Previous Contig 001440:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF008F18Sequence548001440 (5)gb:AB020755_15147093e-37Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MZN1.>gb:AY054176_15629728008545 (4)pir|G84825|G848251e-19probable CCCH-type zinc finger protein [imported] - Arabidopsis thaliana>gb:AC01
JMFF031O21Sequence583001440 (5)gb:AB020755_15147093e-37Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MZN1.>gb:AY054176_15629709008545 (4)pir|G84825|G848253e-19probable CCCH-type zinc finger protein [imported] - Arabidopsis thaliana>gb:AC01
JMFS109H07Sequence604001440 (5)gb:AB020755_15147093e-64Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MZN1.>gb:AY054176_15629
JMSF013P04Sequence497001440 (5)gb:AB020755_15147092e-33Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MZN1.>gb:AY054176_15629668008545 (4)pir|G84825|G848253e-19probable CCCH-type zinc finger protein [imported] - Arabidopsis thaliana>gb:AC01
JMSF045O19Sequence623001440 (5)gb:AB020755_15147091e-38Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MZN1.>gb:AY054176_15629637008545 (4)pir|G84825|G848257e-19probable CCCH-type zinc finger protein [imported] - Arabidopsis thaliana>gb:AC01

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS109H07+ ACTC
                      ____________________________________________________________
consensus ACTC
 
. : . : . : . : . : . :
JMFS109H07+ GGTCCAGTCATGAGAGTACGCCCGGGAACATGGCTTCACCTTAAACGTGTACATTCTGAA
                      ____________________________________________________________
consensus GGTCCAGTCATGAGAGTACGCCCGGGAACATGGCTTCACCTTAAACGTGTACATTCTGAA
 
. : . : . : . : . : . :
JMFS109H07+ GTCATCAGTCCCATAAATACCATTCTTTATGTCTGGAAGGGAGGGATCAATGGGGTATTC
                      ____________________________________________________________
consensus GTCATCAGTCCCATAAATACCATTCTTTATGTCTGGAAGGGAGGGATCAATGGGGTATTC
 
. : . : . : . : . : . :
JMFS109H07+ TTTCCTCTCACTCCCATCTTTCGAGACATTTGGATAGACCACCCGTTGCTCTTCAACCTT
                      ____________________________________________________________
consensus TTTCCTCTCACTCCCATCTTTCGAGACATTTGGATAGACCACCCGTTGCTCTTCAACCTT
 
. : . : . : . : . : . :
JMFS109H07+ TTCAATCAACCCGTAGCCTTCATCAGTATCACCACCGCCCTTGAGAACATGCTCCATCAT
JMSF045O19+ ATCACCACCGCCNTTGAGAACATGNTCCATCAT
                      ____________________________________________________________
consensus TTCAATCAACCCGTAGCCTTCATCAGTATCACCACCGCCCTTGAGAACATGCTCCATCAT
 
. : . : . : . : . : . :
JMFS109H07+ CTTCTTCTGCGAGGTGAATCTGCAGAAGGGGATCAAGTCAGCAGCCCGGTTTCCATTGGC
JMFF008F18+ ATCTGCAGAAGGGGATCAAGTCAGCAGCCCGGTTTCCATTGGC
JMSF045O19+ CTTTTTATGCGAGGTGAATCTGCAGAAGGGGATCAAGTCAGCAGCCCGGTTTCCATTGGC
JMFF031O21+ ATCTGCAGAAGGGGATCAAGTCAGCAGCCCGGTTTCCATTGGC
                      ____________________________________________________________
consensus CTTTTTCTGCGAGGTGAATCTGCAGAAGGGGATCAAGTCAGCAGCCCGGTTTCCATTGGC
 
. : . : . : . : . : . :
JMFS109H07+ GTCCACCAAATTCTCATCAGCCGAGTAACCAAGCAAGAGCTTGATAACATCAAGCGAGGC
JMSF013P04+ CAAGCAAGAGCTTGATAACATCAAGCGAGGC
JMFF008F18+ GTCCACCAAATTCTCATCAGCCGAGTAACCAAGCAAGAGCTTGATAACATCAAGCGAGGC
JMSF045O19+ GTCCACCAAATTCTCATCAGCCGAGTAACCAAGCAAGAGCTTGATAACATCAAGCGAGGC
JMFF031O21+ GTCCACCAAATTCTCATCAGCCGAGTAACCAAGCAAGAGCTTGATAACATCAAGCGAGGC
                      ____________________________________________________________
consensus GTCCACCAAATTCTCATCAGCCGAGTAACCAAGCAAGAGCTTGATAACATCAAGCGAGGC
 
. : . : . : . : . : . :
JMFS109H07+ AGTAGAGCCACCAGAAACCGCACAGTGGAGAGCAGTAGCCCCATCAGAGCCACAAGCTCG
JMSF013P04+ AGTAGAGCCACCAGAAACCGCACAGTGGAGAGCAGTAGCCCCATCAGAGCCACAAGCTCG
JMFF008F18+ AGTAGAGCCACCAGAAACCGCACAGTGGAGAGCAGTAGCCCCATCAGAGCCACAAGCTCG
JMSF045O19+ AGTAGAGCCACCAGAAACCGCACAGTGGAGAGCAGTAGCCCCATCAGAGCCACAAGCTCG
JMFF031O21+ AGTAGAGCCACCAGAAACCGCACAGTGGAGAGCAGTAGCCCCATCAGAGCCACAAGCTCG
                      ____________________________________________________________
consensus AGTAGAGCCACCAGAAACCGCACAGTGGAGAGCAGTAGCCCCATCAGAGCCACAAGCTCG
 
