Previous Contig 001439:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF031M23Sequence588001439 (2)gb:AF016713_17615122e-82Lycopersicon esculentum oligopeptide transporter (LeOPT1) mRNA, complete cds.772009689 (2)gb:AF016713_17615121e-57Lycopersicon esculentum oligopeptide transporter (LeOPT1) mRNA, complete cds.
JMFF039I08Sequence517001439 (2)gb:AF016713_17615129e-64Lycopersicon esculentum oligopeptide transporter (LeOPT1) mRNA, complete cds.694009689 (2)gb:AF016713_17615126e-48Lycopersicon esculentum oligopeptide transporter (LeOPT1) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF031M23+ TTCTGATGGATCAGTGTCATCAAACTGATCAGCACCGAATGATGAAAC
                      ____________________________________________________________
consensus TTCTGATGGATCAGTGTCATCAAACTGATCAGCACCGAATGATGAAAC
 
. : . : . : . : . : . :
JMFF039I08+ CCTAGCGCTATCAGATAGAGGCCAAGAAAGAATACAGC
JMFF031M23+ ACACGGTTTAATCCCACCGGTTCCTAGCGCTATCAGATAGAGGCCAAGAAAGAATACAGC
                      ____________________________________________________________
consensus ACACGGTTTAATCCCACCGGTTCCTAGCGCTATCAGATAGAGGCCAAGAAAGAATACAGC
 
. : . : . : . : . : . :
JMFF039I08+ ATTCTGGGCAGGAGTAGCAGAAGGGCACACAGAGCCCTCACACCCAGCAGGCCTTAAAGC
JMFF031M23+ ATTCTGGGCAGGAGTAGCAGAAGGGCACACAGAGCCCTCACACCCAGCAGGCCTTAAAGC
                      ____________________________________________________________
consensus ATTCTGGGCAGGAGTAGCAGAAGGGCACACAGAGCCCTCACACCCAGCAGGCCTTAAAGC
 
. : . : . : . : . : . :
JMFF039I08+ AGGAACAGAAGCTGATAGAGTCAATGTGCACATTCCAATGAAATAAATGGTT--GAAGGC
JMFF031M23+ AGGAACAGAAGCTGATAGAGTCAATGTGCACATTCCAATGAAATAAATGGTTGAGAAGGC
                      ____________________________________________________________
consensus AGGAACAGAAGCTGATAGAGTCAATGTGCACATTCCAATGAAATAAATGGTTGAGAAGGC
 
. : . : . : . : . : . :
JMFF039I08+ AGCAATGGTCCAATATCTTCCCCAGTATGCATCTGCCAGGAAAGCTCCAATAAGGGGAGT
JMFF031M23+ AGCAATGGTCCAATATCTTCCCCAGTATGCATCTGCCAGGAAAGCTCCAATAAGGGGAGT
                      ____________________________________________________________
consensus AGCAATGGTCCAATATCTTCCCCAGTATGCATCTGCCAGGAAAGCTCCAATAAGGGGAGT
 
. : . : . : . : . : . :
JMFF039I08+ AAGGTAACAGGTGCCTGCCCAAGTGGTGATGTTTGTAGCAGCAGAGGCATTTCCTTCATG
JMFF031M23+ AAGGTAACAGGTGCCTGCCCAAGTGGTGATGTTTGTAGCAGCAGAGGCATTTCCTTCATG
                      ____________________________________________________________
consensus AAGGTAACAGGTGCCTGCCCAAGTGGTGATGTTTGTAGCAGCAGAGGCATTTCCTTCATG
 
. : . : . : . : . : . :
JMFF039I08+ CAAATATTTTGTGAGATAGCTCACAAGATTTATGGCAATCCCATAGTAGGCCAACCGTTC
JMFF031M23+ CAAATATTTTGTGAGATAGCTCACAAGATTTATGGCAATCCCATAGTAGGCCAACCGTTC
                      ____________________________________________________________
consensus CAAATATTTTGTGAGATAGCTCACAAGATTTATGGCAATCCCATAGTAGGCCAACCGTTC
 
. : . : . : . : . : . :
JMFF039I08+ ACAACATTCAGTACTAAGTATAAAGGGACAAGCTTTCCAGGTTCCAGTA
JMFF031M23+ ACAACATTCAGTACTAAGTATAAAGGGACAAGCTTTCCAGGTTCCAGTATTTGCTTTTAG
                      ____________________________________________________________
consensus ACAACATTCAGTACTAAGTATAAAGGGACAAGCTTTCCAGGTTCCAGTATTTGCTTTTAG
 
. : . : . : . : . : . :
JMFF031M23+ AACAGGGTTCCCCTTAATGTCAACTGAAGCATCTCCTGCATAGATTTTGCAGTTTTGTGT
                      ____________________________________________________________
consensus AACAGGGTTCCCCTTAATGTCAACTGAAGCATCTCCTGCATAGATTTTGCAGTTTTGTGT
 
. : . : . : . : . : . :
JMFF031M23+ CTGTGGAAGAAGAAGATGGTGTTCTAAGAGCAATGTGTCTTCTTGATGAGTCTCCATTAC
                      ____________________________________________________________
consensus CTGTGGAAGAAGAAGATGGTGTTCTAAGAGCAATGTGTCTTCTTGATGAGTCTCCATTAC