H02+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS011H07+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS073G08+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS063C01+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS074A03+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS066F11+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS044B05+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS041C04+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS140C06+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS086A08+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS128H11+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS057B02+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS068D07+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS091F03+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFF047P13+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS108G02+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS099F04+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS153A03+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS137H03+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFF031G02+ TGCTTCAAGATTCCTTTCCCATGGCTNTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFF022F01+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS001F03+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS117H09+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS051G04+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS121D09+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS013B08+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS125B09+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFF048E20+ TGCTTCAAGATTCCTTTCCTATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFF041B23+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS040F10+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS102E03+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS101B07+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS051F05+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS042C09+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS136A03+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS138D01+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS088C02+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS029A06+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS121E01+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMSF042N23+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS114A11+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS116F10+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS027H06+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS116G06+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS027C09+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS161F07+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS031G05+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS162C01+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS032D05+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS048D11+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCANTG
JMFS032D07+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFF009B11+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFF029A05+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS158D02+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS158E11+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFF006B10+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFF010C21+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFF027B20+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFF006I08+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFF040E13+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFS157G11+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
JMFF029L11+ NGCTTCAAGATTCCTTTCCCATGGNTTTCAATCCTGGACATAAACAACAGAATCTCATNG
JMFF032C16+ TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
                      ____________________________________________________________
consensus TGCTTCAAGATTCCTTTCCCATGGCTTTCAATCCTCGACATAAACAACAGAATCTCATTG
 
. : . : . : . : . : . :
JMFS076C03+ CGGTGGGCGGCCAGGGTGGC
JMFF006B15+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFF022A18+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACA
JMFS067C09+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS147A04+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS154F03+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS040H11+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS003E06+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFF045I15+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS060D01+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS119E06+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS097C06+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS152E06+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS092B05+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS153A02+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS026E05+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS090H06+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS130C11+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS168D04+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS071D05+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS063B05+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS119B09+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS148C02+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS090F08+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS147B11+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS100G01+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS168F04+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS107A06+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS065G06+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS094E02+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS167A12+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS138H02+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS011H07+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS073G08+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS063C01+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS074A03+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS066F11+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS044B05+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS041C04+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS140C06+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS086A08+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS128H11+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS057B02+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS068D07+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS091F03+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFF047P13+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS108G02+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS099F04+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS153A03+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS137H03+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFF031G02+ CGGTGGGCGGCCAGGGTGGNGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFF022F01+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFF017E12+ CGGGTCAGAACA
JMFS001F03+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS117H09+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS051G04+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS121D09+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS013B08+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS125B09+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFF048E20+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFF041B23+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS040F10+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS102E03+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS101B07+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS051F05+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS042C09+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS136A03+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS138D01+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS088C02+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS029A06+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS121E01+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMSF042N23+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS114A11+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS116F10+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS027H06+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS116G06+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS027C09+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS161F07+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS031G05+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS162C01+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS032D05+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS048D11+ CGGTGGTCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGTTGTGAACACGGGTCAGAACA
