Previous Contig 001436:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001F05Sequence588001436 (120)gb:NTOEE2AG_16916563e-61N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.737001436 (120)sp|P93566|PSBP_SOLTU2e-76Oxygen-evolving enhancer protein 2, chloroplast precursor (OEE2) (23 kDa subunit
JMFF007B06Sequence542001436 (120)gb:NTOEE2AG_16916566e-53N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.749011673 (5)gb:CAR276267_16452092e-64Cicer arietinum mRNA for putative PTS protein (ORF1), clone CanPts.
JMFF007D04Sequence568001436 (120)gb:NTOEE2AG_16916562e-62N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.730001436 (120)sp|P93566|PSBP_SOLTU4e-87Oxygen-evolving enhancer protein 2, chloroplast precursor (OEE2) (23 kDa subunit
JMFF011H19Sequence469001436 (120)gb:NTOEE2AG_16916565e-37N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.657001436 (120)sp|P93566|PSBP_SOLTU7e-68Oxygen-evolving enhancer protein 2, chloroplast precursor (OEE2) (23 kDa subunit
JMFF013I18Sequence703001436 (120)sp|P93566|PSBP_SOLTU1e-96Oxygen-evolving enhancer protein 2, chloroplast precursor (OEE2) (23 kDa subunit
JMFF014I03Sequence548001436 (120)gb:NTOEE2AG_16916562e-52N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.711001436 (120)sp|P93566|PSBP_SOLTU1e-80Oxygen-evolving enhancer protein 2, chloroplast precursor (OEE2) (23 kDa subunit
JMFF015M03Sequence669001436 (120)sp|P93566|PSBP_SOLTU4e-83Oxygen-evolving enhancer protein 2, chloroplast precursor (OEE2) (23 kDa subunit
JMFF016P24Sequence570001436 (120)gb:NTOEE2AG_16916562e-62N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.768001436 (120)pir|S17446|S174466e-88photosystem II oxygen-evolving complex protein 2 precursor - common tobacco
JMFF017E01Sequence542001436 (120)gb:NTOEE2AG_16916563e-51N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.675001436 (120)sp|P93566|PSBP_SOLTU1e-76Oxygen-evolving enhancer protein 2, chloroplast precursor (OEE2) (23 kDa subunit
JMFF017H21Sequence602001436 (120)gb:NTOEE2AG_16916563e-61N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.715001436 (120)sp|P93566|PSBP_SOLTU4e-87Oxygen-evolving enhancer protein 2, chloroplast precursor (OEE2) (23 kDa subunit
JMFF023B03Sequence477001436 (120)gb:NTOEE2AG_16916564e-34N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.750001436 (120)sp|P93566|PSBP_SOLTU2e-88Oxygen-evolving enhancer protein 2, chloroplast precursor (OEE2) (23 kDa subunit
JMFF023E22Sequence400001436 (120)gb:NTOEE2AG_16916561e-21N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.695001436 (120)sp|P93566|PSBP_SOLTU6e-83Oxygen-evolving enhancer protein 2, chloroplast precursor (OEE2) (23 kDa subunit
JMFF023H09Sequence516001436 (120)gb:NTOEE2AG_16916569e-43N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.713001436 (120)sp|O49344|PSP2_ARATH2e-78Oxygen-evolving enhancer protein 2-2, chloroplast precursor (OEE2) (23 kDa subun
JMFF028O10Sequence509001436 (120)gb:NTOEE2AG_16916564e-45N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.674001436 (120)sp|P93566|PSBP_SOLTU2e-77Oxygen-evolving enhancer protein 2, chloroplast precursor (OEE2) (23 kDa subunit
JMFF029C15Sequence475001436 (120)gb:NTOEE2AG_16916563e-34N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.672001436 (120)sp|P93566|PSBP_SOLTU7e-76Oxygen-evolving enhancer protein 2, chloroplast precursor (OEE2) (23 kDa subunit
JMFF031A17Sequence638001436 (120)gb:NTOEE2AG_16916569e-67N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.722001436 (120)sp|P93566|PSBP_SOLTU2e-88Oxygen-evolving enhancer protein 2, chloroplast precursor (OEE2) (23 kDa subunit
JMFF031F09Sequence571001436 (120)gb:NTOEE2AG_16916562e-62N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.676001436 (120)sp|P93566|PSBP_SOLTU3e-97Oxygen-evolving enhancer protein 2, chloroplast precursor (OEE2) (23 kDa subunit
JMFF031H06Sequence603001436 (120)gb:NTOEE2AG_16916562e-62N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.717001436 (120)sp|P93566|PSBP_SOLTU1e-84Oxygen-evolving enhancer protein 2, chloroplast precursor (OEE2) (23 kDa subunit
JMFF031L05Sequence592001436 (120)gb:NTOEE2AG_16916564e-52N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.679001436 (120)sp|P93566|PSBP_SOLTU1e-85Oxygen-evolving enhancer protein 2, chloroplast precursor (OEE2) (23 kDa subunit
JMFF034L03Sequence578001436 (120)gb:NTOEE2AG_16916565e-57N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.715001436 (120)sp|P93566|PSBP_SOLTU6e-84Oxygen-evolving enhancer protein 2, chloroplast precursor (OEE2) (23 kDa subunit
JMFF035J02Sequence542001436 (120)gb:NTOEE2AG_16916563e-51N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.661001436 (120)sp|P93566|PSBP_SOLTU9e-75Oxygen-evolving enhancer protein 2, chloroplast precursor (OEE2) (23 kDa subunit
JMFF035L13Sequence639001436 (120)gb:NTOEE2AG_16916565e-67N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.715001436 (120)sp|P93566|PSBP_SOLTU3e-92Oxygen-evolving enhancer protein 2, chloroplast precursor (OEE2) (23 kDa subunit
JMFF036L24Sequence681001436 (120)sp|P93566|PSBP_SOLTU4e-87Oxygen-evolving enhancer protein 2, chloroplast precursor (OEE2) (23 kDa subunit
JMFF039A18Sequence567001436 (120)gb:NTOEE2AG_16916561e-49N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.715001436 (120)sp|P93566|PSBP_SOLTU6e-83Oxygen-evolving enhancer protein 2, chloroplast precursor (OEE2) (23 kDa subunit
JMFF041E22Sequence636001436 (120)gb:NTOEE2AG_16916564e-66N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.613001436 (120)sp|P93566|PSBP_SOLTU2e-57Oxygen-evolving enhancer protein 2, chloroplast precursor (OEE2) (23 kDa subunit
JMFF045D24Sequence643001436 (120)gb:NTOEE2AG_16916565e-59N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.612001436 (120)sp|P93566|PSBP_SOLTU3e-64Oxygen-evolving enhancer protein 2, chloroplast precursor (OEE2) (23 kDa subunit
JMFF045F17Sequence644001436 (120)gb:NTOEE2AG_16916565e-68N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.588001436 (120)sp|P16059|PSBP_PEA2e-28Oxygen-evolving enhancer protein 2, chloroplast precursor (OEE2) (23 kDa subunit
JMFF045N08Sequence660001436 (120)gb:NTOEE2AG_16916566e-69N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.564001436 (120)sp|P16059|PSBP_PEA1e-50Oxygen-evolving enhancer protein 2, chloroplast precursor (OEE2) (23 kDa subunit
JMFN001E08Sequence534001436 (120)gb:NTOEE2AG_16916563e-62N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.
JMFN004I11Sequence627001436 (120)gb:NTOEE2AG_16916561e-74N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.
JMFN032C21Sequence629001436 (120)gb:NTOEE2AG_16916563e-72N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.
JMFN032O04Sequence631001436 (120)pir|S17446|S174464e-65photosystem II oxygen-evolving complex protein 2 precursor - common tobacco
JMFN037E08Sequence596001436 (120)gb:NTOEE2AG_16916562e-68N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.
JMFS110G12Sequence521001436 (120)pir|T02873|T028733e-48probable photosystem II oxygen-evolving complex protein 2 precursor - rice>gb:AF
JMSF003I06Sequence324001436 (120)gb:NTOEE2AG_16916569e-15N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.694001436 (120)sp|P93566|PSBP_SOLTU9e-87Oxygen-evolving enhancer protein 2, chloroplast precursor (OEE2) (23 kDa subunit
JMSF003N19Sequence322001436 (120)gb:NTOEE2AG_16916567e-12N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.727001436 (120)sp|P93566|PSBP_SOLTU5e-86Oxygen-evolving enhancer protein 2, chloroplast precursor (OEE2) (23 kDa subunit
JMSF006M18Sequence293001436 (120)gb:NTOEE2AG_16916563e-07N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.
JMSF007E23Sequence334001436 (120)gb:NTOEE2AG_16916561e-20N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.734001436 (120)sp|P93566|PSBP_SOLTU2e-93Oxygen-evolving enhancer protein 2, chloroplast precursor (OEE2) (23 kDa subunit
JMSF007K13Sequence390001436 (120)gb:NTOEE2AG_16916563e-32N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.735001436 (120)sp|P93566|PSBP_SOLTU5e-93Oxygen-evolving enhancer protein 2, chloroplast precursor (OEE2) (23 kDa subunit
JMSF010C07Sequence280001436 (120)gb:NTOEE2AG_16916564e-06N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.732001436 (120)sp|P93566|PSBP_SOLTU8e-92Oxygen-evolving enhancer protein 2, chloroplast precursor (OEE2) (23 kDa subunit
JMSF011I23Sequence262001436 (120)gb:NTRNATNM3_16917493e-04N.tabacum mRNA (TNM3) for PSII 23-kDa polypeptide.695001436 (120)sp|P93566|PSBP_SOLTU4e-87Oxygen-evolving enhancer protein 2, chloroplast precursor (OEE2) (23 kDa subunit
JMSF014M14Sequence250001436 (120)gb:NTRNATNM3_16917493e-04N.tabacum mRNA (TNM3) for PSII 23-kDa polypeptide.777001436 (120)sp|P93566|PSBP_SOLTU1e-94Oxygen-evolving enhancer protein 2, chloroplast precursor (OEE2) (23 kDa subunit
JMSF014P13Sequence444001436 (120)gb:NTOEE2AG_16916562e-33N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.733001436 (120)sp|P93566|PSBP_SOLTU2e-92Oxygen-evolving enhancer protein 2, chloroplast precursor (OEE2) (23 kDa subunit
JMSF018F23Sequence439001436 (120)gb:NTOEE2AG_16916562e-35N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.705001436 (120)sp|P93566|PSBP_SOLTU4e-63Oxygen-evolving enhancer protein 2, chloroplast precursor (OEE2) (23 kDa subunit
JMSF019O16Sequence460001436 (120)gb:NTOEE2AG_16916565e-37N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.731001436 (120)sp|P93566|PSBP_SOLTU2e-92Oxygen-evolving enhancer protein 2, chloroplast precursor (OEE2) (23 kDa subunit
JMSF020P09Sequence645001436 (120)gb:NTOEE2AG_16916563e-72N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.766001436 (120)sp|P93566|PSBP_SOLTU3e-71Oxygen-evolving enhancer protein 2, chloroplast precursor (OEE2) (23 kDa subunit
JMSF022K11Sequence666001436 (120)gb:NTOEE2AG_16916566e-77N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.699001436 (120)sp|P93566|PSBP_SOLTU4e-87Oxygen-evolving enhancer protein 2, chloroplast precursor (OEE2) (23 kDa subunit
JMSF026I08Sequence599001436 (120)gb:NTOEE2AG_16916561e-63N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.730001436 (120)sp|P93566|PSBP_SOLTU1e-94Oxygen-evolving enhancer protein 2, chloroplast precursor (OEE2) (23 kDa subunit
JMSF028E11Sequence668001436 (120)gb:NTOEE2AG_16916567e-73N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.696001436 (120)sp|P93566|PSBP_SOLTU4e-87Oxygen-evolving enhancer protein 2, chloroplast precursor (OEE2) (23 kDa subunit
JMSF028H08Sequence614001436 (120)gb:NTOEE2AG_16916561e-63N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.700001436 (120)sp|P93566|PSBP_SOLTU2e-88Oxygen-evolving enhancer protein 2, chloroplast precursor (OEE2) (23 kDa subunit
JMSF028L12Sequence672001436 (120)gb:NTOEE2AG_16916563e-67N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.
JMSF028N11Sequence559001978 (13)pir|F96593|F965934e-30hypothetical protein F7A10.20 [imported] - Arabidopsis thaliana>gb:AE005173_8934227001436 (120)pir|T02873|T028731e-26probable photosystem II oxygen-evolving complex protein 2 precursor - rice>gb:AF
JMSF032D02Sequence676001436 (120)gb:NTOEE2AG_16916562e-77N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.627001436 (120)sp|P93566|PSBP_SOLTU8e-75Oxygen-evolving enhancer protein 2, chloroplast precursor (OEE2) (23 kDa subunit
JMSF032F22Sequence607001436 (120)gb:NTOEE2AG_16916564e-63N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.681001436 (120)sp|P93566|PSBP_SOLTU2e-84Oxygen-evolving enhancer protein 2, chloroplast precursor (OEE2) (23 kDa subunit
JMSF032G11Sequence612001436 (120)gb:NTOEE2AG_16916561e-63N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.729001436 (120)sp|P93566|PSBP_SOLTU3e-92Oxygen-evolving enhancer protein 2, chloroplast precursor (OEE2) (23 kDa subunit
JMSF032L15Sequence614001436 (120)gb:NTOEE2AG_16916561e-63N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.694001436 (120)sp|P93566|PSBP_SOLTU9e-82Oxygen-evolving enhancer protein 2, chloroplast precursor (OEE2) (23 kDa subunit
JMSF036C18Sequence650001436 (120)gb:NTOEE2AG_16916566e-73N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.694001436 (120)sp|P93566|PSBP_SOLTU5e-93Oxygen-evolving enhancer protein 2, chloroplast precursor (OEE2) (23 kDa subunit
JMSF038M05Sequence610001436 (120)gb:NTOEE2AG_16916564e-63N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.816001436 (120)sp|P93566|PSBP_SOLTU2e-94Oxygen-evolving enhancer protein 2, chloroplast precursor (OEE2) (23 kDa subunit
JMSF040H10Sequence577001436 (120)gb:NTOEE2AG_16916561e-63N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.855001436 (120)gb:NTOEE2AR_1691657e-101N.tabacum mRNA for photosystem II oxygen evolving complex 23 kDa polypeptide.
JMSF041E24Sequence716001436 (120)gb:NTOEE2AG_16916563e-81N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.644001436 (120)sp|P93566|PSBP_SOLTU5e-74Oxygen-evolving enhancer protein 2, chloroplast precursor (OEE2) (23 kDa subunit
JMSF041P15Sequence764001436 (120)pir|S17446|S174469e-94photosystem II oxygen-evolving complex protein 2 precursor - common tobacco553001436 (120)sp|P93566|PSBP_SOLTU1e-60Oxygen-evolving enhancer protein 2, chloroplast precursor (OEE2) (23 kDa subunit
JMSF043A20Sequence726001436 (120)gb:NTOEE2AG_16916569e-80N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.731001436 (120)sp|P93566|PSBP_SOLTU3e-92Oxygen-evolving enhancer protein 2, chloroplast precursor (OEE2) (23 kDa subunit
JMSF047A20Sequence692001436 (120)gb:NTOEE2AG_16916562e-82N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.708001436 (120)sp|P93566|PSBP_SOLTU4e-87Oxygen-evolving enhancer protein 2, chloroplast precursor (OEE2) (23 kDa subunit
JMSF047L03Sequence591001436 (120)gb:NTOEE2AG_16916562e-61N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.695001436 (120)sp|P93566|PSBP_SOLTU4e-87Oxygen-evolving enhancer protein 2, chloroplast precursor (OEE2) (23 kDa subunit
JMSF048N04Sequence619007868 (2)gb:NTOEE2AG_16916568e-14N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.788001436 (120)sp|P93566|PSBP_SOLTU3e-83Oxygen-evolving enhancer protein 2, chloroplast precursor (OEE2) (23 kDa subunit
JMSF049G18Sequence645001436 (120)pir|S17446|S174467e-65photosystem II oxygen-evolving complex protein 2 precursor - common tobacco
JMSF051A06Sequence615001436 (120)gb:NTOEE2AG_16916561e-63N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.753001436 (120)sp|P93566|PSBP_SOLTU6e-93Oxygen-evolving enhancer protein 2, chloroplast precursor (OEE2) (23 kDa subunit
JMSF052B20Sequence131001436 (120)gb:AK175738_18177264e-12Arabidopsis thaliana mRNA for putative photosystem II oxygen-evolving complex 23

