Previous Contig 001444:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005C05Sequence475001444 (10)sp|Q41228|PSE1_NICSY1e-38Photosystem I reaction center subunit IV A, chloroplast precursor (PSI-E A).>pir598001444 (10)sp|Q41228|PSE1_NICSY2e-38Photosystem I reaction center subunit IV A, chloroplast precursor (PSI-E A).>pir
JMFF032A08Sequence506001444 (10)sp|Q41228|PSE1_NICSY1e-38Photosystem I reaction center subunit IV A, chloroplast precursor (PSI-E A).>pir609021373sp|Q41228|PSE1_NICSY2e-38Photosystem I reaction center subunit IV A, chloroplast precursor (PSI-E A).>pir
JMFF037D13Sequence592001444 (10)sp|Q41228|PSE1_NICSY2e-38Photosystem I reaction center subunit IV A, chloroplast precursor (PSI-E A).>pir
JMFF049N22Sequence613001444 (10)sp|Q41228|PSE1_NICSY2e-38Photosystem I reaction center subunit IV A, chloroplast precursor (PSI-E A).>pir462001444 (10)sp|Q41229|PSE2_NICSY7e-29Photosystem I reaction center subunit IV B, chloroplast precursor (PSI-E B).>pir
JMFN003M02Sequence627001444 (10)sp|Q41228|PSE1_NICSY2e-38Photosystem I reaction center subunit IV A, chloroplast precursor (PSI-E A).>pir
JMSF003D05Sequence526001444 (10)sp|Q41228|PSE1_NICSY2e-36Photosystem I reaction center subunit IV A, chloroplast precursor (PSI-E A).>pir
JMSF040O21Sequence624001444 (10)sp|Q41228|PSE1_NICSY2e-38Photosystem I reaction center subunit IV A, chloroplast precursor (PSI-E A).>pir572001444 (10)sp|Q41228|PSE1_NICSY2e-38Photosystem I reaction center subunit IV A, chloroplast precursor (PSI-E A).>pir

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF005C05- TT
JMFF049N22+ TTCCCACCAATAAGATT
                      ____________________________________________________________
consensus TTCCCACCAATAAGATT
 
. : . : . : . : . : . :
rJMFF005C05- ATTCTTGATGGAATGATTCAAGTTACTGCAAGAAGAGTATATTATCATACAACCATTG-T
JMFF049N22+ ATTCTTGATGGAATGATTCAAGTTACTGCAAGAAGAGTATATTATCATACAACCATTG-T
rJMSF040O21- ATGATTCAAGTTACTGCAAGAAGAGTATATTATCATACAACCATTG-T
rJMSF003D05- AGAAGAGTATNTTATCATACNACCATTGTT
JMFF037D13+ ATGGAATGATTCAAGTTACTGCAAGAAGAGTATATTATCATACAACCATTG-T
                      ____________________________________________________________
consensus ATTCTTGATGGAATGATTCAAGTTACTGCAAGAAGAGTATATTATCATACAACCATTG-T
 
. : . : . : . : . : . :
rJMFF005C05- CATTTCTGTTCAAGATCTGACAGGTAAACAACAACAGAAAGAAGATGGTCTAATTTTAAG
JMFF049N22+ CATTTCTGTTCAAGATCTGACAGGTAAACAACAACAGAAAGAAGATGGTCTAATTTTAAG
rJMSF040O21- CATTTCTGTTCAAGATCTGACAGGTAAACAACAACAGAAAGAAGATGGTCTAATTTTAAG
rJMSF003D05- CATTTCTGTTCAAGATCTGACAGGTAAACAACAACAGAAAGAAGATGGTCTAATTTTAAG
JMFF037D13+ CATTTCTGTTCAAGATCTGACAGGTAAACAACAACAGAAAGAAGATGGTCTAATTTTAAG
JMFF032A08+ CAGAAAGAAGATGGTCTAATTTTAAG
                      ____________________________________________________________
consensus CATTTCTGTTCAAGATCTGACAGGTAAACAACAACAGAAAGAAGATGGTCTAATTTTAAG
 