JMFS032D07+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFF009B11+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFF029A05+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS158D02+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS158E11+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCCCGGAGGCTGTGAACACGGGTCAGAACA
JMFF006B10+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFF010C21+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFF027B20+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFF006I08+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFF040E13+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFS157G11+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
JMFF029L11+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCNCGGAGGNTGTGAACACGGGTCAGAACA
JMFF032C16+ CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
                      ____________________________________________________________
consensus CGGTGGGCGGCCAGGGTGGCGTCAAGGCGCTCACGGAGGCTGTGAACACGGGTCAGAACA
 
. : . : . : . : . : . :
JMFF006B15+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAA
JMFS067C09+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAA
JMFS147A04+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAAC
JMFS154F03+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS040H11+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS003E06+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFF045I15+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS060D01+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS119E06+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS097C06+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS152E06+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS092B05+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS153A02+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS026E05+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS090H06+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS130C11+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS168D04+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS071D05+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS063B05+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS119B09+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS148C02+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS090F08+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS147B11+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS100G01+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS168F04+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS107A06+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS065G06+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS094E02+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS167A12+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS138H02+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS011H07+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS073G08+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS063C01+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS074A03+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS066F11+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS044B05+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS041C04+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS140C06+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS086A08+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS128H11+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS057B02+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS068D07+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS091F03+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFF047P13+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS108G02+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS099F04+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS153A03+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS137H03+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFF031G02+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACT
JMFF022F01+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACT
JMFF017E12+ CGATCAGCCATGGCAGATTAGCAGCAATCGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS001F03+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS117H09+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS051G04+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS121D09+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS013B08+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS125B09+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFF048E20+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFF041B23+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS040F10+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS102E03+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS101B07+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS051F05+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS042C09+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS136A03+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS138D01+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS088C02+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS029A06+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS121E01+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMSF042N23+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS114A11+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS116F10+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS027H06+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS116G06+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS027C09+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS161F07+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS031G05+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS162C01+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS032D05+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS048D11+ CGATCAGCCATGGCAGATNAGCAGCAAACGATCAAAACTCATAGAAGAAGAGAGCCAATG
JMFS032D07+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFF015O13+ GATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFF009B11+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFF029A05+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS158D02+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS158E11+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFF006B10+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFF010C21+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFF027B20+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFF006I08+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFF040E13+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFS157G11+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
JMFF029L11+ CGATCAGCCATGGCAGANTAGCAGCAAACGATCAAA
JMFF032C16+ CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
                      ____________________________________________________________
consensus CGATCAGCCATGGCAGATTAGCAGCAAACGATCAAAACTCAGAGAAGAAGAGAGCCAATG
 
. : . : . : . : . : . :
JMFS154F03+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS040H11+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS003E06+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAA
JMFF045I15+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS060D01+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS119E06+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS097C06+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS152E06+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS092B05+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS153A02+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS026E05+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS090H06+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS130C11+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS168D04+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS071D05+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS063B05+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS119B09+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS148C02+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS090F08+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS147B11+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS100G01+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS168F04+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS107A06+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS065G06+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS094E02+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS167A12+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS138H02+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS011H07+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS073G08+ CAGGAAAACAAGAACTCAAGAAAGAAA
JMFS063C01+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS074A03+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS066F11+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS044B05+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS041C04+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS140C06+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS086A08+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS128H11+ CAGGAAAACAAGAAATCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAG
