Previous Contig 001431:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF031I19Sequence471001431 (5)pir|T06005|T060053e-42hypothetical protein T25K17.20 - Arabidopsis thaliana>gb:ATCHRIV64_1546502 Arabi632001431 (5)pir|T06005|T060052e-48hypothetical protein T25K17.20 - Arabidopsis thaliana>gb:ATCHRIV64_1546502 Arabi
JMFN044H05Sequence627001431 (5)pir|T06005|T060051e-50hypothetical protein T25K17.20 - Arabidopsis thaliana>gb:ATCHRIV64_1546502 Arabi
JMSF020P11Sequence674001431 (5)pir|T06005|T060052e-50hypothetical protein T25K17.20 - Arabidopsis thaliana>gb:ATCHRIV64_1546502 Arabi749001431 (5)pir|T06005|T060052e-50hypothetical protein T25K17.20 - Arabidopsis thaliana>gb:ATCHRIV64_1546502 Arabi

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF031I19- GGGGAG
                      ____________________________________________________________
consensus GGGGAG
 
. : . : . : . : . : . :
rJMFF031I19- TTCAAACTCGCAGTCGCATAACATTTTTGTTACTTATGATAGTTTCAACATCAAAACATA
rJMSF020P11- AACTCGCAGTCGCATAACATTTTTGTTACTTATGATAGTTTCAACATCAAAACATA
                      ____________________________________________________________
consensus TTCAAACTCGCAGTCGCATAACATTTTTGTTACTTATGATAGTTTCAACATCAAAACATA
 
. : . : . : . : . : . :
rJMFF031I19- TTAAGAACACCACTACATAGTTCATCAACCTAGGTGCCTCTGACTCTGAGGGTAGAAAAA
JMFN044H05+ CATAGTTCATCAACCTAGGTGCCTCTGACTCTGAGGGTAGAAAAA
rJMSF020P11- TTAAGAACACCACTACATAGTTCATCAACCTAGGTGCCTCTGACTCTGAGGGTAGAAAAA
JMSF020P11+ ACTCTGAGGGTAGAAAAA
                      ____________________________________________________________
consensus TTAAGAACACCACTACATAGTTCATCAACCTAGGTGCCTCTGACTCTGAGGGTAGAAAAA
 
. : . : . : . : . : . :
rJMFF031I19- TTGGCACAGATTATTACAGCAAACAAATTTAGTCACTGATTTCTCAGCTTCAAAAATGTT
JMFN044H05+ TTGGCACAGATTATTACAGCAAACAAATTTAGTCACTGATTTCTCAGCTTCAAAAATGTT
rJMSF020P11- TTGGCACAGATTATTACAGCAAACAAATTTAGTCACTGATTTCTCAGCTTCAAAAATGTT
JMSF020P11+ TTGGCACAGATTATTACAGCAAACAAATTTAGTCACTGATTTCTCAGCTTCAAAAATGTT
                      ____________________________________________________________
consensus TTGGCACAGATTATTACAGCAAACAAATTTAGTCACTGATTTCTCAGCTTCAAAAATGTT
 
. : . : . : . : . : . :
rJMFF031I19- TTGGAAGACAAAACCTCGCAGTATTGAGTGCCAGTCGCTCAGATTATCCTAACCAAGACA
JMFN044H05+ TTGGAAGACAAAACCTTGCAGTATTGAGTGCCAGTCGCTCAGATTATCCTAACCAAGACA
rJMSF020P11- TTGGAAGACAAAACCTTGCAGTATTGAGTGCCAGTCGCTCAGATTATCCTAACCAAGACA
JMSF020P11+ TTGGAAGACAAAACCTTGCAGTATTGAGTGCCAGTCGCTCAGATTATCCTAACCAAGACA
                      ____________________________________________________________
consensus TTGGAAGACAAAACCTTGCAGTATTGAGTGCCAGTCGCTCAGATTATCCTAACCAAGACA
 
