Previous Contig 001420:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005N14Sequence493001420 (19)sp|Q9XG83|G2OX_PHACN6e-27Gibberellin 2-beta-dioxygenase (EC 1.14.11.13) (Gibberellin 2-beta- hydroxylase)
JMFF013G19Sequence568001420 (19)sp|Q9XG83|G2OX_PHACN3e-39Gibberellin 2-beta-dioxygenase (EC 1.14.11.13) (Gibberellin 2-beta- hydroxylase)607001420 (19)gb:AB031206_15186012e-40Lactuca sativa Ls2ox1 mRNA for gibberellin 2-oxidase No1, complete cds.
JMFF016J19Sequence616001420 (19)sp|Q9XG83|G2OX_PHACN8e-40Gibberellin 2-beta-dioxygenase (EC 1.14.11.13) (Gibberellin 2-beta- hydroxylase)684001420 (19)gb:CMA315663_16479501e-53Cucurbita maxima partial mRNA for Gibberellin 2-oxidase (ga2ox gene).
JMFF016L08Sequence592001420 (19)sp|Q9XG83|G2OX_PHACN3e-40Gibberellin 2-beta-dioxygenase (EC 1.14.11.13) (Gibberellin 2-beta- hydroxylase)779001420 (19)gb:AB125232_15281417e-69Nicotiana tabacum GA2ox1 mRNA for gibberellin 2-oxidase 1, complete cds.
JMFF029G16Sequence621001420 (19)sp|Q9XG83|G2OX_PHACN3e-39Gibberellin 2-beta-dioxygenase (EC 1.14.11.13) (Gibberellin 2-beta- hydroxylase)673001420 (19)gb:CMA315663_16479507e-52Cucurbita maxima partial mRNA for Gibberellin 2-oxidase (ga2ox gene).
JMFF029O03Sequence200001420 (19)682001420 (19)gb:CMA315663_16479509e-54Cucurbita maxima partial mRNA for Gibberellin 2-oxidase (ga2ox gene).
JMFF031F18Sequence499001420 (19)sp|Q9XG83|G2OX_PHACN3e-27Gibberellin 2-beta-dioxygenase (EC 1.14.11.13) (Gibberellin 2-beta- hydroxylase)808001420 (19)gb:AB125232_15281413e-68Nicotiana tabacum GA2ox1 mRNA for gibberellin 2-oxidase 1, complete cds.
JMFF043N05Sequence625001420 (19)sp|Q9XG83|G2OX_PHACN3e-40Gibberellin 2-beta-dioxygenase (EC 1.14.11.13) (Gibberellin 2-beta- hydroxylase)455001420 (19)gb:AB031207_15186021e-19Lactuca sativa Ls2ox2 mRNA for gibberellin 2-oxidase No2, complete cds.
JMFN015E16Sequence614001420 (19)gb:AF101382_17681533e-71Pisum sativum gibberellin 2 beta-hydroxylase mRNA, deletion mutant, complete cds
JMFN019I09Sequence624001420 (19)gb:AB031206_15186012e-42Lactuca sativa Ls2ox1 mRNA for gibberellin 2-oxidase No1, complete cds.
JMFN020F07Sequence608001420 (19)gb:AF101382_17681531e-37Pisum sativum gibberellin 2 beta-hydroxylase mRNA, deletion mutant, complete cds
JMFN036B03Sequence590001420 (19)sp|Q9XG83|G2OX_PHACN2e-40Gibberellin 2-beta-dioxygenase (EC 1.14.11.13) (Gibberellin 2-beta- hydroxylase)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF013G19- TAATCTTCTTTGGGTTTTA
rJMFF029O03- ATCTTCTTTGGGTTTTA
rJMFF029G16- CTTCTTTGGGTTTTA
rJMFF043N05- A
JMFN019I09+ TTGGGTTTTA
rJMFF016J19- ATCTTCTTTGGGTTTTA
rJMFF031F18- ATCTTCTTTGGGTTTTA
                      ____________________________________________________________
consensus TAATCTTCTTTGGGTTTTA
 