. : . : . : . : . : . :
rJMFF005C05- CCTCATTTCACCTCCTCAACCTCATCCAATGCATAGTTGTTGGTTGATACATTTGCATAG
JMFF049N22+ CCTCATTTCACCTCCTCAACCTCATCCAATGCATAGTTGTTGGTTGATACATTTGCATAG
rJMSF040O21- CCTCATTTCACCTCCTCAACCTCATCCAATGCATAGTTGTTGGTTGATACATTTGCATAG
JMFN003M02+ TCATCCAATGCATAGTTGTTGGTTGATACATTTGCATAG
rJMFF049N22- TCATCCAATGCATAGTTGTTGGTTGATACATTTGCATAG
JMFF005C05+ TCATTTCACCTCCTCAACCTCATCCAATGCATAGTTGTTGGTTGATACATTTGCATAG
rJMSF003D05- CCTCATTTCACCTCCTCAACCTCATCCAATGNATAGTTGTTGGTTGATACATTTGCATAG
JMSF040O21+ TCATCCAATGCATAGTTGTTGGTTGATACATTTGCATAG
JMFF037D13+ CCTCATTTCACCTCCTCAACCTCATCCAATGCATAGTTGTTGGTTGATACATTTGCATAG
JMFF032A08+ CCTCATTTCACCTCCTCAACCTCATCCAATGCATAGTTGTTGGTTGATACATTTGCATAG
                      ____________________________________________________________
consensus CCTCATTTCACCTCCTCAACCTCATCCAATGCATAGTTGTTGGTTGATACATTTGCATAG
 
. : . : . : . : . : . :
rJMFF005C05- TTCACCTTGTTGAACCTCACCACTACTGGATACCTAGTCTTGGGGTCCTGATCAACTGCC
JMFF049N22+ TTCACCTTGTTGAACCTCACCACTACTGGATACCTAGTCTTGGGGTCCTGATCAACTGCC
rJMSF040O21- TTCACCTTGTTGAACCTCACCACTACTGGATACCTAGTCTTGGGGTCCTGATCAACTGCC
JMFN003M02+ TTCACCTTGTTGAACCTCACCACTACTGGATACCTAGTCTTGGGGTCCTGATCAACTGCC
rJMFF049N22- TTCACCTTGTTGAACCTCACCACTACTGGATACCTAGTCTTGGGGTCCTGATCAACTGCC
JMFF005C05+ TTCACCTTGTTGAACCTCACCACTACTGGATACCTAGTCTTGGGGTCCTGATCAACTGCC
rJMSF003D05- TTCACCTTGTTGAACCTCACCACTACTGGATACCTAGTCTTGGGGTCCTGATCAACTGCC
JMSF040O21+ TTCACCTTGTTGAACCTCACCACTACTGGATACCTAGTCTTGGGGTCCTGATCAACTGCC
JMFF037D13+ TTCACCTTGTTGAACCTCACCACTACTGGATACCTAGTCTTGGGGTCCTGATCAACTGCC
JMFF032A08+ TTCACCTTGTTGAACCTCACCACTACTGGATACCTAGTCTTGGGGTCCTGATCAACTGCC
                      ____________________________________________________________
consensus TTCACCTTGTTGAACCTCACCACTACTGGATACCTAGTCTTGGGGTCCTGATCAACTGCC
 
. : . : . : . : . : . :
rJMFF005C05- ACAACTGATCCAACTCCCTTGAACCAGTATGACTCCTTCCTTAGAATCCTCACCTTGGCT
JMFF049N22+ ACAACTGATCCAACTCCCTTGAACCAGTATGACTCCTTCCTTAGAATCCTCACCTTGGCT
rJMSF040O21- ACAACTGATCCAACTCCCTTGAACCAGTATGACTCCTTCCTTAGAATCCTCACCTTGGCT
JMFN003M02+ ACAACTGATCCAACTCCCTTGAACCAGTATGACTCCTTCCTTAGAATCCTCACCTTGGCT
rJMFF049N22- ACAACTGATCCAACTCCCTTGAACCAGTATGACTCCTTCCTTAGAATCCTCACCTTGGCT
JMFF005C05+ ACAACTGATCCAACTCCCTTGAACCAGTATGACTCCTTCCTTAGAATCCTCACCTTGGCT
rJMSF003D05- ACAACTGATCCAACTCCCTTGAACCAGTATGACTCCTTCCTTANAATCCTCACCTTGGCT
JMSF040O21+ ACAACTGATCCAACTCCCTTGAACCAGTATGACTCCTTCCTTAGAATCCTCACCTTGGCT
JMFF037D13+ ACAACTGATCCAACTCCCTTGAACCAGTATGACTCCTTCCTTAGAATCCTCACCTTGGCT
JMFF032A08+ ACAACTGATCCAACTCCCTTGAACCAGTATGACTCCTTCCTTAGAATCCTCACCTTGGCT
                      ____________________________________________________________
consensus ACAACTGATCCAACTCCCTTGAACCAGTATGACTCCTTCCTTAGAATCCTCACCTTGGCT
 