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF045F17- CCCAATGGTTTCTTTTCCATCCAAT
                      ____________________________________________________________
consensus CCCAATGGTTTCTTTTCCATCCAAT
 
. : . : . : . : . : . :
rJMFF045F17- GTCAATTCAGCATTTACATTGAGCAAGAATATGAAATGTGCATTAACTTTTTTAAGTAAT
                      ____________________________________________________________
consensus GTCAATTCAGCATTTACATTGAGCAAGAATATGAAATGTGCATTAACTTTTTTAAGTAAT
 
. : . : . : . : . : . :
rJMFF045F17- AAAATACCTTTGAATCGGTCAGGGATCTTTGGCTTTGATATTTAGCTAGCTAGGATGTTG
rJMSF020P09- AAATACCTTTGAATCGGTCAGGGATCTTTGGCTTTGATATTTAGCTAGCTAGGATGTTG
                      ____________________________________________________________
consensus AAAATACCTTTGAATCGGTCAGGGATCTTTGGCTTTGATATTTAGCTAGCTAGGATGTTG
 
. : . : . : . : . : . :
rJMFF045F17- AATTTTATCTTCTGAGAAGAGAGAAACAGAACAGAGATGGTTGAAATATACT-GGATTTA
rJMSF020P09- AATTTTATCTTCTGAGAAGAGAGAAACAGAACAGAGATGGTTGAAATATACT-GGATTTA
rJMFF035J02- T-GGATTTA
rJMFF011H19- ATGGTTGAAATATACTGGGATTTA
rJMFF041E22- GGTTGAAATATACT-GGATTTA
rJMFF045N08- TGGTTGAAATATACT-GGATTTA
JMFS110G12+ GGTTGAAATATACT-GGATTTA
rJMFF001F05- TCTTCTGAGAAGAGAGAAACAGAACAGAGATGGTTGAAATATACT-GGATTTA
rJMFF017E01- TACT-GGATTTA
rJMFF029C15- ACT-GGATTTA
rJMFF014I03- ATGGTTGAAATATACT-GGATTTA
rJMFF007D04- T-GGATTTA
rJMFF039A18- AATATACT-GGATTTA
rJMFF034L03- CT-GGATTTA
rJMFF023H09- CT-GGATTTA
rJMFF023B03- TGGTTGAAATATACT-GGATTTA
                      ____________________________________________________________
consensus AATTTTATCTTCTGAGAAGAGAGAAACAGAACAGAGATGGTTGAAATATACT-GGATTTA
 
. : . : . : . : . : . :
rJMFF045F17- TCCACATTAGCCTCCATCATGACACCAAAACATTTCTAAAACTTTATGGGCAAGGCAGAA
rJMSF020P09- TCCACATTAGCCTCCATCATGACACCAAAACATTTCTAAAACTTTATGGGCAAGGCAGAA
rJMFF035J02- TCCACATTAGCCTCCATCATGACACCAAAACATTTCTAAAACTTTATGGGCAAGGCAGAA
rJMFF011H19- TCCACATTAGCCTCCATCATGACACCAAAACATTTCTAAAACTTTATGGCCAAGGCAGAA
rJMSF032D02- ACATTTCTAAAACTTTATGGGCAAGGCAGAA
rJMFF041E22- TCCACATTAGCCTCCATCATGACACCAAAACATTTCTAAAACTTTATGGGCAAGGCAGAA
rJMFF045D24- TGACACCAAAACATTTCTAAAACTTTATGGGCAAGGCAGAA
rJMSF041P15- AAACATTTCTAAAACTTTATGGGCAAGGCAGAA
rJMFF045N08- TCCACATTAGCCTCCATCATGACACCAAAACATTTCTAAAACTTTATGGGCAAGGCAGAA
JMFS110G12+ TCCACATTAGCCTCCATCATGACACCAAAACATTTCTAAAACTTTATGGGCAAGGCAGAA
rJMFF001F05- TCCACATTAGCCTCCATCATGACACCAAAACATTTCTAAAACTTTATGGGCAAGGCAGAA
rJMFF017E01- TCCACATTAGCCTCCATCATGACACCAAAACATTTCTAAAACTTTATGGGCAAGGCAGAA
rJMFF029C15- TCCACATTAGCCTCCATCATGACACCAAAACATTTCTAAAACTTTATGGGCAAGGCAGAA
rJMFF014I03- TCCACATTAGCCTCCATCATGACACCAAAACATTTCTAAAACTTTATGGGCAAGGCAGAA
rJMFF017H21- TTAGNCTCCATCATGACACCAAAACATTTCTAAAACTTTATGGGCAAGGCAGAA
rJMFF031H06- CATTAGCCTCCATCATGACACCAAAACATTTCTAAAACTTTATGGGCAAGGCAGAA
rJMSF047A20- CATCATGACACCAAAACATTTCTAAAACTTTATGGGCAAGGCAGAA
rJMSF048N04- CATCATGACACCAAAACATTTCTAAAACTTTATGGGCAAGGCAGAA
rJMSF032F22- AAACATTTCTAAAACTTTATGGGCAAGGCAGAA
rJMFF036L24- AACTTTATGGGCAAGGCAGAA
rJMFF015M03- ACTTTATGGGCAAGGCAGAA
rJMFF028O10- CATCATGACACCAAAACATTTCTAAAACTTTATGGGCAAGGCAGAA
rJMSF041E24- AAACATTTCTAAAACTTTATGGGCAAGGCAGAA
rJMFF007D04- TCCACATTAGCCTCCATCATGACACCAAAACATTTCTAAAACTTTATGGGCAAGGCAGAA
rJMFF031A17- ATTAGCCTCCATCATGACACCAAAACATTTCTAAAACTTTATGGGCAAGGCAGAA
rJMFF039A18- CCCACATTAGCCTCCATCATGACACCAAAACATTTCTAAAACTTTATGGGCAAGGCAGAA
rJMFF034L03- TCCACATTAGCCTCCATCATGACACCAAAACATTTCTAAAACTTTATGGGCAAGGCAGAA
rJMFF023H09- TCCACATTAGCCTCCATCATGACACCAAAACATTTCTAAAACTTTATGGGCAAGGCAGAA
rJMSF028E11- CAAAACATTTCTAAAACTTTATGGGCAAGGCAGAA
rJMFF023E22- ATTAGCCTCCATCATGACACCAAAACATTTCTAAAACTTTATGGGCAAGGCAGAA
rJMFF023B03- CCCACATTAGCCTCCATCATGACACCAAAACATTTCTAAAACTTTATGGGCAAGGCAGAA
rJMSF051A06- ATTAGCCTCCATCATGACACCAAAACATTTCTAAAACTTTATGGGCAAGGCAGAA
rJMSF028H08- AAAACATTTCTAAAACTTTATGGGCAAGGCAGAA
rJMSF019O16- CAAAACATTTCTAAAACTTTATGGGCAAGGCAGAA
rJMSF003N19- AAACATTTCTAAAACTTTATGGGCAAGGCAGAA
rJMFF035L13- CTTTATGGGCAAGGCAGAA
rJMFF016P24- TCCACATTAGCCTCCATCATGACACCAAAACATTTCTAAAACTTTATGGGCAAGGCAGAA
rJMSF022K11- AAAACATTTCTAAAACTTTATGGGCAAGGCAGAA
rJMSF047L03- AAAACATTTCTAAAACTTTATGGGCAAGGCAGAA
rJMSF003I06- AAACATTTCTAAAACTTTATGGGCAAGGCAGAA
rJMSF032L15- AAAACATTTCTAAAACTTTATGGGCAAGGCAGAA
rJMSF007K13- AAAACATTTCTAAAACTTTATGGGCAAGGCAGAA
rJMSF014P13- AACATTTCTAAAACTTTATGGGCAAGGCAGAA
rJMSF043A20- AAACATTTCTAAAACTTTATGGGCAAGGCAGAA
rJMSF032G11- ACATTTCTAAAACTTTATGGGCAAGGCAGAA
rJMSF010C07- AACATTTCTAAAACTTTATGGGCAAGGCAGAA
rJMSF011I23- AAACATTTCTAAAACTTTATGGGCAAGGCAGAA
rJMSF018F23- AACATTTCTAAAACTTTATGGGCAAGGCAGAA
rJMFF031L05- ACTTTATGGGCAAGGCAGAA
rJMSF007E23- AAACATTTCTAAAACTTTATGGGCAAGGCAGAA
rJMSF038M05- AAACATTTCTAAAACTTTATGGGCAAGGCAGAA
rJMSF040H10- AGGCAGAA
                      ____________________________________________________________
consensus TCCACATTAGCCTCCATCATGACACCAAAACATTTCTAAAACTTTATGGGCAAGGCAGAA
 