JMFS057B02+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS068D07+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS091F03+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFF047P13+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS108G02+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS099F04+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS153A03+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS137H03+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFF017E12+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS001F03+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS117H09+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS051G04+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS121D09+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS013B08+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS125B09+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFF048E20+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAG
JMFF041B23+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS040F10+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS102E03+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS101B07+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGA
JMFS051F05+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS042C09+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS136A03+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS138D01+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS088C02+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS029A06+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS121E01+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMSF042N23+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS114A11+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS116F10+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS027H06+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS116G06+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS027C09+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS161F07+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS031G05+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS162C01+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS032D05+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS048D11+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGATTAACAATG
JMFS032D07+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFF015O13+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFF009B11+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFF029A05+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS158D02+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS158E11+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFF006B10+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFF010C21+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFF027B20+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFF006I08+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFF040E13+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFS157G11+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
JMFF032C16+ CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
                      ____________________________________________________________
consensus CAGGAAAACAAGAACTCAAGAAAGAAAGAAATGAGCAGAAAAAGTAAAAGAGTAACAATG
 
. : . : . : . : . : . :
JMFS154F03+ AACACAAAACAGATGGGGGCAAATTA
JMFS040H11+ AACACAAAA
JMFF045I15+ AACAC
JMFS060D01+ AACACAAAACAGATGGGGGCAAATTAAA
JMFS119E06+ AACACAAAACAGATGGGGGCAAATTAAA
JMFS097C06+ AACACAAAACAGATGGGGGCAAATTAAA
JMFS152E06+ AACACAAAACAGATGGGGGCAAATTAAA
JMFS092B05+ AACACAAAACAGATGGGGGCAAATTAAA
JMFS153A02+ AACACAAAACAGATGGGGGCAAATTAAA
JMFS026E05+ AACACAAAACAGATGGGGGCAAATTAAAG
JMFS090H06+ AACACAAAACAGATGGGGGCAAATTAAAGAGAG
JMFS130C11+ AACAAAAAACAGATGGGGGCAAATTAAAGAGAG
JMFS168D04+ AACACAAAACAGATGGGGGCAAATTAAAGA
JMFS071D05+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCA
JMFS063B05+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAAATGA
JMFS119B09+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAAATGAAA
JMFS148C02+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAAA
JMFS090F08+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAAAT
JMFS147B11+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAA
JMFS100G01+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAAATGAAA
JMFS168F04+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAAATGAAAGAGT
JMFS107A06+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAAATGAAA
JMFS065G06+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAAATGAAA
JMFS094E02+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAAATGAAA
JMFS167A12+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAAATGAAA
JMFS138H02+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAAATGAA
JMFS011H07+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAAATGAAA
JMFS063C01+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAAATGAAAG
JMFS074A03+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAAATGAAAGA
JMFS066F11+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAAATGAAAGA
JMFS044B05+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAAATGAAAGA
JMFS041C04+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAAATGAAAGAGTT
JMFS140C06+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAAATGAAAGAGTTT
JMFS086A08+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAAATGAAA
JMFS057B02+ AACACAAAACAGATGGGGGCAAATTAAA
JMFS068D07+ AA
JMFS091F03+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAAATGAAAGAGTTT
JMFF047P13+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAAATGAAAGAGTTTTGCTT
JMFS108G02+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAAATGAAAGAGTT
JMFS099F04+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAAATGAAAG
JMFS153A03+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAAATGAAAGA
JMFS137H03+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAAAT
JMFF017E12+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAAA
JMFS001F03+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAAAT
JMFS117H09+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAAATGAAAGAGT
JMFS051G04+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAAATGAAAGA
JMFS121D09+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAAATGAA
JMFS013B08+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAAAT
JMFS125B09+ AACACAAAACAGATGGGGGCAAATTAAA
JMFF041B23+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAAATGAAAGAGTTTTGCTT
JMFS040F10+ AACACAAAACAGATGGGGGCAAATTAAAGA
JMFS102E03+ AACACAAAACAGATGGGGGCAAATTAAAGAGA
JMFS051F05+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAAATGAAAG
JMFS042C09+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAAATGAAA
JMFS136A03+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAAATGAAAGA
JMFS138D01+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAAATGAAAGAGTTT
JMFS088C02+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAAATGAAA
JMFS029A06+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAAATGAAA
JMFS121E01+ AACACAAAA
JMSF042N23+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAAATGAAAGAGTTTTGCTTTGGT
JMFS114A11+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAAATGAAA
JMFS116F10+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAAATGAAA
JMFS027H06+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAAATGAAA
JMFS116G06+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAAATGAAA
JMFS027C09+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAAATGAAAGAGTTT
JMFS161F07+ AACACAAAACAGATGGGGGCAAATTAAAGAGAG
JMFS031G05+ AACACAAAACAGATGGGGGCAAATTAAAGAGA
JMFS162C01+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAAATGAAAG
JMFS032D05+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAAATGAAA
JMFS048D11+ AACACAAAACAGANGGGGGCAAANNAAAGAGAGCAAA
JMFS032D07+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAAATGAAA
JMFF015O13+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAAATGAAAGAGTTTTGCTTTGGT
JMFF009B11+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAAATGAAAGAGTTTTGCTTTGGT
JMFF029A05+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAAATGAAAGAGTTTTGCTTTGG
JMFS158D02+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAAATGAAAGA
JMFS158E11+ AACACAAAACAGATGGGGGCAAATTAAAGAGAG
JMFF006B10+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAAATGAAAGAGTTTTGCTTTGGT
JMFF010C21+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAAATGAAAGAGTTTTGCTTTGGT
JMFF027B20+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAAATGAAAGAGTTTTGCTTTGGT
JMFF006I08+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAAATGAAAGAGTTTTGCTTTGGT
JMFF040E13+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAAATGAAAGAGTTTTGCTTTGGTGAT
JMFS157G11+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAAATGAAA
JMFF032C16+ AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAAATGAAAGAGTTTTGCTTTGGTGAT
                      ____________________________________________________________
consensus AACACAAAACAGATGGGGGCAAATTAAAGAGAGCAAATGAAAGAGTTTTGCTTTGGTGAT