. : . : . : . : . : . :
rJMFF005C05- CCTCTCTTGGGTCCAATGGGGGGTGGCTTGGCAGCTTTAGCCGGAGGAGCTTCAGCATCT
JMFF049N22+ CCTCTCTTGGGTCCAATGGGGGGTGGCTTGGCAGCTTTAGCCGGAGGAGCTTCAGCATCT
rJMSF040O21- CCTCTCTTGGGTCCAATGGGGGGTGGCTTGGCAGCTTTAGCCGGAGGAGCTTCAGCATCT
JMFN003M02+ CCTCTCTTGGGTCCAATGGGGGGTGGCTTGGCAGCTTTAGCCGGAGGAGCTTCAGCATCT
rJMFF049N22- CCTCTCTTGGGTCCAATGGGGGGTGGCTTGGCAGCTTTAGCCGGAGGAGCTTCAGCATCT
JMFF005C05+ CCTCTCTTGGGTCCAATGGGGGGTGGCTTGGCAGCTTTAGCCGGAGGAGCTTCAGCATCT
rJMSF003D05- CCTCTCTTGGGTCCAATGGGGNGTGGCTTGACAGCTTTAGCCGGAGGAGCTTCAGCATCT
JMSF040O21+ CCTCTCTTGGGTCCAATGGGGGGTGGCTTGGCAGCTTTAGCCGGAGGAGCTTCAGCATCT
JMFF037D13+ CCTCTCTTGGGTCCAATGGGGGGTGGCTTGGCAGCTTTAGCCGGAGGAGCTTCAGCATCT
JMFF032A08+ CCTCTCTTGGGTCCAATGGGGGGTGGCTTGGCAGCTTTAGCCGGAGGAGCTTCAGCATCT
                      ____________________________________________________________
consensus CCTCTCTTGGGTCCAATGGGGGGTGGCTTGGCAGCTTTAGCCGGAGGAGCTTCAGCATCT
 
. : . : . : . : . : . :
rJMFF005C05- GCGGCTGCCGGTGGTGGCGGCGCAGCCTCCTCGGCGGCTGCCCTTACGACAAGCCTGCAG
JMFF049N22+ GCGGCTGCCGGTGGTGGCGGCGCAGCCTCCTCGGCGGCTGCCCTTACGACAAGCCTGCAG
rJMSF040O21- GCGGCTGCCGGTGGTGGCGGCGCAGCCTCCTCGGCGGCTGCCCTTACGACAAGCCTGCAG
JMFN003M02+ GCGGCTGCCGGTGGTGGCGGCGCAGCCTCCTCGGCGGCTGCCCTTACGACAAGCCTGCAG
rJMFF049N22- GCGGCTGCCGGTGGTGGCGGCGCANCCTCCTCGGCGGCTGCCCTTACGACAAGCCTGCAG
JMFF005C05+ GCGGCTGCCGGTGGTGGCGGCGCAGCCTCCTCGGCGGCTGCCCTTACGACAAGCCTGCAG
rJMSF003D05- GCGGCTGCCGGTGGTGGCGGCGCANCCTCCTCGGCGGCTGCCCTTACNACAAGCCTGCAG
JMSF040O21+ GCGGCTGCCGGTGGTGGCGGCGCAGCCTCCTCGGCGGCTGCCCTTACGACAAGCCTGCAG
JMFF037D13+ GCGGCTGCCGGTGGTGGCGGCGCAGCCTCCTCGGCGGCTGCCCTTACGACAAGCCTGCAG
JMFF032A08+ GCGGCTGCCGGTGGTGGCGGCGCAGCCTCCTCGGCGGCTGCCCTTACGACAAGCCTGCAG
                      ____________________________________________________________
consensus GCGGCTGCCGGTGGTGGCGGCGCAGCCTCCTCGGCGGCTGCCCTTACGACAAGCCTGCAG
 