. : . : . : . : . : . :
rJMFF045F17- GAAGGTTTAAAAGCTCAGTTTAGCAGGCAGCATGTGATTTAGGGGAACAAAACACTACAT
rJMSF020P09- GAAGGTTTAAAAGCTCAGTTTAGCAGGCAGCATGTGATTTAGGGGAACAAAACACTACAT
rJMFF035J02- GAAGGTTTAAAAGCTCAGTTTAGCAGGCAGCATGTGATTTAGGGGAACAAAACACTACAT
rJMFF011H19- GAAGGTTTAAAAGCTCAGTTTAGCAGGCAGCATGTGATTTAGGGGAACAAAACACTACAT
rJMSF032D02- GAAGGTTTAAAAGCTCAGTTTAGCAGGCAGCATGTGATTTAGGGGAACAAAACACTACAT
rJMFF041E22- GAAGGTTTAAAAGCTCAGTTTAGCAGGCAGCATGTGATTTAGGGGAACAAAACACTACAT
rJMFF045D24- GAAGGTTTAAAAGCTCAGTTTAGCAGGCAGCATGTGATTTAGGGGAACAAAACACTACAT
rJMSF041P15- GAAGGTTTAAAAGCTCAGTTTAGCAGGCAGCATGTGATTTAGGGGAACAAAACACTACAT
rJMFF045N08- GAAGGTTTAAAAGCTCAGTTTAGCAGGCAGCATGTGATTTAGGGGAACAAAACACTACAT
JMFS110G12+ GAAGGTTTAAAAGCTCAGTTTAGCAGGCAGCATGTGATTTAGGGGAACAAAACACTACAT
rJMFF001F05- GAAGGTTTAAAAGCTCAGTTTAGCAGGCAGCATGTGATTTAGGGGAACAAAACACTACAT
rJMFF017E01- GAAGGTTTAAAAGCTCAGTTTAGCAGGCAGCATGTGATTTAGGGGAACAAAACACTACAT
rJMFF029C15- GAAGGTTTAAAAGCTCAGTTTAGCAGGCAGCATGTGATTTAGGGGAACAAAACACTACAT
rJMFF014I03- GAAGGTTTAAAAGCTCAGTTTAGCAGGCAGCATGTGATTTAGGGGAACAAAACACTACAT
rJMFF017H21- GAAGGTTTAAAAGCTCAGTTTAGCAGGCAGCATGTGATTTAGGGGAACAAAACACTACAT
rJMFF031H06- GAAGGTTTAAAAGCTCAGTTTAGCAGGCAGCATGTGATTTAGGGGAACAAAACACTACAT
rJMSF047A20- GAAGGTTTAAAAGCTCAGTTTAGCAGGCAGCATGTGATTTAGGGGAACAAAACACTACAT
rJMSF048N04- GAAGGTTTAAAAGCTCAGTTTAGCAGGCAGCATGTGATTTAGGGGAACAAAACACTACAT
rJMSF032F22- GAAGGTTTAAAAGCTCAGTTTAGCAGGCAGCATGTGATTTAGGGGAACAAAACACTACAT
rJMFF036L24- GAAGGTTTAAAAGCTCAGTTTAGCAGGCAGCATGTGATTTAGGGGAACAAAACACTACAT
rJMFF015M03- GAAGGTTTAAAAGCTCAGTTTAGCAGGCAGCATGTGATTTAGGGGAACAAAACACTACAT
rJMFF028O10- GAAGGTTTAAAAGCTCAGTTTAGCAGGCAGCATGTGATTTAGGGGAACAAAA-ACTACAT
rJMSF041E24- GAAGGTTTAAAAGCTCAGTTTAGCAGGCAGCATGTGATTTAGGGGAACAAAACACTACAT
rJMFF007D04- GAAGGTTTAAAAGCTCAGTTTAGCAGGCAGCATGTGATTTAGGGGAACAAAACACTACAT
rJMFF031A17- GAAGGTTTAAAAGCTCAGTTTAGCAGGCAGCATGTGATTTAGGGGAACAAAACACTACAT
rJMFF039A18- GAAGGTTTAAAAGCTCAGTTTAGCAGGCAGCATGTGATTTAGGGGAACAAAACACTACAT
rJMFF034L03- GAAGGTTTAAAAGCTCAGTTTAGCAGGCAGCATGTGATTTAGGGGAACAAAACACTACAT
rJMFF023H09- GAAGGTTTAAAAGCTCAGTTTAGCAGGCAGCATGTGATTTAGGGGAACAAAACACTACAT
rJMSF028E11- GAAGGTTTAAAAGCTCAGTTTAGCAGGCAGCATGTGATTTAGGGGAACAAAACACTACAT
rJMFF023E22- GAAGGTTTAAAAGCTCAGTTTAGCAGGCAGCATGTGATTTAGGGGAACAAAACACTACAT
rJMFF023B03- GAAGGTTTAAAAGCTCAGTTTAGCAGGCAGCATGTGATTTAGGGGAACAAAACACTACAT
rJMSF051A06- GAAGGTTTAAAAGCTCAGTTTAGCAGGCAGCATGTGATTTAGGGGAACAAAACACTACAT
rJMSF028H08- GAAGGTTTAAAAGCTCAGTTTAGCAGGCAGCATGTGATTTAGGGGAACAAAACACTACAT
rJMSF019O16- GAAGGTTTAAAAGCTCAGTTTAGCAGGCAGCATGTGATTTAGGGGAACAAAACACTACAT
rJMSF003N19- GAAGGTTTAAAAGCTCAGTTTAGCAGGCAGCATGTGATTTAGGGGAACAAAACACTACAT
rJMFF035L13- GAAGGTTTAAAAGCTCAGTTTAGCAGGCAGCATGTGATTTAGGGGAACAAAACACTACAT
rJMFF016P24- GAAGGTTTAAAAGCTCAGTTTAGCAGGCAGCATGTGATTTAGGGGAACAAAACACTACAT
rJMSF022K11- GAAGGTTTAAAAGCTCAGTTTAGCAGGCAGCATGTGATTTAGGGGAACAAAACACTACAT
rJMSF047L03- GAAGGTTTAAAAGCTCAGTTTAGCAGGCAGCATGTGATTTAGGGGAACAAAACACTACAT
rJMSF003I06- GAAGGTTTAAAAGCTCAGTTTAGCAGGCAGCATGTGATTTAGGGGAACAAAACACTACAT
rJMSF032L15- GAAGGTTTAAAAGCTCAGTTTAGCAGGCAGCATGTGATTTAGGGGAACAAAACACTACAT
rJMSF007K13- GAAGGTTTAAAAGCTCAGTTTAGCAGGCAGCATGTGATTTAGGGGAACAAAACACTACAT
rJMSF014P13- GAAGGTTTAAAAGCTCAGTTTAGCAGGCAGCATGTGATTTAGGGGAACAAAACACTACAT
rJMSF043A20- GAAGGTTTAAAAGCTCAGTTTAGCAGGCAGCATGTGATTTAGGGGAACAAAACACTACAT
rJMSF032G11- GAAGGTTTAAAAGCTCAGTTTAGCAGGCAGCATGTGATTTAGGGGAACAAAACACTACAT
rJMSF010C07- GAAGGTTTAAAAGCTCAGTTTAGCAGGCAGCATGTGATTTAGGGGAACAAAACACTACAT
rJMSF011I23- GAAGGTTTAAAAGCTCAGTTTAGCAGGCAGCATGTGATTTAGGGGAACAAAACACTACAT
rJMSF036C18- GGTTTAAAAGCTCAGTTTAGCAGGCAGCATGTGATTTAGGGGAACAAAACACTACAT
rJMSF018F23- GAAGGTTTAAAAGCTCAGTTTAGCAGGCAGCATGTGATTTAGGGGAACAAAACACTACAT
rJMFF031L05- GAAGGTTTAAAAGCTCAGTTTAGCAGGCAGCATGTGATTTAGGGGAACAAAACACTACAT
rJMSF007E23- GAAGGTTTAAAAGCTCAGTTTAGCAGGCAGCATGTGATTTAGGGGAACAAAACACTACAT
rJMSF026I08- AAACACTACAT
rJMFF013I18- GCAGCATGTGATTTAGGGGAACAAAACACTACAT
rJMFF031F09- CACTACAT
rJMSF014M14- AAAGCTCAGTTTAGCAGGCAGCATGTGATTTAGGGGAACAAAACACTACAT
rJMSF038M05- GAAGGTTTAAAAGCTCAGTTTAGCAGGCAGCATGTGATTTAGGGGAACAAAACACTACAT
rJMSF040H10- G-AGGTTTAAAAGCTCAGTTTAGCAGGCAGCATGTGATTTAGGGGAACAAAACACTACAT
                      ____________________________________________________________
consensus GAAGGTTTAAAAGCTCAGTTTAGCAGGCAGCATGTGATTTAGGGGAACAAAACACTACAT
 
. : . : . : . : . : . :
rJMFF045F17- ACAGACTGACTGAACTCAGAAACACATTCAACCTTAAGCAAGGCTGAAAGAACTGGCAGA
rJMSF020P09- ACAGACTGACTGAACTCAGAAACACATTCAACCTTAAGCAAGGCTGAAAGAACTGGCAGA
rJMFF035J02- ACAGACTGACTGAACTCAGAAACACATTCAACCTTAAGCAAGGCTGAAAGAACTGGCAGA
rJMFF011H19- ACAGACTGACTGAACTCAGAAACACATTCAACCTTAAGCAAGGCTGAAAGAACTGGCAGA
rJMSF032D02- ACAGACTGACTGAACTCAGAAACACATTCAACCTTAAGCAAGGCTGAAAGAACTGGCAGA
rJMFF041E22- ACAGACTGACTGAACTCAGAAACACATTCAACCTTAAGCAAGGCTGAAAGAACTGGCAGA
rJMFF045D24- ACAGACTGACTGAACTCAGAAACACATTCAACCTTAAGCAAGGCTGAAAGAACTGGCAGA
rJMSF041P15- ACAGACTGACTGAACTCAGAAACACATTCAACCTTAAGCAAGGCTGAAAGAACTGGCAGA
rJMFF045N08- ACAGACTGACTGAACTCAGAAACACATTCAACCTTAAGCAAGGCTGAAAGAACTGGCAGA
rJMSF028N11- AAGAACTGGCAGA
JMFS110G12+ ACAGACTGACTGAACTCAGAAACACATTCAACCTTAAGCAAGGCTGAAAGAACTGGCAGA
rJMFF001F05- ACAGACTGACTGAACTCAGAAACACATTCAACCTTAAGCAAGGCTGAAAGAACTGGCAGA
rJMFF017E01- ACAGACTGACTGAACTCAGAAACACATTCAACCTTAAGCAAGGCTGAAAGAACTGGCAGA
rJMFF029C15- ACAGACTGACTGAACTCAGAAACACATTCAACCTTAAGCAAGGCTGAAAGAACTGGCAGA
rJMFF014I03- ACAGACTGACTGAACTCAGAAACACATTCAACCTTAAGCAAGGCTGAAAGAACTGGCAGA
rJMFF017H21- ACAGACTGACTGAACTCAGAAACACATTCAACCTTAAGCAAGGCTGAAAGAACTGGCAGA
rJMFF031H06- ACAGACTGACTGAACTCAGAAACACATTCAACCTTAAGCAAGGCTGAAAGAACTGGCAGA
rJMSF047A20- ACAGACTGACTGAACTCAGAAACACATTCAACCTTAAGCAAGGCTGAAAGAACTGGCAGA
rJMSF048N04- ACAGACTGACTGAACTCAGAAACACATTCAACCTTAAGCAAGGCTGAAAGAACTGGCAGA
rJMSF032F22- ACAGACTGACTGAACTCAGAAACACATTCAACCTTAAGCAAGGCTGAAAGAACTGGCAGA
rJMFF036L24- ACAGACTGACTGAACTCAGAAACACATTCAACCTTAAGCAAGGCTGAAAGAACTGGCAGA
rJMFF015M03- ACAGACTGACTGAACTCAGAAACACATTCAACCTTAAGCAAGGCTGAAAGAACTGGCAGA
rJMFF028O10- ACAGACTGACTGAACTCAGAAACACATTCAACCTTAAGCAAGGCTGAAAGAACTGGCAGA
rJMSF041E24- ACAGACTGACTGAACTCAGAAACACATTCAACCTTAAGCAAGGCTGAAAGAACTGGCAGA
rJMFF007D04- ACAGACTGACTGAACTCAGAAACACATTCAACCTTAAGCAAGGCTGAAAGAACTGGCAGA
rJMFF031A17- ACAGACTGACTGAACTCAGAAACACATTCAACCTTAAGCAAGGCTGAAAGAACTGGCAGA
rJMFF039A18- ACAGACTGACTGAACTCAGAAACACATTCAACCTTAAGCAAGGCTGAAAGAACTGGCAGA
rJMFF034L03- ACAGACTGACTGAACTCAGAAACACATTCAACCTTAAGCAAGGCTGAAAGAACTGGCAGA
rJMFF023H09- ACAGACTGACTGAACTCAGAAACACATTCAACCTTAAGCAAGGCTGAAAGAACTGGCAGA
rJMSF028E11- ACAGACTGACTGAACTCAGAAACACATTCAACCTTAAGCAAGGCTGAAAGAACTGGCAGA
rJMFF023E22- ACAGACTGACTGAACTCAGAAACACATTCAACCTTAAGCAAGGCTGAAAGAACTGGCAGA
rJMFF023B03- ACAGACTGACTGAACTCAGAAACACATTCAACCTTAAGCAAGGCTGAAAGAACTGGCAGA
rJMSF051A06- ACAGACTGACTGAACTCAGAAACACATTCAACCTTAAGCAAGGCTGAAAGAACTGGCAGA
rJMSF028H08- ACAGACTGACTGAACTCAGAAACACATTCAACCTTAAGCAAGGCTGAAAGAACTGGCAGA
rJMSF019O16- ACAGACTGACTGAACTCAGAAACACATTCAACCTTAAGCAAGGCTGAAAGAACTGGCAGA
rJMSF003N19- ACAGACTGACTGAACTCAGAAACACATTCAACCTTAAGCAAGGCTGAAAGAACTGGCAGA
rJMFF035L13- ACAGACTGACTGAACTCAGAAACACATTCAACCTTAAGCAAGGCTGAAAGAACTGGCAGA
rJMFF016P24- ACAGACTGACTGAACTCAGAAACACATTCAACCTTAAGCAAGGCTGAAAGAACTGGCAGA
rJMSF022K11- ACAGACTGACTGAACTCAGAAACACATTCAACCTTAAGCAAGGCTGAAAGAACTGGCAGA
rJMSF047L03- ACAGACTGACTGAACTCAGAAACACATTCAACCTTAAGCAAGGCTGAAAGAACTGGCAGA
rJMSF003I06- ACAGACTGACTGAACTCAGAAACACATTCAACCTTAAGCAAGGCTGAAAGAACTGGCAGA
rJMSF032L15- ACAGACTGACTGAACTCAGAAACACATTCAACCTTAAGCAAGGCTGAAAGAACTGGCAGA
rJMSF007K13- ACAGACTGACTGAACTCAGAAACACATTCAACCTTAAGCAAGGCTGAAAGAACTGGCAGA
rJMSF014P13- ACAGACTGACTGAACTCAGAAACACATTCAACCTTAAGCAAGGCTGAAAGAACTGGCAGA
rJMSF043A20- ACAGACTGACTGAACTCAGAAACACATTCAACCTTAAGCAAGGCTGAAAGAACTGGCAGA
rJMSF032G11- ACAGACTGACTGAACTCAGAAACACATTCAACCTTAAGCAAGGCTGAAAGAACTGGCAGA
rJMSF010C07- ACAGACTGACTGAACTCAGAAACACATTCAACCTTAAGCAAGGCTGAAAGAACTGGCAGA
rJMSF011I23- ACAGACTGACTGAACTCAGAAACACATTCAACCTTAAGCAAGGCTGAAAGAACTGGCAGA
rJMSF036C18- ACAGACTGACTGAACTCAGAAACACATTCAACCTTAAGCAAGGCTGAAAGAACTGGCAGA
rJMSF018F23- ACAGACTGACTGAACTCAGAAACACATTCAACCTTAAGCAAGGCTGAAAGAACTGGCAGA
rJMFF031L05- ACAGACTGACTGAACTCAGAAACACATTCAACCTTAAGCAAGGCTGAAAGAACTGGCAGA
rJMSF007E23- ACAGACTGACTGAACTCAGAAACACATTCAACCTTAAGCAAGGCTGAAAGAACTGGCAGA
rJMSF026I08- ACAGACTGACTGAACTCAGAAACACATTCAACCTTAAGCAAGGCTGAAAGAACTGGCAGA
rJMFF013I18- ACAGACTGACTGAACTCAGAAACACATTCAACCTTAAGCAAGGCTGAAAGAACTGGCAGA
rJMFF031F09- ACAGACTGACTGAACTCAGAAACACATTCAACCTTAAGCAAGGCTGAAAGAACTGGCAGA
rJMSF014M14- ACAGACTGACTGAACTCAGAAACACATTCAACCTTAAGCAAGGCTGAAAGAACTGGCAGA
rJMSF038M05- ACAGACTGACTGAACTCAGAAACACATTCAACCTTAAGCAAGGCTGAAAGAACTGGCAGA
rJMSF040H10- ACAGACTGACTGAACTCAGAAACACATTCAACCTTAAGCAAGGCTGAAAGAACTGGCAGA
                      ____________________________________________________________
consensus ACAGACTGACTGAACTCAGAAACACATTCAACCTTAAGCAAGGCTGAAAGAACTGGCAGA
 
