Previous Contig 001442:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF031P13Sequence538001442 (6)pir|B96655|B966551e-66hypothetical protein F16P17.17 [imported] - Arabidopsis thaliana>gb:AE005173_893684001442 (6)gb:AP005775_18576784e-81Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJN
JMFF050F12Sequence586001442 (6)pir|B96655|B966556e-76hypothetical protein F16P17.17 [imported] - Arabidopsis thaliana>gb:AE005173_893399001442 (6)gb:AF387005_17948101e-21Arabidopsis thaliana Unknown protein (F16P17.17) mRNA, complete cds.
JMFS150C03Sequence462001442 (6)pir|B96655|B966559e-51hypothetical protein F16P17.17 [imported] - Arabidopsis thaliana>gb:AE005173_893
JMSF036L06Sequence631001442 (6)pir|B96655|B966553e-89hypothetical protein F16P17.17 [imported] - Arabidopsis thaliana>gb:AE005173_893595023732pir|S27923|S279232e-11gene LF3 protein - human herpesvirus 4>gb:HHV507799_2410012 Human herpesvirus 4

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF050F12- CAAAACATTGGTGAAAAATTCTTTACAGGGCTAATCCCAAATTATTCTTATTGAAA
rJMFF031P13- TTACAGTGCTAATCCCAAATTATTCATATTGAAA
                      ____________________________________________________________
consensus CAAAACATTGGTGAAAAATTCTTTACAGTGCTAATCCCAAATTATTCTTATTGAAA
 
. : . : . : . : . : . :
rJMFF050F12- TATGAGAGAAGATACAACTTTCAATACCCAACAAGCCTACTTTTGGATAAACAAAACCTG
rJMFF031P13- TATGAGAGAAGATACAACATTCAATACACAACAAGCCTACATTTGGATAAACAGAACCTG
                      ____________________________________________________________
consensus TATGAGAGAAGATACAACTTTCAATACCCAACAAGCCTACTTTTGGATAAACAGAACCTG
 
. : . : . : . : . : . :
rJMFF050F12- GGAAATGTAAACTTCCCCCCGATCAACATTGTACCAAAATCAAAAAAAAATATAAATTCT
rJMFF031P13- TGAAATGTAGACTTCACACCGATCAACATTGTACCAAAATCANAAAAAAATATAAATTCT
                      ____________________________________________________________
consensus TGAAATGTAGACTTCCCCCCGATCAACATTGTACCAAAATCAAAAAAAAATATAAATTCT
 
. : . : . : . : . : . :
rJMFF050F12- TGAAAAAAAATTCAAACCACTTATAAGGGTCAAGCAACGGGGGTCTTACAATTTGGCTTG
rJMFF031P13- TGAAATAAAATTCAAACCACTTATAAGGTTCAAGCAACGGGGGTCTTACGATTTGGCTTG
                      ____________________________________________________________
consensus TGAAATAAAATTCAAACCACTTATAAGGTTCAAGCAACGGGGGTCTTACGATTTGGCTTG
 
. : . : . : . : . : . :
rJMFF050F12- AACACGTATTGTATGAGGGACTCCTTGATCGACATGAGTTCCGGGAATTCCTTCTTTAAC
rJMFF031P13- AACACGTATTGTATGAGGGACTCCTTGATCGACATGAGTTCCGGGAATTCCTTCTTTAGC
                      ____________________________________________________________
consensus AACACGTATTGTATGAGGGACTCCTTGATCGACATGAGTTCCGGGAATTCCTTCTTTAGC
 
. : . : . : . : . : . :
rJMFF050F12- TTGGTAGCGCCAAGCTCATTGTTGCTTCTTGGAACAACTAAAACCTTTGCCTGCTCCTCG
rJMFF031P13- TTGGTAGCGTCAAGCTCATTGTTGCTTCTTGGAGCAACTATAACCTTTGCCTGCTCCTCN
                      ____________________________________________________________
consensus TTGGTAGCGTCAAGCTCATTGTTGCTTCTTGGAGCAACTATAACCTTTGCCTGCTCCTCG
 
. : . : . : . : . : . :
rJMFF050F12- AGGGAAAAGTTCTTCCACGTAAAACATGGATCAATGAATTCCC
rJMFF031P13- AGGGTAAAGTTCTTCCACGTAAAACATGGATCAATGTATTCCCTGTACATCTCCAGAATC
                      ____________________________________________________________
consensus AGGGTAAAGTTCTTCCACGTAAAACATGGATCAATGTATTCCCTGTACATCTCCAGAATC
 
