Previous Contig 001441:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF031P12Sequence574001441 (4)gb:AY120725_15796071e-57Arabidopsis thaliana unknown protein (At3g27010) mRNA, complete cds.798012831 (3)gb:AY120725_1579607e-109Arabidopsis thaliana unknown protein (At3g27010) mRNA, complete cds.
JMFS151D06Sequence614001441 (4)gb:AY120725_15796071e-74Arabidopsis thaliana unknown protein (At3g27010) mRNA, complete cds.
JMSF008N04Sequence368001441 (4)gb:AY120725_15796071e-50Arabidopsis thaliana unknown protein (At3g27010) mRNA, complete cds.783012831 (3)gb:AY120725_1579607e-107Arabidopsis thaliana unknown protein (At3g27010) mRNA, complete cds.
JMSF032F08Sequence709001441 (4)gb:AY120725_15796078e-86Arabidopsis thaliana unknown protein (At3g27010) mRNA, complete cds.740012831 (3)gb:AY120725_15796076e-69Arabidopsis thaliana unknown protein (At3g27010) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF032F08+ ATTAGCATTGCCGT
                      ____________________________________________________________
consensus ATTAGCATTGCCGT
 
. : . : . : . : . : . :
JMFS151D06+ GCGAAGTGGGAC
JMSF032F08+ GGCAGTACCACTGGGGTATGTTAGTTTATAATCCATAACCATGACCTTGCGAAGTGGGAC
                      ____________________________________________________________
consensus GGCAGTACCACTGGGGTATGTTAGTTTATAATCCATAACCATGACCTTGCGAAGTGGGAC
 
. : . : . : . : . : . :
JMFS151D06+ AAGGCTGAAAAGGCCAAGAAAACTGACAACAAATATGAAACCCATCATCCATAACAGCCC
JMSF032F08+ AAGGCTGAAAAGGCCAAGAAAACTGACAACAAATATGAAACCCATCATCCATAACAGCCC
                      ____________________________________________________________
consensus AAGGCTGAAAAGGCCAAGAAAACTGACAACAAATATGAAACCCATCATCCATAACAGCCC
 
. : . : . : . : . : . :
JMFS151D06+ TGGATTCTTCACATCCTCTGCTCTATTGCCAGGGTAATCTGGCCCAATGAGCTGGTATGT
JMSF032F08+ TGGATTCTTCACATCCTCTGCTCTATTGCCAGGGTAATCTGGCCCAATGAGCTGGTATGT
JMFF031P12+ TGCCAGGGTAATCTGGCCCAATGAGCTGGTATGT
                      ____________________________________________________________
consensus TGGATTCTTCACATCCTCTGCTCTATTGCCAGGGTAATCTGGCCCAATGAGCTGGTATGT
 
. : . : . : . : . : . :
JMFS151D06+ TTTCTCATCCATAGAAAGCAAATATGATCCAAATCCACCGCTAAAGGCGAGGCCATAGCA
JMSF032F08+ TTTCTCATCCATAGAAAGCAAATATGATCCAAATCCACCGCTAAAGGCGAGGCCATAGCA
JMSF008N04+ TTTCTCATCCATAGAAAGCAAATATGATCCAAATCCACCGCTAAAGGCGAGGCCATAGCA
JMFF031P12+ TTTCTCATCCATAGAAAGCAAATATGATCCAAATCCACCGCTAAAGGCGAGGCCATAGCA
                      ____________________________________________________________
consensus TTTCTCATCCATAGAAAGCAAATATGATCCAAATCCACCGCTAAAGGCGAGGCCATAGCA
 
. : . : . : . : . : . :
JMFS151D06+ AGCAACAACACAGGTCTGAATAACGGTATTCTCTTGTCTGGTAAACGGCTGAACCGAAAA
JMSF032F08+ AGCAACAACACAGGTCTGAATAACGGTATTCTCTTGTCTGGTAAACGGCTGAACCGAAAA
JMSF008N04+ AGCAACAACACAGGTCTGAATAACGGTATTCTCTTGTCTGGTAAACGGCTGAACCGAAAA
JMFF031P12+ AGCAACAACACAGGTCTGAATAACGGTATTCTCTTGTCTGGTAAACGGCTGAACCGAAAA
                      ____________________________________________________________
consensus AGCAACAACACAGGTCTGAATAACGGTATTCTCTTGTCTGGTAAACGGCTGAACCGAAAA
 
. : . : . : . : . : . :
JMFS151D06+ GCCGAGTTTGGAGAGAAAGGCGGTCCAACTCTTGACGAAGAAGAAGCCGAGCAAACCAGC
JMSF032F08+ GCCGAGTTTGGAGAGAAAGGCGGTCCAACTCTTGACGAAGAAGAAGCCGAGCAAACCAGC
JMSF008N04+ GCCGAGTTTGGAGAGAAAGGCGGTCCAACTCTTGACGAAGAAGAAGCCGAGCAAACCAGC
JMFF031P12+ GCCGAGTTTGGAGAGAAAGGCGGTCCAACTCTTGACGAAGAAGAAGCCGAGCAAACCAGC
                      ____________________________________________________________
consensus GCCGAGTTTGGAGAGAAAGGCGGTCCAACTCTTGACGAAGAAGAAGCCGAGCAAACCAGC
 