. : . : . : . : . : . :
rJMFF045F17- GCCCTCGACAAACTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCTGCCTGTGCCTTGCA
rJMSF020P09- GCCCTCGACAAACTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCTGCCTGTGCCTTGCA
rJMFF035J02- GCCCTCGACAAACTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCTGCCTGTGCCTTGCA
rJMFF011H19- GCCCTCGACAAACTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCTGCCTGTGCCTTGCA
rJMSF032D02- GCCCTCGACAAACTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCTGCCTGTGCCTTGCA
rJMFF041E22- GCCCTCGACAAACTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCTGCCTGTGCCTTGCA
rJMFF045D24- GCCCTCGACAAACTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCTGCCTGTGCCTTGCA
rJMSF041P15- GCCCTCGACAAACTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCTGCCTGTGCCTTGCA
rJMFF045N08- GCCCTCGACAAACTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCTGCCTGTGCCTTGCA
rJMSF028N11- GCCCTCGACAAANTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCTGCCTGTGCCTTGCA
rJMSF052B20- CCTCGACAAACTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCNGCCNGNGCCTTGGA
JMFS110G12+ GCCCTCGACAAACTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCTGCCTGTGCCTTGCA
rJMFF001F05- GCCCTCGACAAACTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCTGCCTGTGCCTTGCA
rJMFF017E01- GCCCTCGACAAACTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCTGCCTGTGCCTTGCA
rJMFF029C15- GCCCTCGACAAACTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCTGCCTGTGCCTTGCA
rJMFF014I03- GCCCTCGACAAACTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCTGCCTGTGCCTTGCA
rJMFF017H21- GCCCTCGACAAACTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCTGCCTGTGCCTTGCA
rJMFF031H06- GCCCTCGACAAACTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCTGCCTGTGCCTTGCA
rJMSF047A20- GCCCTCGACAAACTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCTGCCTGTGCCTTGCA
rJMSF048N04- GCCCTCGACAAACTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCTGCCTGTGCCTTGCA
rJMSF032F22- GCCCTCGACAAACTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCTGCCTGTGCCTTGCA
rJMFF036L24- GCCCTCGACAAACTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCTGCCTGTGCCTTGCA
rJMFF015M03- GCCCTCGACAAACTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCTGCCTGTGCCTTGCA
rJMFF028O10- GCCCTCGACAAACTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCTGCCTGTGCCTTGCA
rJMSF041E24- GCCCTCGACAAACTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCTGCCTGTGCCTTGCA
rJMFF007D04- GCCCTCGACAAACTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCTGCCTGTGCCTTGCA
rJMFF031A17- GCCCTCGACAAACTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCTGCCTGTGCCTTGCA
rJMFF039A18- GCCCTCGACAAACTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCTGCCTGTGCCTTGCA
rJMFF034L03- GCCCTCGACAAACTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCTGCCTGTGCCTTGCA
rJMFF023H09- GCCCTCGACAAACTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCTGCCTGTGCCTTGCA
rJMSF028E11- GCCCTCGACAAACTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCTGCCTGTGCCTTGCA
rJMFF023E22- GCCCTCGACAAACTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCTGCCTGTGCCTTGCA
rJMFF023B03- GCCCTCGACAAACTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCTGCCTGTGCCTTGCA
rJMSF051A06- GCCCTCGACAAACTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCTGCCTGTGCCTTGCA
rJMSF028H08- GCCCTCGACAAACTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCTGCCTGTGCCTTGCA
rJMSF019O16- GCCCTCGACAAACTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCTGCCTGTGCCTTGCA
rJMSF003N19- GCCCTCGACAAACTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCTGC--GTGCCTTGCA
rJMFF035L13- GCCCTCGACAAACTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCTGCCTGTGCCTTGCA
rJMFF016P24- GCCCTCGACAAACTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCTGCCTGTGCCTTGCA
rJMSF022K11- GCCCTCGACAAACTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCTGCCTGTGCCTTGCA
rJMSF047L03- GCCCTCGACAAACTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCTGCCTGTGCCTTGCA
rJMSF003I06- GCCCTCGACAAACTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCTGCCTGTGCCTTGCA
rJMSF032L15- GCCCTCGACAAACTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCTGCCTGTGCCTTGCA
rJMSF007K13- GCCCTCGACAAACTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCTGCCTGTGCCTTGCA
rJMSF014P13- GCCCTCGACAAACTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCTGCCTGTGCCTTGCA
rJMSF043A20- GCCCTCGACAAACTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCTGCCTGTGCCTTGCA
rJMSF032G11- GCCCTCGACAAACTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCTGCCTGTGCCTTGCA
rJMSF010C07- GCCCTCGACAAACTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCTGCCTGTGCCTTGCA
rJMSF011I23- GCCCTCGACAAACTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCTGCCTGTGCCTTGCA
rJMSF036C18- GCCCTCGACAAACTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCTGCCTGTGCCTTGCA
rJMSF018F23- GCCCTCGACAAACTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCTGCCTGTGCCTTGCA
rJMFF031L05- GCCCTCGACAAACTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCTGCCTGTGCCTTGCA
rJMSF007E23- GCCCTCGACAAACTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCTGCCTGTGCCTTGCA
rJMSF026I08- GCCCTCGACAAACTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCTGCCTGTGCCTTGCA
rJMFF013I18- GCCCTCGACAAACTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCTGCCTGTGCCTTGCG
rJMFF031F09- GCCCTCGACAAACTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCTGCCTGTGCCTTGCA
rJMSF014M14- GCCCTCGACAAACTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCTGCCTGTGCCTTGCA
rJMSF038M05- GCCCTCGACAAACTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCTGCCTGTGCCTTGCA
rJMSF040H10- GCCCTCGACAAACTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCTGCCTGTGCCTTGCA
JMSF041P15+ GCCTGTGCCTTGCA
                      ____________________________________________________________
consensus GCCCTCGACAAACTTCCTCGCTCCCTTGAACCATCTCTTGTCGCCTGCCTGTGCCTTGCA
 