. : . : . : . : . : . :
rJMFF031P13- TCGTTATGGCTGACCACTCCAGGGTTCGTGAAGTTCCATATCCCGGTGAGGTTTCTCTTT
                      ____________________________________________________________
consensus TCGTTATGGCTGACCACTCCAGGGTTCGTGAAGTTCCATATCCCGGTGAGGTTTCTCTTT
 
. : . : . : . : . : . :
rJMFF031P13- GCCATCTCGATGGATATAGGGAGGAGCTCGTCTAATATTGTCATCGAGTTTGGAATGTTA
                      ____________________________________________________________
consensus GCCATCTCGATGGATATAGGGAGGAGCTCGTCTAATATTGTCATCGAGTTTGGAATGTTA
 
. : . : . : . : . : . :
rJMFF031P13- ACCACCTTCTCGTAGCGAGCGATCTTGGTGATGAAGTTACGAGGGTTGGATAGATCAGAT
JMSF036L06+ CTCGTAGCGAGCGATCTTGGTGATGAAGTTACGAGGGTTGGATAGATCAGAT
                      ____________________________________________________________
consensus ACCACCTTCTCGTAGCGAGCGATCTTGGTGATGAAGTTACGAGGGTTGGATAGATCAGAT
 
. : . : . : . : . : . :
rJMFF031P13- GAGATAGGCATCCTCACTCGTAATGTGCAGACATTCTCATAGTTCTTGAGCAAATCCTCC
JMSF036L06+ GAGATAGGCATCCTCACTCGTAATGTGCAGACATTCTCATAGTTCTTGAGCAAATCCTCC
JMFF050F12+ GGCATCCTCACTCGTAATGTGCAGACATTCTCATAGGTCTTGAGCAAATCCTCC
                      ____________________________________________________________
consensus GAGATAGGCATCCTCACTCGTAATGTGCAGACATTCTCATAGTTCTTGAGCAAATCCTCC
 
. : . : . : . : . : . :
rJMFF031P13- ACCATGGCTTTGGTCTTGGAATAGAA
JMSF036L06+ ACCATGGCTTTGGTCTTGGAATAGAAGGACCCAATGAAATTAGGAGTGTCCTCCTCCTTG
JMFF050F12+ ACCATGGCTTTGGTCTTGGAATAGAAGGACCCAATGAAATTAGGAGTGTCCTCCTCCTAG
JMFF031P13+ CATGGCTTTGGTCTTGGAATAGAAGGACCCAATGAAATTAGGAGTGTCCCCCTCCTTG
                      ____________________________________________________________
consensus ACCATGGCTTTGGTCTTGGAATAGAAGGACCCAATGAAATTAGGAGTGTCCTCCTCCTTG
 
. : . : . : . : . : . :
JMSF036L06+ AAGCCGACGCCGGATCCGAGAACGTGGCCGGAATCGTACTCGAAAATGCAGCCGGTGGCG
JMFF050F12+ AAGCCGACGCCGGATCCGAGAACGTGGCCGGAATCGTACTCGAAAATGCAGCCGGTGGCG
JMFS150C03+ GGAATCGTACTGAGAAATGCAGCCGGTGGAG
JMFF031P13+ AAGCCGACGCCGGATCCGAGAACGTGGCCGGAATCGTACTCGAAAATGCAGCCGGTGGCG
                      ____________________________________________________________
consensus AAGCCGACGCCGGATCCGAGAACGTGGCCGGAATCGTACTCGAAAATGCAGCCGGTGGCG
 
. : . : . : . : . : . :
JMSF036L06+ AAGTTAATGAGCACCAGCCCCTTCTCCCTGCAGACGTCGGCGAGCGTGAGCGTGCCCACA
JMFF050F12+ AAGTTAATGAGCACCAGCCCCTTCTCCCTGCAGACGTCGGCGAGCGTGAGCGTGCCCACA
JMFS150C03+ GAGTTAATGAGCACCAGCCCTTTCTCCCTGCAGACGTCGGCGAGCGTGAGCGTGCCCACA
JMFF031P13+ AAGTTAATGAGCACCAGCCCCTTCTCCCTGCAGACGTCGGCGAGCGTGAGCGTGCCCACA
                      ____________________________________________________________
consensus AAGTTAATGAGCACCAGCCCCTTCTCCCTGCAGACGTCGGCGAGCGTGAGCGTGCCCACA
 