. : . : . : . : . : . :
rJMFF031I19- GAAAGATTGTGGTTACCCAGCTGGTTCTTTTCAGGGATAGTAACCGGTGAACGTAAATCC
JMFN044H05+ GAAAGATTGTGGTTACCCAGCTGGTTCTTTTCAGGGATAGTAACCGGTGAACGTAAATCC
rJMSF020P11- GAAAGATTGTGGTTACCCAGCTGGTTCTTTTCAGGGATAGTAACCGGTGAACGTAAATCC
JMSF020P11+ GAAAGATTGTGGTTACCCAGCTGGTTCTTTTCAGGGATAGTAACCGGTGAACGTAAATCC
                      ____________________________________________________________
consensus GAAAGATTGTGGTTACCCAGCTGGTTCTTTTCAGGGATAGTAACCGGTGAACGTAAATCC
 
. : . : . : . : . : . :
rJMFF031I19- CCTTCCTACTATCTCTCCAGCACAATACCATGCAAAGCATTCGAGGCCGAATAAAGCAGC
JMFN044H05+ CCTTCCTACTATCTCTCCAGCACAATACCATGCAAAGCATTCGAGGCCGAATAAAGCAGC
rJMSF020P11- CCTTCCTACTATCTCTCCAGCACAATACCATGCAAAGCATTCGAGGCCGAATAAAGCAGC
JMSF020P11+ CCTTCCTACTATCTCTCCAGCACAATACCATGCAAAGCATTCGAGGCCGAATAAAGCAGC
JMFF031I19+ TATCTCTCCAGCACAATACCATGCAAAGCATTCGAGGCCGAATAAAGCAGC
                      ____________________________________________________________
consensus CCTTCCTACTATCTCTCCAGCACAATACCATGCAAAGCATTCGAGGCCGAATAAAGCAGC
 
. : . : . : . : . : . :
rJMFF031I19- TGTGCCAGCATCCTCGACCTTCAATTCGTGCCTATTCTTCCATGCCTGCTTGACATAATC
JMFN044H05+ TGTGCCAGCATCCTCGACCTTCAATTCGTGCCTATTCTTCCATGCCTGCTTGACATAATC
rJMSF020P11- TGTGCCAGCATCCTCGACCTTCAATTCGTGCCTATTCTTCCATGCCTGCTTGACATAATC
JMSF020P11+ TGTGCCAGCATCCTCGACCTTCAATTCGTGCCTATTCTTCCATGCCTGCTTGACATAATC
JMFF031I19+ TGTGCCAGCATCCTCGACCTTCAATTCGTGCCTATTCTTCCATGCCTGCTTGACATAATC
                      ____________________________________________________________
consensus TGTGCCAGCATCCTCGACCTTCAATTCGTGCCTATTCTTCCATGCCTGCTTGACATAATC
 
. : . : . : . : . : . :
rJMFF031I19- AACTTCCTCCCAAAAGGCCTGGTTACGGCTGGGGATACTGGCAAGACGAGTGTAGAAGAG
JMFN044H05+ AACTTCCTTCCAAAAGGCCTGGTTACGGCTGGGGATACTGGCAAGACGAGTGTAGAAGAG
rJMSF020P11- AACTTCCTTCCAAAAGGCCTGGTTACGGCTGGGGATACTGGCAAGACGAGTGTAGAAGAG
JMSF020P11+ AACTTCCTTCCAAAAGGCCTGGTTACGGCTGGGGATACTGGCAAGACGAGTGTAGAAGAG
JMFF031I19+ AACTTCCTCCCAAAAGGCCTGGTTACGGCTGGGGATACTGGCAAGACGAGTGTAGAAGAG
                      ____________________________________________________________
consensus AACTTCCTTCCAAAAGGCCTGGTTACGGCTGGGGATACTGGCAAGACGAGTGTAGAAGAG
 