. : . : . : . : . : . :
rJMFF045F17- GATGTAAAGCTTTCCATTGGAAACGCTGGCAGTGATCAGCTGGTGCTTCCCACCTTCATC
rJMSF020P09- GATGTAAAGCTTTCCATTGGAAACGCTGGCAGTGATCAGCTGGTGCTTCCCACCTTCATC
rJMFF035J02- GATGTAAAGCTTTCCATTGGAAACGCTGGCAGTGATCAGCTGGTGCTTCCCACCTTCATC
rJMFF011H19- GATGTAAAGCTTTCCATTGGAAACGCTGGCAGTGATCAGCTGGTGCTTCCCACCTTCATC
rJMSF032D02- GATGTAAAGCTTTCCATTGGAAACGCTGGCAGTGATCAGCTGGTGCTTCCCACCTTCATC
rJMFF041E22- GATGTAAAGCTTTCCATTGGAAACGCTGGCAGTGATCAGCTGGTGCTTCCCACCTTCATC
rJMFF045D24- GATGTAAAGCTTTCCATTGGAAACGCTGGCAGTGATCAGCTGGTGCTTCCCACCTTCATC
rJMSF041P15- GATGTAAAGCTTTCCATTGGAAACGCTGGCAGTGATCAGCTGGTGCTTCCCACCTTCATC
rJMFF045N08- GATGTAAAGCTTTCCATTGGAAACGCTGGCAGTGATCAGCTGGTGCTTCCCACCTTCATC
rJMSF028N11- NATGNAAAGCTTTCCATTGGAAACGCTGGCAGTGATCAGCTGGNGCTTCCCACCTTCNTC
rJMSF052B20- GATGTAAAGCTTTNCNTTGNANACGCTGGCAGTGATCNNCTGGTGCTTCCCACCTTCNTC
JMFS110G12+ GATGTAAAGCTTTCCATTGGAAACGCTGGCAGTGATCAGCTGGTGCTTCCCACCTTCATC
rJMFF001F05- GATGTAAAGCTTTCCATTGGAAACGCTGGCAGTGATCAGCTGGTGCTTCCCACCTTCATC
rJMFF017E01- GATGTAAAGCTTTCCATTGGAAACGCTGGCAGTGATCAGCTGGTGCTTCCCACCTTCATC
rJMFF029C15- GATGTAAAGCTTTCCATTGGAAACGCTGGCAGTGATCAGCTGGTGCTTCCCACCTTCATC
rJMFF014I03- GATGTAAAGCTTTCCATTGGAAACGCTGGCAGTGATCAGCTGGTGCTTCCCACCTTCATC
rJMFF017H21- GATGTAAAGCTTTCCATTGGAAACGCTGGCAGTGATCAGCTGGTGCTTCCCACCTTCATC
rJMFF031H06- GATGTAAAGCTTTCCATTGGAAACGCTGGCAGTGATCAGCTGGTGCTTCCCACCTTCATC
rJMSF047A20- GATGTAAAGCTTTCCATTGGAAACGCTGGCAGTGATCAGCTGGTGCTTCCCACCTTCATC
rJMSF048N04- GATGTAAAGCTTTCCATTGGAAACGCTGGCAGTGATCAGCTGGTGCTTCCCACCTTCATC
rJMSF032F22- GATGTAAAGCTTTCCATTGGAAACGCTGGCAGTGATCAGCTGGTGCTTCCCACCTTCATC
rJMFF036L24- GATGTAAAGCTTTCCATTGGAAACGCTGGCAGTGATCAGCTGGTGCTTCCCACCTTCATC
rJMFF015M03- GATGTAAAGCTTTCCATTGGAAACGCTGGCAGTGATCAGCTGGTGCTTCCCACCTTCATC
rJMFF028O10- GATGTAAAGCTTTCCATTGGAAACGCTGGCAGTGATCAGCTGGTGCTTCCCACCTTCATC
rJMSF041E24- GATGTAAAGCTTTCCATTGGAAACGCTGGCAGTGATCAGCTGGTGCTTCCCACCTTCATC
rJMFF007D04- GATGTAAAGCTTTCCATTGGAAACGCTGGCAGTGATCAGCTGGTGCTTCCCACCTTCATC
rJMFF031A17- GATGTAAAGCTTTCCATTGGAAACGCTGGCAGTGATCAGCTGGTGCTTCCCACCTTCATC
rJMFF039A18- GATGTAAAGCTTTCCATTGGAAACGCTGGCAGTGATCAGCTGGTGCTTCCCACCTTCATC
rJMFF034L03- GATGTAAAGCTTTCCATTGGAAACGCTGGCAGTGATCAGCTGGTGCTTCCCACCTTCATC
rJMFF023H09- GATGTAAAGCTTTCCATTGGAAACGCTGGCAGTGATCAGCTGGTGCTTCCCACCTTCATC
rJMSF028E11- GATGTAAAGCTTTCCATTGGAAACGCTGGCAGTGATCAGCTGGTGCTTCCCACCTTCATC
rJMFF023E22- GATGTAAAGCTTTCCATTGGAAACGCTGGCAGTGATCAGCTGGTGCTTCCCACCTTCATC
rJMFF023B03- GATGTAAAGCTTTCCATTGGAAACGCTGGCAGTGATCAGCTGGTGCTTCCCACCTTCATC
rJMSF051A06- GATGTAAAGCTTTCCATTGGAAACGCTGGCAGTGATCAGCTGGTGCTTCCCACCTTCATC
rJMSF028H08- GATGTAAAGCTTTCCATTGGAAACGCTGGCAGTGATCAGCTGGTGCTTCCCACCTTCATC
rJMSF019O16- GATGTAAAGCTTTCCATTGGAAACGCTGGCAGTGATCAGCTGGTGCTTCCCACCTTCATC
rJMSF003N19- GATGTAAAGCTTTCCATTGGAAACGCTGGCAGTGATCAGCTGGTGCTTCCCACCTTCATC
rJMFF035L13- GATGTAAAGCTTTCCATTGGAAACGCTGGCAGTGATCAGCTGGTGCTTCCCACCTTCATC
rJMFF016P24- GATGTAAAGCTTTCCATTGGAAACGCTGGCAGTGATCAGCTGGTGCTTCCCACCTTCATC
rJMSF022K11- GATGTAAAGCTTTCCATTGGAAACGCTGGCAGTGATCAGCTGGTGCTTCCCACCTTCATC
rJMSF047L03- GATGTAAAGCTTTCCATTGGAAACGCTGGCAGTGATCAGCTGGTGCTTCCCACCTTCATC
rJMSF003I06- GATGTAAAGCTTTCCATTGGAAACGCTGGCAGTGATCAGCTGGTGCTTCCCACCTTCATC
rJMSF032L15- GATGTAAAGC-TTCCATTGGAAACGCTGGCAGTGATCAGCTGGTGCTTCCCACCTTCATC
rJMSF007K13- GATGTAAAGCTTTCCATTGGAAACGCTGGCAGTGATCAGCTGGTGCTTCCCACCTTCATC
rJMSF014P13- GATGTAAAGCTTTCCATTGGAAACGCTGGCAGTGATCAGCTGGTGCTTCCCACCTTCATC
rJMSF043A20- GATGTAAAGCTTTCCATTGGAAACGCTGGCAGTGATCAGCTGGTGCTTCCCACCTTCATC
rJMSF032G11- GATGTAAAGCTTTCCATTGGAAACGCTGGCAGTGATCAGCTGGTGCTTCCCACCTTCATC
rJMSF010C07- GATGTAAAGCTTTCAATTGGAAACGCTGGCAGTGATCAGCTGGTGCTTCCCACCTTCATC
rJMSF011I23- GATGTAAAGCTTTCCATTGGAAACGCTGGCAGTGATCAGCTGGTGCTTCCCACCTTCATC
rJMSF036C18- GATGTAAAGCTTTCCATTGGAAACGCTGGCAGTGATCAGCTGGTGCTTCCCACCTTCATC
rJMSF018F23- GATGTAAAGCTTTCCATTGGAAACGCTGGCAGTGATCAGCTGGTGCTTCCCACCTTCATC
rJMFF031L05- GATGTAAAGCTTTCCATTGGAAACGCTGGCAGTGATCAGCTGGTGCTTCCCACCTTCATC
rJMSF007E23- GATGTAAAGCTTTCCATTGGAAACGCTGGCAGTGATCAGCTGGTGCTTCCCACCTTCATC
rJMSF026I08- GATGTAAAGCTTTCCATTGGAAACGCTGGCAGTGATCAGCTGGTGCTTCCCACCTTCATC
rJMFF013I18- GATGTAAAGCTTTCCATTGGAAACGCTGGCAGTGATCAGCTGGTGCTTCCCACCTTCATC
rJMFF031F09- GATGTAAAGCTTTCCATTGGAAACGCTGGCAGTGATCAGCTGGTGCTTCCCACCTTCATC
rJMSF014M14- GATGTAAAGCTTTCCATTGGAAACGCTGGCAGTGATCAGCTGGTGCTTCCCACCTTCATC
rJMSF038M05- GATGTAAAGCTTTCCATTGGAAACGCTGGCAGTGATCAGCTGGTGCTTCCCACCTTCATC
rJMSF040H10- GATGTAAAGCTTTCCATTGGAAACGCTGGCAGTGATCAGCTGGTGCTTCCCACCTTCATC
JMSF047A20+ TTCATC
JMSF041P15+ GATGTAAAGCTTTCCATTGGAAACGCTGGCAGTGATCAGCTGGTGCTTCCCACCTTCATC
                      ____________________________________________________________
consensus GATGTAAAGCTTTCCATTGGAAACGCTGGCAGTGATCAGCTGGTGCTTCCCACCTTCATC
 
. : . : . : . : . : . :
rJMFF045F17- GCCATCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
rJMSF020P09- GCCATCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
rJMFF035J02- GCCATCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
rJMFF011H19- GCCATCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
rJMSF032D02- GCCATCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
rJMFF041E22- GCCATCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
rJMFF045D24- GCCATCCGCTGTCCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
rJMSF041P15- GCCATCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
rJMFF045N08- GCCATCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
rJMSF028N11- GCCATCCGCTGTTCTTGTCAACACANAAATGAAGTAGTACTGCTTTCNTCCGACCACTGG
rJMSF052B20- NCCATCCGCTG
JMFS110G12+ GCCATCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
rJMFF001F05- GCCATCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
rJMFF017E01- GCCATCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
rJMFF029C15- GCCATCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
rJMFF014I03- GCCATCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
rJMFF017H21- GCCATCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
rJMFF031H06- GCCATCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
rJMSF047A20- GCCATCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
rJMSF048N04- GCCATCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
rJMSF032F22- GCCATCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
rJMFF036L24- GCCATCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
rJMFF015M03- GCCATCCGCTGTTCTTGTCAACACAAAAATGAAGTAGNACTGCTTTCCTCCGACCACTGG
rJMFF028O10- GCCATCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
rJMSF041E24- GCCATCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
rJMFF007D04- GCCATCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
rJMFF031A17- GCCATCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
rJMFF039A18- GCCATCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
rJMFF034L03- GCCATCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
rJMFF023H09- GCCATCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
rJMSF028E11- GCCATCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
rJMFF023E22- GCCATCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
rJMFF023B03- GCCATCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
rJMSF051A06- GCCATCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
rJMSF028H08- GCCATCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
rJMSF019O16- GCCATCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
rJMSF003N19- GCCATCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
rJMFF035L13- GCCATCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
rJMFF016P24- GCCATCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
rJMSF022K11- GCCATCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
rJMSF047L03- GCCATCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
rJMSF003I06- GCCATCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
rJMSF032L15- GCCATCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
rJMSF007K13- GCCATCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
rJMSF014P13- GCCATCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
rJMSF043A20- GCCATCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
rJMSF032G11- GCCATCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
rJMSF010C07- GCCATCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
rJMSF011I23- GCCATCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
rJMSF036C18- GCCATCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
rJMSF018F23- GCCATCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
rJMFF031L05- GCCATCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
rJMSF007E23- GCCATCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
rJMSF026I08- GCCATCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
rJMFF013I18- GCCATCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
rJMFF031F09- GCCATCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
rJMSF014M14- GCCATCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
rJMSF038M05- GCCATCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
rJMSF040H10- GCCATCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
JMSF047A20+ GCCATCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
JMSF041P15+ GCCATCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
JMSF032D02+ TTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
JMSF020P09+ CCGACCACTGG
JMSF036C18+ TCCGACCACNGG
JMSF028E11+ TCCGACCACTGG
JMSF022K11+ TTGTCAACACAGAAATGAAGTAGTACTGCTTTCNTCCGACCACTGG
JMFN004I11+ TGAAGTAGTACTGCTTTCCTCCGACCACTGG
JMSF041E24+ GCCATCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
JMSF043A20+ TCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
                      ____________________________________________________________
consensus GCCATCCGCTGTTCTTGTCAACACAGAAATGAAGTAGTACTGCTTTCCTCCGACCACTGG
 
. : . : . : . : . : . :
rJMFF045F17- AGTTGATGTCTCCAATATGTTTGC
rJMSF020P09- AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
rJMFF035J02- AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
rJMFF011H19- AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
rJMSF032D02- AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
rJMFF041E22- AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
rJMFF045D24- AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
rJMSF041P15- AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
rJMFF045N08- AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
rJMSF028N11- AGTTGATGTCTCCAATATGTTTGCGGTGGCCACA
JMFS110G12+ AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
rJMFF001F05- AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
rJMFF017E01- AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
rJMFF029C15- AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
rJMFF014I03- AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
rJMFF017H21- AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
rJMFF031H06- AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
rJMSF047A20- AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
rJMSF048N04- AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
rJMSF032F22- AGTTGATGTCTCCAATATGTTTGAGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
rJMFF036L24- AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
rJMFF015M03- AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
rJMFF028O10- AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
rJMSF041E24- AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
rJMFF007D04- AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
rJMFF031A17- AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
rJMFF039A18- AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
rJMFF034L03- AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
rJMFF023H09- AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
rJMSF028E11- AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
rJMFF023E22- AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
rJMFF023B03- AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
rJMSF051A06- AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
rJMSF028H08- AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
rJMSF019O16- AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
rJMSF003N19- AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
rJMFF035L13- AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
rJMFF016P24- AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
rJMSF022K11- AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
rJMSF047L03- AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
rJMSF003I06- AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
rJMSF032L15- AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
rJMSF007K13- AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
rJMSF014P13- AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
rJMSF043A20- AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
rJMSF032G11- AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
rJMSF010C07- AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
rJMSF011I23- AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
rJMSF036C18- AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
rJMSF018F23- AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
rJMFF031L05- AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
rJMSF007E23- AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
rJMSF026I08- AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
rJMFF013I18- AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
rJMFF031F09- AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
rJMSF014M14- AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
rJMSF038M05- AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
rJMSF040H10- AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
JMSF047A20+ AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
JMSF041P15+ AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
JMSF032D02+ AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
JMSF020P09+ AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
JMSF036C18+ AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
JMFN032O04+ CCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
JMFN032C21+ CCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
JMFF045F17+ GGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
JMSF028E11+ AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
JMSF022K11+ AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
JMSF049G18+ CTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
JMFN004I11+ AGTTGATGTCTCCAATATGTNTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
JMSF041E24+ AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
JMFN037E08+ TATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
JMFF045N08+ CCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
JMSF026I08+ TGA
JMSF043A20+ AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
JMFF041E22+ AGCATTAGGATCAAATCCTCCCTCTGA
JMSF032L15+ CTGA
JMSF040H10+ CTGA
JMFN001E08+ GA
JMFF031A17+ ACAGCATTAGGATCAAATCCTCCCTCTGA
JMFF035L13+ CACAGCATTAGGATCAAATCCTCCCTCTGA
JMSF051A06+ TCTGA
JMSF028H08+ CTGA
JMSF032G11+ TCTGA
JMSF028L12+ CCACAGCATTAGGATCAAATCCTCCCTCTGA
                      ____________________________________________________________
consensus AGTTGATGTCTCCAATATGTTTGCGGTGGCCACAGCATTAGGATCAAATCCTCCCTCTGA
 