. : . : . : . : . : . :
JMFS151D06+ GGCAACATTGAGGGAGGGGATGATCCCAACCGTGAGATTGAGCTTATGGGTGATTATACA
JMSF032F08+ GGCAACATTGAGGGAGGGGATGATCCCAACCGTGAGATTGAGCTTATGGGTGATTATACA
JMSF008N04+ GGCAACATTGAGGGAGGGGATGATCCCAACCGTGAGATTGAGCTTATGGGTGATTATACA
JMFF031P12+ GGCAACATTGAGGGAGGGGATGATCCCAACCGTGAGATTGAGCTTATGGGTGATTATACA
                      ____________________________________________________________
consensus GGCAACATTGAGGGAGGGGATGATCCCAACCGTGAGATTGAGCTTATGGGTGATTATACA
 
. : . : . : . : . : . :
JMFS151D06+ GAAGAGGGTTCCAAGCACCGCGCTCACCACCAGACCCCTAACAGTAATCTGCTCCTTCCA
JMSF032F08+ GAAGAGGGTTCCAAGCACCGCGCTCACCACCAGACCCCTAACAGTAATCTGCTCCTTCCA
JMSF008N04+ GAAGAGGGTTCCAAGCACCGCGCTCACCACCAGACCCCTAACAGTAATCTGCTCCTTCCA
JMFF031P12+ GAAGAGGGTTCCAAGCACCGCGCTCACCACCAGACCCCTAACAGTAATCTGCTCCTTCCA
                      ____________________________________________________________
consensus GAAGAGGGTTCCAAGCACCGCGCTCACCACCAGACCCCTAACAGTAATCTGCTCCTTCCA
 
. : . : . : . : . : . :
JMFS151D06+ ATCTGGAATCTCATCCACCTCCGCCTCCACTTTGTTATCATCTAACAAGTGCTCCGTTAT
JMSF032F08+ ATCTGGAATCTCATCCACCTCCGCCTCCACTTTGTTATCATCTAACAAGTGCTCCGTTAT
JMSF008N04+ ATCTGGAATCTCATCCACCTCCGCCTCCACTTTGTTATCATCTAACAAGTGCTCCGTT
JMFF031P12+ ATCTGGAATCTCATCCACCTCCGCCTCCACTTTGTTATCATCTAACAAGTGCTCCGTTAT
                      ____________________________________________________________
consensus ATCTGGAATCTCATCCACCTCCGCCTCCACTTTGTTATCATCTAACAAGTGCTCCGTTAT
 
. : . : . : . : . : . :
JMFS151D06+ CTCTGCTGCCGCATCCCCATTGCTTACGGTTCCCATCCTTGTTGGTGACAGCTAGGAGGA
JMSF032F08+ CTCTGCTGCCGCATCCCCATTGCTTACGGTTCCCATCCTTGTTGGTGACAGCTAGGAGGA
JMFF031P12+ CTCTGCTGCCGCATCCCCATTGCTTACGGTTCCCATCCTTGTTGGTGACAGCTAGGAGGA
                      ____________________________________________________________
consensus CTCTGCTGCCGCATCCCCATTGCTTACGGTTCCCATCCTTGTTGGTGACAGCTAGGAGGA
 
. : . : . : . : . : . :
JMFS151D06+ GTGAGAAGAGGTGGAGAGATCAGAAGATTGATCGTGAATGGTGGTGATGAAGATGAAGGG
JMSF032F08+ GTGAGAAGAGGTGGAGAGATCAGAAGATTGATCGTGAATGGTGGTGATGAAGATGAAGGG
JMFF031P12+ GTGAGAAGAGGTGGAGAGATCAGAAGATTGATCGTGAATGGTGGTGATGAAGATGAAGGG
                      ____________________________________________________________
consensus GTGAGAAGAGGTGGAGAGATCAGAAGATTGATCGTGAATGGTGGTGATGAAGATGAAGGG
 
. : . : . : . : . : . :
JMFS151D06+ CT
JMSF032F08+ CTGGGAAGTTGAAGAAAAGACAAGAAAAGAGGTT
JMFF031P12+ CTGGGAAGTTGAAGAAAAGACAAGAAAAGAGGTTGCTTGCTGGATTGGTACTTACTACTT
                      ____________________________________________________________
consensus CTGGGAAGTTGAAGAAAAGACAAGAAAAGAGGTTGCTTGCTGGATTGGTACTTACTACTT