. : . : . : . : . : . :
rJMFF005C05- CGGGCGGGGGTGGTGGCATTCTTGGAAGGGAACATTACGATGTTGATCCGAGGTGTGGTG
JMFF049N22+ CGGGCGGGGGTGGTGGCATTCTTGGAAGGGAACATTACGATGTTGATCCGAGGTGTGGTG
rJMSF040O21- CGGGCGGGGGTGGTGGCATTCTTGGAAGGGAACATTACGATGTTGATCCGAGGTGTGGTG
JMFN003M02+ CGGGCGGGGGTGGTGGCATTCTTGGAAGGGAACATTACGATGTTGATCCGAGGTGTGGTG
rJMFF049N22- CGGGCGGGGGTGG
JMFF005C05+ CGGGCGGGGGTGGTGGCATTCTTGGAAGGGAACATTACGATGTTGATCCGAGGTGTGGTG
rJMSF003D05- CGGGCGGGGGTGGTGNCATTCTTGGAAGGGAACATTACGATGTTGATCCGAGGTGTGGTG
JMSF040O21+ CGGGCGGGGGTGGTGGCATTCTTGGAAGGGAACATTACGATGTTGATCCGAGGTGTGGTG
JMFF037D13+ CGGGCGGGGGTGGTGGCATTCTTGGAAGGGAACATTACGATGTTGATCCGAGGTGTGGTG
JMFF032A08+ CGGGCGGGGGTGGTGGCATTCTTGGAAGGGAACATTACGATGTTGATCCGAGGTGTGGTG
                      ____________________________________________________________
consensus CGGGCGGGGGTGGTGGCATTCTTGGAAGGGAACATTACGATGTTGATCCGAGGTGTGGTG
 
. : . : . : . : . : . :
rJMFF005C05- GTGTTTGAGGCCACCATTTTAGCAGTCAGCAGAAACTCAGACGCGGCTGATGCCATGCCG
JMFF049N22+ GTGTTTGAGGCCACCATTTTAGCAGTCAGCAGAAACTCAGACGCGGCTGATGCCATGCCG
rJMSF040O21- GTGTTTGAGGCCACCATTTTAGCAGTCAGCAGAAACTCAGACGCGGCTGATGCCATGCCG
JMFN003M02+ GTGTTTGAGGCCACCATTTTAGCAGTCAGCAGAAACTCAGACGCGGCTGATGCCATGCCG
JMFF005C05+ GTGTTTGAGGCCACCATTTTAGCAGTCAGCAGAAACTCAGACGCGGCTGATGCCATGCCG
rJMSF003D05- GTGTTTGAGGCCACCATTTTANCANTCANCAGAAACTCAGACNCGGCTGATGCCATGCCG
JMSF040O21+ GTGTTTGAGGCCACCATTTTAGCAGTCAGCAGAAACTCAGACGCGGCTGATGCCATGCCG
JMFF037D13+ GTGTTTGAGGCCACCATTTTAGCAGTCAGCAGAAACTCAGACGCGGCTGATGCCATGCCG
JMFF032A08+ GTGTTTGAGGCCACCATTTTAGCAGTCAGCAGAAACTCAGACGCGGCTGATGCCATGCCG
                      ____________________________________________________________
consensus GTGTTTGAGGCCACCATTTTAGCAGTCAGCAGAAACTCAGACGCGGCTGATGCCATGCCG
 
. : . : . : . : . : . :
rJMFF005C05- CAGCTTGCCATGGTTTGTCTCAACTGCTGCAAAGATGCGAATCCGAGTGCGGAAAAT
JMFF049N22+ CAGCTTGCCATGGTTTGTCTCAACTGCTGCAAAGATGCGAATCCGAGTGCGGAAAAT
rJMSF040O21- CAGCTTGCCATGGTTTGTCTCAACTGCTGCAAAGATGCGAATCC
JMFN003M02+ CAGCTTGCCATGGTTTGTCTCAACTGCTGCAAAGATGCGAATCCGA
JMFF005C05+ CAGCTTGCCATGGTTTGTCTCAACTGCTGCAAAGATGCGAATCCGAGTGCGGAAAAT
rJMSF003D05- CANCTTGCCATGGTTT
JMSF040O21+ CAGCTTGCCATGGTTTGTCTCAACTGCTGCAAAGATGCGAATCC
JMFF037D13+ CAGCTTGCCATGGTTTGTCTCAACTGCTGCAAAGATGCGAATCCGAGTGCGGAAAAT
JMFF032A08+ CAGCTTGCCATGGTTTGTCTCAACTGCTGCAAAGATGCGAATCCGAGTGCGGAAAATACT
                      ____________________________________________________________
consensus CAGCTTGCCATGGTTTGTCTCAACTGCTGCAAAGATGCGAATCCGAGTGCGGAAAATACT