. : . : . : . : . : . :
rJMSF020P09- ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
rJMFF035J02- ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
rJMFF011H19- ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
rJMSF032D02- ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
rJMFF041E22- ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
rJMFF045D24- ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
rJMSF041P15- ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
rJMFF045N08- ATCGGTTTTGCCAGAGTAGACTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
JMFS110G12+ ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
rJMFF001F05- ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
rJMFF017E01- ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
rJMFF029C15- ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
rJMFF014I03- ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
rJMFF017H21- ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
rJMFF031H06- ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
rJMSF047A20- ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
rJMSF048N04- ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
rJMSF032F22- ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
rJMFF036L24- ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
rJMFF015M03- ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
rJMFF028O10- ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
rJMSF041E24- ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
rJMFF007D04- ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
rJMFF031A17- ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
rJMFF039A18- ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
rJMFF034L03- ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
rJMFF023H09- ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAA-AGTCCACTTGAGCAAGGAATTC
rJMSF028E11- ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
rJMFF023E22- ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
rJMFF023B03- ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
rJMSF051A06- ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
rJMSF028H08- ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
rJMSF019O16- ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
rJMSF003N19- ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
rJMFF035L13- ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
rJMFF016P24- ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
rJMSF022K11- ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
rJMSF047L03- ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
rJMSF003I06- ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
rJMSF032L15- ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
rJMSF007K13- ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
rJMSF014P13- ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
rJMSF043A20- ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
rJMSF032G11- ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
rJMSF010C07- ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
rJMSF011I23- ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
rJMSF036C18- ATCGGTTTTGCCAGAGTAGGCTTGTTTTCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
rJMSF018F23- ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
rJMFF031L05- ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
rJMSF007E23- ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
rJMSF026I08- ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
rJMFF013I18- ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
rJMFF031F09- ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
rJMSF014M14- ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
rJMSF038M05- ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
rJMSF040H10- ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
JMSF047A20+ ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
JMSF041P15+ ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
JMSF032D02+ ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
JMSF020P09+ ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
JMSF036C18+ ATCGGTTTTGCCAGAGTAGGCTTGTTTTCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
JMFN032O04+ ATCGGTTTTGCCAGAGTAGGCT-GTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
JMFN032C21+ ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
JMFF045F17+ ATCGGTTTTGCCAGAGTAGGCTGTTTTCNCAAGCAAATAGTCCACTTGAGCAAGGAATTC
JMSF028E11+ ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
JMSF022K11+ ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
JMSF049G18+ ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
JMFN004I11+ ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
JMSF041E24+ ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
JMFN037E08+ ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTGNAGCAAGGAATTC
JMFF045N08+ ATCGGTTTTGCCAGAGTAGACTTGTTTCCCAAGCAAATAGTCCACTGNAGCAAGGAATTC
JMSF026I08+ ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
JMSF043A20+ ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
JMFF041E22+ ATCGGTTNTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
JMSF032L15+ ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
JMSF038M05+ ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
JMFF031H06+ GGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
JMSF047L03+ TTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
JMSF040H10+ ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
JMFF016P24+ CGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
JMFF031F09+ CGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
JMFN001E08+ ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
JMFF031A17+ ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
JMFF035L13+ ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
JMSF051A06+ ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
JMSF028H08+ ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
JMSF032G11+ ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
JMSF032F22+ ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
JMFF034L03+ CCAAGCAAATAGTCCACTTGAGCAAGGAATTC
JMFF017H21+ TTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
JMFF007B06+ AGCAAGGAATTC
JMFF001F05+ TTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
JMFF007D04+ CGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
JMSF028L12+ ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
JMFF045D24+ GCCAGAGTAGGCTGTTTTCCCAAGCAAATAGTCCACTGNAGCAAGGAATTC
                      ____________________________________________________________
consensus ATCGGTTTTGCCAGAGTAGGCTTGTTTCCCAAGCAAATAGTCCACTTGAGCAAGGAATTC
 
. : . : . : . : . : . :
rJMSF020P09- CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
rJMFF035J02- CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
rJMFF011H19- CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
rJMSF032D02- CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
rJMFF041E22- CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
rJMFF045D24- CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAAA
rJMSF041P15- CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
rJMFF045N08- CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTC
JMFS110G12+ CTCAGGGGAACCGTAGTCGG
rJMFF001F05- CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
rJMFF017E01- CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
rJMFF029C15- CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
rJMFF014I03- CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
rJMFF017H21- CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
rJMFF031H06- CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
rJMSF047A20- CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
rJMSF048N04- CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
rJMSF032F22- CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
rJMFF036L24- CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
rJMFF015M03- CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
rJMFF028O10- CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
rJMSF041E24- CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
rJMFF007D04- CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
rJMFF031A17- CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
rJMFF039A18- CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
rJMFF034L03- CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
rJMFF023H09- CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
rJMSF028E11- CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
rJMFF023E22- CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
rJMFF023B03- CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
rJMSF051A06- CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
rJMSF028H08- CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
rJMSF019O16- CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
rJMSF003N19- CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGATGGGAGTGACCAA-GACGCAGA
rJMFF035L13- CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
rJMFF016P24- CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
rJMSF022K11- CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
rJMSF047L03- CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
rJMSF003I06- CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
rJMSF032L15- CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
rJMSF007K13- CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
rJMSF014P13- CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
rJMSF043A20- CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
rJMSF032G11- CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
rJMSF010C07- CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
rJMSF011I23- CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
rJMSF036C18- CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
rJMSF018F23- CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
rJMFF031L05- CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
rJMSF007E23- CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
rJMSF026I08- CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
rJMFF013I18- CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
rJMFF031F09- CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
rJMSF014M14- CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
rJMSF038M05- CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
rJMSF040H10- CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
JMSF047A20+ CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
JMSF041P15+ CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
JMSF032D02+ CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
JMSF020P09+ CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
JMSF036C18+ CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
JMFN032O04+ CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
JMFN032C21+ CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
JMFF045F17+ CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
JMSF028E11+ CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
JMSF022K11+ CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
JMSF049G18+ CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCG--GGGAGTGACCAA-GACGCAGA
JMFN004I11+ CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
JMSF041E24+ CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
JMFN037E08+ CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGCGACCAA-GACGCAGA
JMFF045N08+ CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
JMSF026I08+ CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
JMSF043A20+ CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
JMFF041E22+ CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
JMSF032L15+ CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
JMSF038M05+ CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
JMFF031H06+ CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
JMSF047L03+ CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
JMSF040H10+ CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
JMFF016P24+ CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
JMFF031F09+ CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
JMFN001E08+ CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
JMFF031A17+ CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
JMFF035L13+ CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
JMSF051A06+ CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
JMSF028H08+ CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
JMSF032G11+ CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
JMSF032F22+ CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
JMFF034L03+ NTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
JMFF017H21+ CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
JMFF007B06+ CTCAGGGGAACCGTAGTCGGTGATGGACTTNTTGTCGGTGGGAGTGACCAA-GACGCAGA
JMFF001F05+ CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
JMFF007D04+ CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
JMFF039A18+ TAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
JMFF035J02+ GAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
JMFF028O10+ GTGGGAGTGACCAA-GACGCAGA
JMFF023H09+ TCGGTGGGAGTGACCAANGACGCAGA
JMFF014I03+ TCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
JMFF017E01+ GAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
JMSF028L12+ CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
JMFF045D24+ CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
JMFF031L05+ CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
                      ____________________________________________________________
consensus CTCAGGGGAACCGTAGTCGGTGATGGACTTCTTGTCGGTGGGAGTGACCAA-GACGCAGA
 
. : . : . : . : . : . :
rJMSF020P09- TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
rJMFF035J02- TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
rJMFF011H19- TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACCGGGGAAACTCAAC
rJMSF032D02- TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
rJMFF041E22- TGTTGCTGGTTTGGTC--AAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACT
rJMFF045D24- TGTTGCTGGTTTGGTC-AAAGTTGCCTTCGTATCTGAGAACCTGACC-GGGAAACTNCAC
rJMSF041P15- TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACC
rJMFF001F05- TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
rJMFF017E01- TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
rJMFF029C15- TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
rJMFF014I03- TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
rJMFF017H21- TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
rJMFF031H06- TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
rJMSF047A20- TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
rJMSF048N04- TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
rJMSF032F22- TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
rJMFF036L24- TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
rJMFF015M03- TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
rJMFF028O10- TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
rJMSF041E24- TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
rJMFF007D04- TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
rJMFF031A17- TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
rJMFF039A18- TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
rJMFF034L03- TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
rJMFF023H09- TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACATGACC-GGGAAACTCAAC
rJMSF028E11- TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
rJMFF023E22- TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
rJMFF023B03- TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
rJMSF051A06- TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
rJMSF028H08- TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
rJMSF019O16- TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
rJMSF003N19- TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
rJMFF035L13- TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
rJMFF016P24- TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
rJMSF022K11- TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
rJMSF047L03- TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
rJMSF003I06- TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
rJMSF032L15- TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
rJMSF007K13- TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
rJMSF014P13- TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACG-GGGAAACTCAAC
rJMSF043A20- TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
rJMSF032G11- TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
rJMSF010C07- TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
rJMSF011I23- TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
rJMSF036C18- TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
rJMSF018F23- TGTTGCTGGTTTGGTCAAAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
rJMFF031L05- TGTTGCTGGTTTGGTC-AAAGTTGCCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
rJMSF007E23- TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
rJMSF026I08- TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
rJMFF013I18- TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
rJMFF031F09- TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
rJMSF014M14- TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
rJMSF038M05- TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
rJMSF040H10- TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
JMSF047A20+ TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
JMSF041P15+ TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
JMSF032D02+ TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
JMSF020P09+ TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
JMSF036C18+ TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
JMFN032O04+ TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
JMFN032C21+ TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
JMFF045F17+ TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
JMSF028E11+ TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
JMSF022K11+ TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
JMSF049G18+ TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
JMFN004I11+ TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
JMSF018F23+ ACCTGACC-GGGAAACTCAAC
JMSF007K13+ ACTCAAC
JMSF041E24+ TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
JMFN037E08+ TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
JMFF045N08+ TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
JMSF026I08+ TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
JMSF043A20+ TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
JMFF041E22+ TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
JMSF032L15+ TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
JMSF038M05+ TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
JMFF031H06+ TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
JMSF047L03+ TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
JMSF040H10+ TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
JMFF016P24+ TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
JMFF031F09+ TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
JMFN001E08+ TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
JMFF031A17+ TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
JMFF035L13+ TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
JMSF051A06+ TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
JMSF028H08+ TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
JMSF032G11+ TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
JMSF032F22+ TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
JMFF034L03+ TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
JMFF017H21+ TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
JMFF007B06+ TGTTGNTGGTTTGGTC-AAAGTTGTCTTNGTATCTGAGAACCTGACC-GGGAAACTCAAC
JMFF001F05+ TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
JMFF007D04+ TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
JMFF039A18+ TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
JMFF035J02+ TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
JMFF028O10+ TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
JMFF023H09+ TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACATGACC-GGGAAACTCAAC
JMFF014I03+ TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
JMFF017E01+ TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
JMSF028L12+ TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
JMFF045D24+ TGTTGCTGGTTTGGTC-AAAGTTGCCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
JMFF029C15+ GGGAAACTCAAC
JMFF023B03+ CC-GGGAAACTCAAC
JMSF019O16+ TCTGAGAACCTGACC-GGGAAACTCAAC
JMSF014P13+ GGAAACTCAAC
JMFF011H19+ ATCTGAGAACCTGACC-GGGAAACTCAAC
JMFF031L05+ TGTTGCTGGTTTGGTC-AAAGTTGCCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
                      ____________________________________________________________
consensus TGTTGCTGGTTTGGTC-AAAGTTGTCTTCGTATCTGAGAACCTGACC-GGGAAACTCAAC
 
. : . : . : . : . : . :
rJMSF020P09- TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCT
rJMFF035J02- TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGA
rJMFF011H19- TTCCTTGCTAGGGTTCCACTTTGA-NGGAACCTGCA
rJMSF032D02- TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
rJMFF045D24- TTCCTTGCTA
rJMFF001F05- TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
rJMFF017E01- TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
rJMFF029C15- TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
rJMFF014I03- TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
rJMFF017H21- TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
rJMFF031H06- TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
rJMSF047A20- TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
rJMSF048N04- TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
rJMSF032F22- TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
rJMFF036L24- TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
rJMFF015M03- TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
rJMFF028O10- TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
rJMSF041E24- TTCCTTGCTAGGGTTCCACTTTGAGGGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
rJMFF007D04- TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
rJMFF031A17- TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
rJMFF039A18- TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
rJMFF034L03- TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
rJMFF023H09- TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
rJMSF028E11- TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
rJMFF023E22- TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
rJMFF023B03- TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
rJMSF051A06- TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
rJMSF028H08- TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
rJMSF019O16- TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
rJMSF003N19- TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
rJMFF035L13- TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
rJMFF016P24- TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
rJMSF022K11- TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
rJMSF047L03- TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
rJMSF003I06- TTCCCTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
rJMSF032L15- TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
rJMSF007K13- TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
rJMSF014P13- TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
rJMSF043A20- TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
rJMSF032G11- TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
rJMSF010C07- TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
rJMSF011I23- TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
rJMSF036C18- TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
rJMSF018F23- TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
rJMFF031L05- TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
rJMSF007E23- TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
rJMSF026I08- TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
rJMFF013I18- TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
rJMFF031F09- TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
rJMSF014M14- TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
rJMSF038M05- TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
rJMSF040H10- TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
JMSF047A20+ TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
JMSF041P15+ TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
JMSF032D02+ TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
JMSF020P09+ TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
JMSF036C18+ TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
JMFN032O04+ TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
JMFN032C21+ TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
JMFF045F17+ TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
JMSF028E11+ TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
JMSF022K11+ TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
JMSF049G18+ TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
JMFN004I11+ TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
JMSF018F23+ TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
JMSF007K13+ TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
JMSF041E24+ TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
JMFN037E08+ TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
JMFF045N08+ TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
JMSF026I08+ TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
JMSF043A20+ TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
JMFF041E22+ TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
JMSF032L15+ TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
JMSF038M05+ TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
JMFF031H06+ TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
JMSF047L03+ TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
JMSF040H10+ TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
JMFF016P24+ TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
JMFF031F09+ TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
JMFN001E08+ TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
JMFF031A17+ TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
JMFF035L13+ TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
JMSF051A06+ TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
JMSF028H08+ TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
JMSF032G11+ TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
JMSF032F22+ TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
JMFF034L03+ TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
JMFF017H21+ TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
JMFF007B06+ TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
JMFF001F05+ TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
JMFF007D04+ TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
JMFF039A18+ TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
JMFF035J02+ TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
JMFF028O10+ TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
JMFF023H09+ TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
JMFF014I03+ TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
JMFF017E01+ TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
JMSF028L12+ TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
JMFF045D24+ TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
JMFF029C15+ TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
JMFF023B03+ TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
JMSF019O16+ TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
JMSF014P13+ TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
JMFF023E22+ CAGCTTGAATCCGTCTCCCGGTGATT
JMFF011H19+ TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
JMFF031L05+ TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
                      ____________________________________________________________
consensus TTCCTTGCTAGGGTTCCACTTTGA-GGGAACCTGCAGCTTGAATCCGTCT-CCGGTGATT
 