. : . : . : . : . : . :
JMFS109H07+ GTTAATCTCACCACAACCGTTCTCCAGAATATAATTCAGCACCCGTTTGCTACCAAAAAT
JMSF013P04+ GTTAATCTCACCACAACCGTTCTCCAGAATATAATTCAGCACCCGTTTGCTACCAAAAAT
JMFF008F18+ GTTAATCTCACCACAACCGTTCTCCAGAATATAATTCAGCACCCGTTTGCTACCAAAAAT
JMSF045O19+ GTTAATCTCACCACAACCGTTCTCCAGAATATAATTCAGCACCCGTTTGCTACCAAAAAT
JMFF031O21+ GTTAATCTCACCACAACCGTTCTCCAGAATATAATTCAGCACCCGTTTGCTACCAAAAAT
                      ____________________________________________________________
consensus GTTAATCTCACCACAACCGTTCTCCAGAATATAATTCAGCACCCGTTTGCTACCAAAAAT
 
. : . : . : . : . : . :
JMFS109H07+ TGAAGCAACCATAAGGGGTGTCCTCTCCTCATACCCCATCTTCTTAGAACCAATTCTTCT
JMSF013P04+ TGAAGCAACCATAAGGGGTGTCCTCTCCTCATACCCCATCTTCTTAGAACCAATTCTTCT
JMFF008F18+ TGAAGCAACCATAAGGGGTGTCCTCTCCTCATACCCCATCTTCTTAGAACCAATTCTTCT
JMSF045O19+ TGAAGCAACCATAAGGGGTGTCCTCTCCTCATACCCCATCTTCTTAGAACCAATTCTTCT
JMFF031O21+ TGAAGCAACCATAAGGGGTGTCCTCTCCTCATACCCCATCTTCTTAGAACCAATTCTTCT
                      ____________________________________________________________
consensus TGAAGCAACCATAAGGGGTGTCCTCTCCTCATACCCCATCTTCTTAGAACCAATTCTTCT
 
. : . : . : . : . : . :
JMFS109H07+ CCCATACCACAATCCTGACATGTTCACATCAAGACCCTCTTCTTCAACAGCTGCTCTAAA
JMSF013P04+ CCCATACCACAATCCTGACATGTTCACATCAAGACCCTCTTCTTCAACAGC
JMFF008F18+ CCCATACCACAATCCTGACATGTTCACATCAAGACCCTCTTCTTCAACAGCTGCTCTAAA
JMSF045O19+ CCCATACCACAATCCTGACATGTTCACATCAAGACCCTCTTCTTCAACAGCTGCTCTAAA
JMFF031O21+ CCCATACCACAATCCTGACATGTTCACATCAAGACCCTCTTCTTCAACAGCTGCTCTAAA
                      ____________________________________________________________
consensus CCCATACCACAATCCTGACATGTTCACATCAAGACCCTCTTCTTCAACAGCTGCTCTAAA
 
. : . : . : . : . : . :
JMFF008F18+ CCCTCTAAGATCATCATTCGCGGATAACTCGAGCAAAATCTCTTGCCCTTGAATTCCACC
JMSF045O19+ CCCTCTAAGATCATCATTCGCGGATAACTCGAGCAAAATCTCTTGCCCTTGAATTCCACC
JMFF031O21+ CCCTCTAAGATCATCATTCGCGGATAACTCGAGCAAAATCTCTTGCCCTTGAATTCCACC
                      ____________________________________________________________
consensus CCCTCTAAGATCATCATTCGCGGATAACTCGAGCAAAATCTCTTGCCCTTGAATTCCACC
 
. : . : . : . : . : . :
JMFF008F18+ TTCCATAGCTAGATCATCAGGAACAACTTTCCTCCTAGAGCCACTACACATCCTATCAAT
JMSF045O19+ TTCCATAGCTAGATCATCAGGAACAACTTTCCTCCTAGAGCCACTACACATCCTATCAAT
JMFF031O21+ TTCCATAGCTAGATCATCAGGAACAACTTTCCTCCTAGAGCCACTACACATCCTATCAAT
                      ____________________________________________________________
consensus TTCCATAGCTAGATCATCAGGAACAACTTTCCTCCTAGAGCCACTACACATCCTATCAAT
 
. : . : . : . : . : . :
JMFF008F18+ CTCTC
JMSF045O19+ CTCTCTCAAATTGGGCAGAGCAGAGAGAAAAGGGAAGAATATGAAACCCAGATTTCCCGC
JMFF031O21+ CTCTCTCAAATTGGGCAGAGCAGAGAGAAAAGGGAAGAATATGAAACCCAGATTTCCCGC
                      ____________________________________________________________
consensus CTCTCTCAAATTGGGCAGAGCAGAGAGAAAAGGGAAGAATATGAAACCCAGATTTCCCGC
 
. : . : . : . : . : . :
JMSF045O19+ ACAGGAAAAAGGGGAGCTAAACTCCAAATTGCTTAGAATGGGT
JMFF031O21+ ACAGGAAAAAGGGGAGCTAAACTCCAAATTGCTCAGAATGGGTTCACGCAATTCCTCTCC
                      ____________________________________________________________
consensus ACAGGAAAAAGGGGAGCTAAACTCCAAATTGCTTAGAATGGGTTCACGCAATTCCTCTCC