Previous Contig 001443:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004I03Sequence515001443 (3)gb:AK176533_18185211e-12Arabidopsis thaliana mRNA, complete cds, clone: RAFL25-05-E08.741009698 (3)gb:ATT2L20_15557513e-85Arabidopsis thaliana DNA chromosome 5, BAC clone T2L20 (ESSA project).>gb:AY0911
JMFF032A02Sequence496001443 (3)gb:AC136219_17430557e-04Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0073E05, complet659009698 (3)gb:AP004326_18402118e-66Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OJ12
JMSF001P22Sequence267001443 (3)752009698 (3)gb:ATT2L20_15557517e-83Arabidopsis thaliana DNA chromosome 5, BAC clone T2L20 (ESSA project).>gb:AY0911

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF004I03+ GCCGAGCAGCCACTTAAGCCAAGCCG
                      ____________________________________________________________
consensus GCCGAGCAGCCACTTAAGCCAAGCCG
 
. : . : . : . : . : . :
JMFF004I03+ ATTTCTCGAGCTCCAGGAACCTCAGAACTATCGATCCCGGAATCCTTCCGTTCTCGATCG
JMFF032A02+ CTTCCGTTCTCGATCG
                      ____________________________________________________________
consensus ATTTCTCGAGCTCCAGGAACCTCAGAACTATCGATCCCGGAATCCTTCCGTTCTCGATCG
 
. : . : . : . : . : . :
JMFF004I03+ CCGCCTTCAAGTCCTTAGGCAAGCTCTCGAGCGATCTCCCCGCCTCCGCCAACACCATTA
JMFF032A02+ CCGCCTTCAAGTCCTTAGGCAAGCTCTCGAGCGATCTCCCCGCCTCCGCCAACACCATTA
                      ____________________________________________________________
consensus CCGCCTTCAAGTCCTTAGGCAAGCTCTCGAGCGATCTCCCCGCCTCCGCCAACACCATTA
 
. : . : . : . : . : . :
JMFF004I03+ ACGCCTCCTTCTTATTATTGCTGCTCTGATCGCCGCCCTCCGCGTCTCCATCTCCGCCGC
JMFF032A02+ ACGCCTCCTTCTTATTATTGCTGCTCTGATCGCCGCCCTCCGCGTCTCCATCTCCGCCGC
                      ____________________________________________________________
consensus ACGCCTCCTTCTTATTATTGCTGCTCTGATCGCCGCCCTCCGCGTCTCCATCTCCGCCGC
 
. : . : . : . : . : . :
JMSF001P22+ TCGCCGCCGCCAGCAGCGAATG
JMFF004I03+ CTCCGCCGGAGAAGTTCCCGCCGTTGACGCCTCCGTCGTCGCCGCCGCCAGCAGCGAATG
JMFF032A02+ CTCCGCCGGAGAAGTTCCCGCCGTTGACGCCTCCGTCGTCGCCGCCGCCAGCAGCGAATG
                      ____________________________________________________________
consensus CTCCGCCGGAGAAGTTCCCGCCGTTGACGCCTCCGTCGTCGCCGCCGCCAGCAGCGAATG
 
. : . : . : . : . : . :
JMSF001P22+ GAAGCAGCAGAAAAGTACGGCGGCTAGGGCTCAGCGAGCGATTCAAAGAGGCCGAAATGG
JMFF004I03+ GAAGCAGCAGAAAAGTACGGCGGCTAGGGCTCAGCGAGCGATTCAAAGAGGCCGAAATGG
JMFF032A02+ GAAGCAGCAGAAAAGTACGGCGGCTAGGGCTCAGCGAGCGATTCAAAGAGGCCGAAATGG
                      ____________________________________________________________
consensus GAAGCAGCAGAAAAGTACGGCGGCTAGGGCTCAGCGAGCGATTCAAAGAGGCCGAAATGG
 
. : . : . : . : . : . :
JMSF001P22+ AAGCCGGACGAGCGACGGTGGCCGGCACGGAGGCGAAAATGGCGGCGCGGTGAGTGAGGA
JMFF004I03+ AAGCCGGACGAGCGACGGTGGCCGGCACGGAGGCGAAAATGGCGGCGCGGTGAGTGAGGA
JMFF032A02+ AAGCCGGACGAGCGACGGTGGCCGGCACGGAGGCGAAAATGGCGGCGCGGTGAGTGAGGA
                      ____________________________________________________________
consensus AAGCCGGACGAGCGACGGTGGCCGGCACGGAGGCGAAAATGGCGGCGCGGTGAGTGAGGA
 
. : . : . : . : . : . :
JMSF001P22+ GCCTGGGGAGAGGAGGAGAGGGAGATCGCGGCGTGGAGAGGAAGCCGGCGGCGGCGATCG
JMFF004I03+ GCCTGGGGAGAGGAGGAGAGGGAGATCGCGGCGTGGAGAGGAAGCCGGCGGCGGCGATCG
JMFF032A02+ GCCTGGGGAGAGGAGGAGAGGGAGATCGCGGCGTGGAGAGGAAGCCGGCGGCGGCGATCG
                      ____________________________________________________________
consensus GCCTGGGGAGAGGAGGAGAGGGAGATCGCGGCGTGGAGAGGAAGCCGGCGGCGGCGATCG
 
. : . : . : . : . : . :
JMSF001P22+ ACATTGCTTCTGTTGTTGTTAACGCCGCCCTTAGAGAGAGTTTGGTAGCTGGCGCGCAGC
JMFF004I03+ ACATTGCTTCTGTTGTTGTTAACGCCGCCCTTAGAGAGAGTTTGGTAGCTGGCGCGCAGC
JMFF032A02+ ACATTGCTTCTGTTGTTGTTAACGCCGCCCTTAGAGAGAGTTTGGTAGCTGGCGCGCAGC
                      ____________________________________________________________
consensus ACATTGCTTCTGTTGTTGTTAACGCCGCCCTTAGAGAGAGTTTGGTAGCTGGCGCGCAGC
 
. : . : . : . : . : . :
JMSF001P22+ TTT
JMFF004I03+ TTT
JMFF032A02+ TTTGGTCTTCGCTCTAACTAGTTAACTACTTCTTTTATGCACGTTGAAGGAATGGTACCT
                      ____________________________________________________________
consensus TTTGGTCTTCGCTCTAACTAGTTAACTACTTCTTTTATGCACGTTGAAGGAATGGTACCT