. : . : . : . : . : . :
rJMSF032D02- G
rJMFF001F05- GGCANGAANTTCTGTG-TTTGTTTTCG
rJMFF017E01- GGCAGGAA-T
rJMFF029C15- GGCAGGA
rJMFF014I03- GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG
rJMFF017H21- GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAN
rJMFF031H06- GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGT
rJMSF047A20- GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
rJMSF048N04- GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGC
rJMSF032F22- GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACC
rJMFF036L24- GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAN
rJMFF015M03- GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCG
rJMFF028O10- GGCAGGAA-TTCTGTG
rJMSF041E24- GGCAGGAA-TTCTGTG
rJMFF007D04- GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAN
rJMFF031A17- GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAN
rJMFF039A18- GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCG
rJMFF034L03- GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCA
rJMFF023H09- GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTC
rJMSF028E11- GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
rJMFF023E22- GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCG
rJMFF023B03- GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAN
rJMSF051A06- GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAN
rJMSF028H08- GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
rJMSF019O16- GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
rJMSF003N19- GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
rJMFF035L13- GGCATGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAN
rJMFF016P24- GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCGAAAAACATTCGCGGCTTCACCGTAG
rJMSF022K11- GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
rJMSF047L03- GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
rJMSF003I06- GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
rJMSF032L15- GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
rJMSF007K13- GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
rJMSF014P13- GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
rJMSF043A20- GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
rJMSF032G11- GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
rJMSF010C07- GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
rJMSF011I23- GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
rJMSF036C18- GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
rJMSF018F23- GGCAGGAA-TTCTGTGTTTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAA
rJMFF031L05- GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
rJMSF007E23- GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
rJMSF026I08- GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
rJMFF013I18- GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
rJMFF031F09- GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
rJMSF014M14- GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
rJMSF038M05- GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
rJMSF040H10- GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
JMSF047A20+ GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
JMSF041P15+ GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
JMSF032D02+ GGCAGGAA-TTCTATG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
JMSF020P09+ GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
JMSF036C18+ GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
JMFN032O04+ GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
JMFN032C21+ GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
JMFF045F17+ GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
JMSF028E11+ GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
JMSF022K11+ GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
JMSF049G18+ GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
JMFN004I11+ GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
JMSF018F23+ GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
JMSF007K13+ GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
JMSF003I06+ CATTCGCGGCTTCACCGTAG
JMSF041E24+ GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
JMFN037E08+ GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
JMFF045N08+ GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
JMSF026I08+ GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
JMSF043A20+ GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
JMFF041E22+ GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
JMSF032L15+ GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
JMSF038M05+ GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
JMFF031H06+ GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
JMSF047L03+ GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
JMSF040H10+ GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
JMFF016P24+ GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
JMFF031F09+ GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
JMFN001E08+ GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
JMFF031A17+ GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
JMFF035L13+ GGCATGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
JMSF051A06+ GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
JMSF028H08+ GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
JMSF032G11+ GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
JMSF032F22+ GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
JMFF034L03+ GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
JMFF017H21+ GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
JMFF007B06+ GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
JMSF007E23+ GAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
JMFF001F05+ GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
JMFF007D04+ GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
JMFF039A18+ GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
JMFF035J02+ GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
JMFF028O10+ GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
JMFF023H09+ GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
JMFF014I03+ GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
JMFF017E01+ GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
JMSF028L12+ GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
JMFF045D24+ GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
JMFF029C15+ GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
JMFF023B03+ GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
JMSF019O16+ GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
JMSF014P13+ GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
JMFF023E22+ GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
JMSF003N19+ GTAG
JMFF011H19+ GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
JMFF031L05+ GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
                      ____________________________________________________________
consensus GGCAGGAA-TTCTGTG-TTTGTTTTCGGCTTTCCG-AAAACATTCGCGGCTTCACCGTAG
 
. : . : . : . : . : . :
rJMFF017H21- GCGGCGTCG
rJMSF047A20- GCGGCGTCG
rJMFF036L24- GCGGCGTC
rJMFF007D04- GCGGCGTCGG
rJMFF031A17- GCGGCGTCGGCAGGG
rJMSF028E11- GCGGCGTCG
rJMFF023B03- GCGGCGTCGGCAGGGG
rJMSF051A06- GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGA
rJMSF028H08- GCGGCGTCGGCAGG
rJMSF019O16- GCGGCGTCGGCAGGGGAAACCTTANAGCCAACAGCGGCAGCGCC
rJMSF003N19- GCGGCGTCGGCAGGGGAAACCTTANAGCCAACAGCGGCAGCGCC
rJMFF035L13- GCGGCGTCGGCAGGGGAAACCTTANAGCCAACAGCGGCAGCGCC
rJMFF016P24- GCGGCGTCGGCAGGGGAAACCTTANAGCCAACAGCGGCAGCGCCGAT
rJMSF022K11- GCGGCGTCGACAG
rJMSF047L03- GCGGCGTCG
rJMSF003I06- GCGGCGTCG
rJMSF032L15- GCGGCGTCG
rJMSF007K13- GCGGCGTCGACAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGA
rJMSF014P13- GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGA
rJMSF043A20- GCGGCGTCGGCAGGGGAAACCTTAAAGCCAACAGCGGCAGCGCCGA
rJMSF032G11- GCGGCGTCGGCAGGGGAAACCTTAAAGCCAACAGCGGCAGCGCCGA
rJMSF010C07- GCGGCGTCGGCAGGGGAAACCTTANAGCCAACAGCGGCAGCGCCGATG
rJMSF011I23- GCGGCGTCGG
rJMSF036C18- GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCG
rJMSF018F23- GCGGCGTCGGCAGGGGAAA
rJMFF031L05- GCGGCGT
rJMSF007E23- GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGA
rJMSF026I08- GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
rJMFF013I18- GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
rJMFF031F09- GCGGCGTCGGCAGGGGAAACCTTANAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
rJMSF014M14- GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
rJMSF038M05- GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
rJMSF040H10- GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
JMSF047A20+ GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
JMSF041P15+ GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
JMSF032D02+ GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
JMSF020P09+ GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
JMSF036C18+ GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
JMFN032O04+ GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
JMFN032C21+ GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGACAGCGCCGATGAGGACGGTGAGA
JMFF045F17+ GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
JMSF028E11+ GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
JMSF022K11+ GCGGCGTCGACAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
JMSF049G18+ GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
JMFN004I11+ GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
JMSF018F23+ GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
JMSF007K13+ GCGGCGTCGACAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
JMSF003I06+ GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
JMSF041E24+ GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
JMFN037E08+ GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
JMFF045N08+ GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
JMSF026I08+ GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
JMSF010C07+ GAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
JMSF043A20+ GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
JMFF041E22+ GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
JMSF032L15+ GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
JMSF038M05+ GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
JMFF031H06+ GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
JMSF047L03+ GCGGCGTCGGAAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
JMSF040H10+ GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
JMFF016P24+ GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
JMFF031F09+ GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
JMFN001E08+ GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
JMFF031A17+ GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
JMFF035L13+ GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
JMSF051A06+ GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
JMSF028H08+ GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
JMSF032G11+ GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
JMSF032F22+ GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
JMFF034L03+ GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
JMFF017H21+ GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
JMFF007B06+ GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
JMSF007E23+ GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
JMFF001F05+ GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
JMFF007D04+ GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
JMFF039A18+ GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
JMFF035J02+ GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
JMFF028O10+ GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
JMFF023H09+ GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
JMFF014I03+ GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
JMFF017E01+ GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
JMSF028L12+ GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
JMFF045D24+ GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
JMFF029C15+ GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
JMFF023B03+ GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
JMSF019O16+ GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
JMSF014P13+ GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
JMFF023E22+ GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
JMSF003N19+ GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
JMSF006M18+ CTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
JMSF011I23+ GAGA
JMFF011H19+ GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
JMFF031L05+ GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
                      ____________________________________________________________
consensus GCGGCGTCGGCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGA
 
. : . : . : . : . : . :
rJMSF026I08- GCCAATCGGCGAGAGACGGCGACCGAAGANGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
rJMFF013I18- GCCAATCGGCGAGAGAC
rJMFF031F09- GCCAATCGGCGAGAGA
rJMSF014M14- GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
rJMSF038M05- GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
rJMSF040H10- GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMSF047A20+ GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMSF041P15+ GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMSF032D02+ GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMSF020P09+ GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMSF036C18+ GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMFN032O04+ GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMFN032C21+ GCCAATTGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMFF045F17+ GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMSF028E11+ GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMSF022K11+ GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMSF049G18+ GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMFN004I11+ GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMSF018F23+ GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMSF007K13+ GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMSF003I06+ GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMSF041E24+ GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMFN037E08+ GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMFF045N08+ GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMSF026I08+ GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMSF010C07+ GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMSF043A20+ GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMFF041E22+ GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMSF032L15+ GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMSF038M05+ GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMFF031H06+ GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMSF047L03+ GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMSF040H10+ GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMFF016P24+ GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMFF031F09+ GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMFN001E08+ GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMFF031A17+ GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMFF035L13+ GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMSF051A06+ GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMSF028H08+ GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMSF032G11+ GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMSF032F22+ GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMFF034L03+ GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMFF017H21+ GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMFF007B06+ GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMSF007E23+ GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMFF001F05+ GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMFF007D04+ GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMFF039A18+ GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMFF035J02+ GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMFF028O10+ GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMFF023H09+ GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMFF014I03+ GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMFF017E01+ GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMSF028L12+ GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMFF045D24+ GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMFF029C15+ GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMFF023B03+ GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMSF019O16+ GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMSF014P13+ GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMFF023E22+ GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMSF003N19+ GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMSF006M18+ GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMSF011I23+ GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMSF014M14+ CGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMFF011H19+ GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
JMFF031L05+ GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
                      ____________________________________________________________
consensus GCCAATCGGCGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGAC
 
. : . : . : . : . : . :
rJMSF026I08- TG
rJMSF014M14- TGCTT
rJMSF038M05- TGCTTCTGAGC
rJMSF040H10- TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMSF047A20+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMSF041P15+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMSF032D02+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMSF020P09+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMSF036C18+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMFN032O04+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMFN032C21+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMFF045F17+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMSF028E11+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMSF022K11+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMSF049G18+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMFN004I11+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACGGGAACGTAACGGTTCGAG
JMSF018F23+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMSF007K13+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMSF003I06+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMSF041E24+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMFN037E08+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMFF045N08+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMSF026I08+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMSF010C07+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMSF043A20+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMFF041E22+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMSF032L15+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMSF038M05+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMFF031H06+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMSF047L03+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMSF040H10+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMFF016P24+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMFF031F09+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMFN001E08+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMFF031A17+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMFF035L13+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMSF051A06+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMSF028H08+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMSF032G11+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMSF032F22+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMFF034L03+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMFF017H21+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMFF007B06+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMSF007E23+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMFF001F05+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMFF007D04+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMFF039A18+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMFF035J02+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMFF028O10+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMFF023H09+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMFF014I03+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMFF017E01+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMSF028L12+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMFF045D24+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMFF029C15+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMFF023B03+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMSF019O16+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMSF014P13+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMFF023E22+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMSF003N19+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMSF006M18+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMSF011I23+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMSF014M14+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMFF011H19+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
JMFF031L05+ TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
                      ____________________________________________________________
consensus TGCTTCTGAGCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAG
 