. : . : . : . : . : . :
rJMFF031I19- CTGTTTAGATAATTCATTGCACTTTTCCACAGTGGATGGCTCCACAATATACTGCTTGTT
JMFN044H05+ CTGTTTAGATAATTCATTGCACTTTTCCACAGTGGATGGCTCCACAATATACTGCTTGTT
rJMSF020P11- CTGTTTAGATAATTCATTGCACTTTTCCACAGTGGATGGCTCCACAATATACTGCTTGTT
JMSF020P11+ CTGTTTAGATAATTCATTGCACTTTTCCACAGTGGATGGCTCCACAATATACTGCTTGTT
JMFF031I19+ CTGTTTAGATAATTCATTGCACTTTTCCACAGTGGATGGCTCCACAATATACTGCTTGTT
                      ____________________________________________________________
consensus CTGTTTAGATAATTCATTGCACTTTTCCACAGTGGATGGCTCCACAATATACTGCTTGTT
 
. : . : . : . : . : . :
rJMFF031I19- CTGATCCAATGTCTGTTTGTAGATAGCACAACTATGCTTGGTAATAAACTGTTTCGCTTG
JMFN044H05+ CTGATCCAATGTCTGTTTGTAGATAGCACAACTATGCTTGGTAATAAACTGTTTCGCTTG
rJMSF020P11- CTGATCCAATGTCTGTTTGTAGATAGCACAACTATGCTTGGTAATAAACTGTTTCGCTTG
JMSF020P11+ CTGATCCAATGTCTGTTTGTAGATAGCACAACTATGCTTGGTAATAAACTGTTTCGCTTG
JMFF031I19+ CTGATCCAATGTCTGTTTGTAGATAGCACAACTATGCTTGGTAATAAACTGTTTCGCTTG
                      ____________________________________________________________
consensus CTGATCCAATGTCTGTTTGTAGATAGCACAACTATGCTTGGTAATAAACTGTTTCGCTTG
 
. : . : . : . : . : . :
rJMFF031I19- GCATGCCTTTGCTTGCAGTTGATGAA
JMFN044H05+ GCATGCCTTTGCTTGCAGTTGATGAAACTTGGATGCCATTAATTCTTCTTTTTAAAATAT
rJMSF020P11- GCATGCCTTTGCTTGCAGTTGATGAAACTTGGATGCCATTAATTCTTCTTTTTAAAATAT
JMSF020P11+ GCATGCCTTTGCTTGCAGTTGATGAAACTTGGATGCCATTAATTCTTCTTTTTAAAATAT
JMFF031I19+ GCATGCCTTTGCTTGCAGTTGATGAAACTTGGATGCCATTAATTCTTCTTTTTAAAATAT
                      ____________________________________________________________
consensus GCATGCCTTTGCTTGCAGTTGATGAAACTTGGATGCCATTAATTCTTCTTTTTAAAATAT
 
. : . : . : . : . : . :
JMFN044H05+ CCGGAGTATTGGTCAGAGAAGACGGCGAGGATTTGCTACTCC
rJMSF020P11- CCGGAGTATTGGTCAGAGAAGACGGCGAGGATTTGCTACTCCCGCCGCTGCGCTGCGTCT
JMSF020P11+ CCGGAGTATTGGTCAGAGAAGACGGCGAGGATTTGCTACTCCCGCCGCTGCGCTGCGTCT
JMFF031I19+ CCGGAGTATTGGTCAGAGAAGACGGCGAGGATTTGCTACTCCCGCCGCTGCGCTGCGTCT
                      ____________________________________________________________
consensus CCGGAGTATTGGTCAGAGAAGACGGCGAGGATTTGCTACTCCCGCCGCTGCGCTGCGTCT
 
. : . : . : . : . : . :
rJMSF020P11- ATTGACTCTATTCTAGAAAGAGGCTTTGAA
JMSF020P11+ ATTGACTCTATTCTAGAAAGAGGCTTTGAAGGGAGAAAGGAGAGAAATCAAGAGT
JMFF031I19+ ATTGACTCTATTCTAGAAAGAGGCTTTGAAGGGAGAAAGGAGAGAAATCAAGAGTAACAC
                      ____________________________________________________________
consensus ATTGACTCTATTCTAGAAAGAGGCTTTGAAGGGAGAAAGGAGAGAAATCAAGAGTAACAC