. : . : . : . : . : . :
JMSF036L06+ ACGTTGGCCCGGATGGTCTCCACCTTGTGGGACTCGCACCAGTCGACGTTCGGGCGGCCG
JMFF050F12+ ACGTTGGCCCGGATGGTCTCCACCTTGTGGGACTCGCACCAGTCGACGTTCGGGCGGCCG
JMFS150C03+ ACGTTGGCCCGGATGGTCTCCACCTTGTGGGACTCGCACCAGTCGACGTTCGGGCGGCCG
JMFF031P13+ ACGTTGGCCCGGATGGTCTCCACCTTGTGGGACTCGCACCAGTCGACGTTCGGGCGGCCG
                      ____________________________________________________________
consensus ACGTTGGCCCGGATGGTCTCCACCTTGTGGGACTCGCACCAGTCGACGTTCGGGCGGCCG
 
. : . : . : . : . : . :
JMSF036L06+ GTGACTCCGGCGGCGTTGAATACGTGGGTCGGGTTGACGGATGCGATGTCGGACTCCAAA
JMFF050F12+ GTGACTCCGGCGGCGTTGAATACGTGGGTCGGGTTGACGGATGCGATGTCGGACTCCAAA
JMFS150C03+ GTGACTCCGGCGGCGTTGAATACGTGGGTCGGGTTGACGGATGCGATGTCGGACTCCAAA
JMFF031P13+ GTGACTCCGGCGGCGTTGAATACGTGGGTCGGGTTGACGGATGCGATGTCGGACTCCAAA
                      ____________________________________________________________
consensus GTGACTCCGGCGGCGTTGAATACGTGGGTCGGGTTGACGGATGCGATGTCGGACTCCAAA
 
. : . : . : . : . : . :
JMSF036L06+ GATACCCGGTTCTCCAACCGCCCAGACCCGTAAGCGTAGTGGATCCCCTGAGCCTCGCAC
JMFF050F12+ GATACCCGGTTCTCCAACCGCCCAGACCCGTAAGCGTAGTGGATCCCCTGAGCCTCGCAC
JMFS150C03+ GATACCCGGTTCTCCAACCGCCCAGACCCGTAAGCGTAGTGGATCCCCTGAGCCTCGCAC
JMFF031P13+ GATACCCGGTTCTCCAACCGCCCAGACCCGTAAGCGTAGTGGATCCCCTGAGCCTCGCAC
                      ____________________________________________________________
consensus GATACCCGGTTCTCCAACCGCCCAGACCCGTAAGCGTAGTGGATCCCCTGAGCCTCGCAC
 
. : . : . : . : . : . :
JMSF036L06+ AGTTTGCCCAGCACACCGCCAATCCACCCGGTGCGGCCATAGATCAAGAACTTATACTGC
JMFF050F12+ AGTTTGCCCAGCACACCGCCAATCCACCCGGTGCGGCCATAGATCAAGGACTTATACTGC
JMFS150C03+ AGTTTGCCCAGCACACCGCCAATCCACCCGGTGCGGCCATAGATCAAGAACTTATACTGC
JMFF031P13+ AGTTTGCCCAGCACACCGCCAATCCACCCGGTGCGGCCATAGATCAAGAACTTATACTGC
                      ____________________________________________________________
consensus AGTTTGCCCAGCACACCGCCAATCCACCCGGTGCGGCCATAGATCAAGAACTTATACTGC
 
. : . : . : . : . : . :
JMSF036L06+ TTGGTTTCTGAGCCACTAACCGGGAAACCCATTGCGCCAAAAGCTGCTCAAATCAAATGG
JMFF050F12+ TTGGTTCCTGAGCCACTAACCGGGAAACCCATTGCGCCAAAAGCTGCTCAAATCAAATGG
JMFS150C03+ TTGGTTTCTGAGCCACTAACCGGGAAACCCATTGCGCCAAAAGCTGCTCAAATCAAATGG
JMFF031P13+ TTGGTTTCTGAGCCACTAACCGGGAAACCCATTGCGCCAAAAGCTGCTCAAATCAAATGG
                      ____________________________________________________________
consensus TTGGTTTCTGAGCCACTAACCGGGAAACCCATTGCGCCAAAAGCTGCTCAAATCAAATGG
 
. : . : . : . : . : . :
JMSF036L06+ AAAACGTATGTTCAATATAGACTATACTGCATACACCT
JMFF050F12+ AAAACGTATGTTCAATATAGACTATACTGCATACACCTAGCTAGCTCT
JMFS150C03+ AAAACGTATGTTCAA
JMFF031P13+ AAAACGTATGTTCAATATAGACTATACTGCATACACCTAGCTAGCTCTTCGTGCGTATAT
                      ____________________________________________________________
consensus AAAACGTATGTTCAATATAGACTATACTGCATACACCTAGCTAGCTCTTCGTGCGTATAT