. : . : . : . : . : . :
rJMSF040H10- GAAGATGGCCTA
JMSF047A20+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMSF041P15+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMSF032D02+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMSF020P09+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMSF036C18+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMFN032O04+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMFN032C21+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMFF045F17+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMSF028E11+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMSF022K11+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMSF049G18+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMFN004I11+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMSF018F23+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMSF007K13+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMSF003I06+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMSF041E24+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMFN037E08+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMFF045N08+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMSF026I08+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMSF010C07+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMSF043A20+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMFF041E22+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMSF032L15+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMSF038M05+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMFF031H06+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMSF047L03+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMSF040H10+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMFF016P24+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMFF031F09+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMFN001E08+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMFF031A17+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMFF035L13+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMSF051A06+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMSF028H08+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMSF032G11+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMSF032F22+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMFF034L03+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMFF017H21+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMFF007B06+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMSF007E23+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMFF001F05+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMFF007D04+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMFF039A18+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMFF035J02+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMFF028O10+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMFF023H09+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMFF014I03+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMFF017E01+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMSF028L12+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMFF045D24+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMFF029C15+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMFF023B03+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMSF019O16+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMSF014P13+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMFF023E22+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMSF003N19+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMSF006M18+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMSF011I23+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMSF014M14+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMFF011H19+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
JMFF031L05+ GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
                      ____________________________________________________________
consensus GAAGATGGCCTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAA
 
. : . : . : . : . : . :
JMSF047A20+ GCCATGATCGCGCGCGGAGGAGCTTACTGTCTT
JMSF041P15+ GCCATGATCGCGCGCGGAGGAGCTTACTGTCTTGTCT
JMSF032D02+ GCCATGATCGCGCGCGGAGGAGCTTACTGTCTTGTCT
JMSF020P09+ GCCATGATCGCGCGCGGAGGAGCTTACTGTCTTGTCTGTCT
JMSF036C18+ GCCATGATCGCGCGCGGAGGAGCTTACTGTCTTGTCTGTCTGTC
JMFN032O04+ GCCATGATCGCGCGCGGAGGAGCTTACTGTCTTGTCTGTCTGTCTGTCTCG
JMFN032C21+ GCCATGATCGCGCGCGGAGGAGCTTACTGTCTTGTCTGTCTGTCTGTC
JMFF045F17+ GCCATGATCGCGCGCGGAGGAGCTTACTGTCTTGTCTGTCTGTCTGTCTCGCCGCTTTAG
JMSF028E11+ GCCATGATCGCGCGCGGAGGAGCTTACTGTCTTGTCTGTCTGTCTGTCTCGCCGCTTTAG
JMSF022K11+ GCCATGATCGCGCGCGGAGGAGCTTAC
JMSF049G18+ GCCATGATCGCGCGCGGAGGAGCTTACTGTCTTGTCTGTCTGTCTGTCTCGCCGCTTTAG
JMFN004I11+ GCCA
JMSF018F23+ GCCATGATCGCGCGCGGAGGAGCTTACTGTCTTGTCTGTCTGTCTGTCTCGCCGCTTTAG
JMSF007K13+ GCCATGATCGCGCGCGGAGGAGCTTAC
JMSF003I06+ GCCATGATCGCGCGCGGAGGAGCTTACTGTCTTGTCTGTCTGTCTGTCTCGCCGCTTTAG
JMSF041E24+ GCCATGATCGCGCGCGGAGGAGCTTACTGTCTTGTCTGTCTGTCTGTCTCGCCGCTTTAG
JMFN037E08+ GCCATGATCGCGCGCGGAG
JMFF045N08+ GCCATGATCGCGCGCGGAGGAGCTTACTGTCTTGTCTGTCTGTCTGTCTCGCCGCTTTAG
JMSF026I08+ GCCATGATCGCGCGCGGAGGAGCTTACTGTCTTGTCTGTCTGTCTGTCTCGCCGCTTTAG
JMSF010C07+ GCCATGATCGCGCGCGGAGGAGCTTACTGTCTTGTCTGTCTGTCTGTCTCGCCGCTTTAG
JMSF043A20+ GCCATGATCGCGCGCGGAGGAGCTTACTGTCTTGTCTGTCTGTCTGTCTCGCCGCTTTAG
JMFF041E22+ GCCATGATCGCGCGCGGAGGAGCTTACTGTCTTGTCTGTCTGTCTGTCTCGCCGCTTTAG
JMSF032L15+ GCCATGATCGCGCGCGGAGGAGCTTACTGTCTTGTCTGTCTGTCTGTCTCGCCGCTTTAG
JMSF038M05+ GCCATGATCGCGCGCGGAGGAGCTTACTGTCTTGTCTGTCTGTCTGTCTCGCCGCTTTAG
JMFF031H06+ GCCATGATCGCGCGCGGAGGAGCTTACTGTCTTGTCTGTCTGTCTGTCTCGCCGCTTTAG
JMSF047L03+ GCCATGATCGCGCGCGGAGGAGCTTACTGTCTTGTCTGTCTGTCTGTCTCGCCGCTTTAG
JMSF040H10+ GCCATGATCGCGCGCGGAGGAGCTTACTGTCTTGTCTGTC
JMFF016P24+ GCCATGATCGCGCGCGGAGGAGCTTACTGTCTTGTCTGTC
JMFF031F09+ GCCATGATCGCGCGCGGAGGAGCTTACTGTCGTGTCGGTCT
JMFF031A17+ GCCATGATCGCGCGCGGAGGAGCTTACTGTCTTGTCTGTCTGTCTGTCTCGCCGCTTTAG
JMFF035L13+ GCCATGATCGCGCGCGGAGGAGCTTACTGTCTTGTCTGTCTGTCTGTCTCGCCGCTTTAG
JMSF051A06+ GCCATGATCGCGCGCGGAGGAGCTTACTGTCTTGTCTGTCTGTCTGTCTCGCCGCTTTAG
JMSF028H08+ GCCATGATCGCGCGCGGAGGAGCTTACTGTCTTGTCTGTCTGTCTGTCTCGCCGCTTTAG
JMSF032G11+ GCCATGATCGCGCGCGGAGGAGCTTACTGTCTTGTCTGTCTGTCTGTCTCGCCGCTTTAG
JMSF032F22+ GCCATGATCGCGCGCGGAGGAGCTTACTGTCTTGTCTGCCTGTCTGTCTCGCCGCTTTAG
JMFF034L03+ GCCATGATCGCGCGCGGAGGAGCTTACTGTCTTGTCTGTCTGTCTGTCTCGCCGCTTTAG
JMFF017H21+ GCCATGATCGCGCGCGGAGGAGCTTACTGTCTTGTCTGTCTGTCTGTCTCGCCGCTTTAG
JMFF007B06+ GCCATGATCGCGCGCGGAGGAGCTTACTGTCTTGTCTGTCTGTCNGTCTCGCCGCT
JMSF007E23+ GCCATGATCGCGCGCGGAGGAGCTTACTGTCTTGTCTGTCT
JMFF001F05+ GCCATGATCGCGCGCGGAGGAGCTTACTGTCTTGTCTGTCTGTCTGTCTCGCCGCTTTAG
JMFF007D04+ GCCATGATCGCGCGCGGAGGAGCTTACTGTCTTGTCTG
JMFF039A18+ GCCATGATCGCGCGCGGAGGAGCTTACTGTCTTGTCTGTCTGTCTGTCTCGCCGCTTTAG
JMFF035J02+ GCCATGATCGCGCGCGGAGGAGCTTACTGTCTTGTCTGTCTGTCTGTCTCGCCGCTTTAG
JMFF028O10+ GCCATGATCGCGCGCGGAGGAGCTTACTGTCTTGTCTGTCTGTCTGTCTCGCCGCTTTAG
JMFF023H09+ GCCATGATCGCGCGCGGAGGAGCTTACTGTCTTGTCTGTCTGTCTGTCTCGCCGCTTTAG
JMFF014I03+ GCCATGATCGCGCGCGGAGGAGCTTACTGTCTTGTCTGTCTGTCTGTCTCGCCGCTTTAG
JMFF017E01+ GCCATGATCGCGCGCGGAGGAGCTTACTGTCTTGTCTGTCTGTCTGTCTCGCCGCTTTAG
JMSF028L12+ GCCATGATCGCGCGCGGAGGAGCTTACTGTCTTGTCTGTCTGTCTGTCTCGCCGCTTTAG
JMFF045D24+ GCCATGATCGCGCGCGGAGGAGCTTACTGTCTTGTCTGTCTGTCTGTCTCGCCGCTTTAG
JMFF029C15+ GCCATGATCGCGCGCGGAGGAGCTTACTGTCTTGTCTGTCTGTCTGTCTCGCCGCTTTAG
JMFF023B03+ GCCATGATCGCGCGCGGAGGAGCTTACTGTCTTGTCTGTCTGTCTGTCTCGCCGCTTTAG
JMSF019O16+ GCCATGATCGCGCGCGGAGGAGCTTACTGTCTTGTCTGTCTGTCTGTCTCGCCGCTTTAG
JMSF014P13+ GCCATGATCGCGCGCGGAGGAGCTTACTGTCTTGTCTGTCTGTCTGTCTCGCCGCTTTAG
JMFF023E22+ GCCATGATCGCGCGCGGAGGAGCTTACTGTCTTGTCTGTCTGTCTGTCTCGCCGCTTTAG
JMSF003N19+ GCCATGATCGCGCGCGGAGGAGCTTACTGTCTTGTCTGTCTGTCTGTCTCGCCGCTTTAG
JMSF006M18+ GCCATGATCGCGCGCGGAGGAGCTTACTGTCTTGTCTGTCTGTCTGTCTCGCCGCTTTAG
JMSF011I23+ GCCATGATCGCGCGCGGAGGAGCTTACTGTCTTGTCTGTCTGTCTGTCTCGCCGCTTTAG
JMSF014M14+ GCCATGATCGCGCGCGGAGGAGCTTACTGTCTTGTCTGTCTGTCTGTCTCGCCGCTTTAG
JMFF011H19+ GCCATGATCGCGCGCGGAGGAGCTTACTGTCTTGTCTGTCTGTCTGTCTCGCCGCTTTAG
JMFF031L05+ GCCATGATCGCGCGCGGAGGAGCTTACTGTCTTGTCTGTCTGTCTGTCTCGCCGCTTTAG
                      ____________________________________________________________
consensus GCCATGATCGCGCGCGGAGGAGCTTACTGTCTTGTCTGTCTGTCTGTCTCGCCGCTTTAG
 
. : . : . : . : . : . :
JMFF045F17+ CTC
JMSF028E11+ CTC
JMSF049G18+ CTTC
JMSF018F23+ CTC
JMSF003I06+ CTC
JMSF041E24+ CTTC
JMFF045N08+ CTTAGCTTAGCTATA
JMSF026I08+ CTTC
JMSF010C07+ CTTC
JMSF043A20+ CTTAGCTTAGCTATACT
JMFF041E22+ CTTAGCTTAGCTATACT
JMSF032L15+ CTTAGCTTAGCTATAC
JMSF038M05+ CTTAGCTTAGCTATAC
JMFF031H06+ CTTAGCTTAGCTAT
JMSF047L03+ C
JMFF031A17+ CTTAGCTTAGCTATACT
JMFF035L13+ CTTAGCTTAGCTATACT
JMSF051A06+ CTTAGCTTAGCTATACT
JMSF028H08+ CTTAGCTTAGCTATAC
JMSF032G11+ CTTAGCTTAGCTAT
JMSF032F22+ CTTAGCTTAGCTAT
JMFF034L03+ CTTAGCTTAGCTAT
JMFF017H21+ CTTAGCTTAGCTATACT
JMFF001F05+ CTT
JMFF039A18+ CTTAGCTTAGCTATACTGAGAGGAGTGATTTTTGTGTTGGTGATATGT
JMFF035J02+ CTTAGCTTAGCTATACT
JMFF028O10+ CTTAGCTTAGCTAT
JMFF023H09+ CTTAGCTTAGCTATACT
JMFF014I03+ CTTAGCTTAGCTATACT
JMFF017E01+ CTTAGCTTAGCTATACT
JMSF028L12+ CTTAGCTTAGCTATACTGAGAGGAGTGATTTTTGTGTTGGTGATATGT
JMFF045D24+ CTTAGCTTAGCTATACTGAGAGGAGTGATTTTTGTGTTGGTGATATGTGAAGGAGAA
JMFF029C15+ CTTAGCTTAGCTATACTGAGAGGAGTGATTTTTGTGTTGGTGATATGT
JMFF023B03+ CTTAGCTTAGCTATACTGAGAGGAGTGATTTTTGTGTTGGTGATATGT
JMSF019O16+ CTTAGCTTAGCTATACTG
JMSF014P13+ CTTAGCTTAGCTATA
JMFF023E22+ CTTAGCTTAGCTATACT
JMSF003N19+ CTTAGCTTAGCTATACT
JMSF006M18+ CTTAGCTTAGCT
JMSF011I23+ CTTAGCTTAGCTAT
JMSF014M14+ CTTAGCTTAGCTAT
JMFF011H19+ CTTAGCTTAGCTATACTGAGAGGAGT
JMFF031L05+ CTTAGCTTAGCTATACTGAGAGGAGTGATTTTTGTGTTGGTGATATGTGAAGGAGAAGAT
                      ____________________________________________________________
consensus CTTAGCTTAGCTATACTGAGAGGAGTGATTTTTGTGTTGGTGATATGTGAAGGAGAAGAT