. : . : . : . : . : . :
rJMFF013G19- CTAAATACAATACTATGTATTATATA-GTACATAGGAACCGAAATACCTATATACATGGT
rJMFF029O03- CTAAATACAATACTATGTATTATATA-GTACATAGGAACCGAAATACCTATATACATGGT
rJMFF029G16- CTAAATACAATACTATGTATTATATA-GTACATAGGAACCGAAATACCTATATACATGGT
rJMFF043N05- CTAAATACAATACTATGTATTATATA-GTACATAGGAACCGAAATACCTATATACATGGT
JMFN019I09+ CTAAATACAATACTATGTATTATATA-GTACATAGGAACCGAAATACCTATATACATGGT
rJMFF016J19- CTAAATACAATACTATGTATTATATA-GTACATAGGAACCGAAATACCTATATACATGGT
rJMFF031F18- CTAAATACAATACTATGTATTATATA-GTACATAGGAACCGAAATACCTATATACATGGT
rJMFF016L08- ATGTATTATATAGGTACATAGGAACCGAAATACCTATATACATGGT
                      ____________________________________________________________
consensus CTAAATACAATACTATGTATTATATA-GTACATAGGAACCGAAATACCTATATACATGGT
 
. : . : . : . : . : . :
rJMFF013G19- CGATAGCTTTTACATAACTAGCCATGTCTTGCAGACAGGGTATGGGGTAAAAATTCCCAG
rJMFF029O03- CGATAGCTTTTACATAACTAGCCATGTCTTGCAGACAGGGTATGGGGTAAAAATTCCCAG
rJMFF029G16- CGATAGCTTTTACATAACTAGCCATGTCTTGCAGACAGGGTATGGGGTAAAAATTCCCAG
rJMFF043N05- CGATAGCTTTTACATAACTAGCCATGTCTTGCAAACAGGGTATGGGGTAAAAATTCCCAA
JMFN019I09+ CGATAGCTTTTACATAACTAGCCATGTCTTGCAGACAGGGTATGGGGTAAAAATTCCCAG
rJMFF016J19- CGATAGCTTTTACATAACTAGCCATGTCTTGCAGACAGGGTATGGGGTAAAAATTCCCAG
rJMFF031F18- CGATAGCTTTTACATAACTAGCCATGTCTTGCAGACAGGGTATGGGGTAAAAATTCCCAG
rJMFF016L08- CGATAGCTTTTACATAACTAGCCATGTCTTGCAGACAGGGTATGGGGTAAAAATTCCCAG
                      ____________________________________________________________
consensus CGATAGCTTTTACATAACTAGCCATGTCTTGCAGACAGGGTATGGGGTAAAAATTCCCAG
 
. : . : . : . : . : . :
rJMFF013G19- AAAAATCTGGAAATCCCCCCTGCATATATATAGATATATAGCGAAATCTAAAAAGTTTTA
rJMFF029O03- AAAAATCTGGAAATCCCCCCTGCATATATATAGATATATAGCGAAATCTAAAAAGTTTTA
rJMFF029G16- AAAAATCTGGAAATCCCCCCTGCATATATATAGATATATAGCGAAATCTAAAAAGTTTTA
rJMFF043N05- AAAAATCTGGAAATCCCCCCTGCATATATATAGATATATAGCGAAATCTAAAAAGTTTTA
JMFN019I09+ AAAAATCTGGAAATCCCCCCTGCATATATATAGATATATAGCGAAATCTAAAAAGTTTTA
rJMFF016J19- AAAAATCTGGAAATCCCCCCTGCATATATATAGATATATAGCGAAATCTAAAAAGTTTTA
rJMFF031F18- AAAAATCTGGAAATCCCCCCTGCATATATATAGATATATAGCG-AATCTAAAAAGTTTTA
rJMFF016L08- AAAAATCTGGAAATCCCCCCTGCATATATATAGATATATAGCGAAATCTAAAAAGTTTTA
                      ____________________________________________________________
consensus AAAAATCTGGAAATCCCCCCTGCATATATATAGATATATAGCGAAATCTAAAAAGTTTTA
 
. : . : . : . : . : . :
rJMFF013G19- CATGTTTTCTAATTAACAGAAGTTGGGTTATTACAATGCAGTGGAGGATTGTTCTTCTTC
rJMFF029O03- CATGTTTTCTAATTAACAGAAGTTGGGTTATTACAATGCAGTGGAGGATTGTTCTTCTTC
rJMFF029G16- CATGTTTTCTAATTAACAGAAGTTGGGTTATTACAATGCAGTGGAGGATTGTTCTTCTTC
rJMFF043N05- CCTGTTTTCTAATTAACAAAAGTTGGGTTATTACAATGCAGTGGAGGATTGTTCTTCTTC
JMFN019I09+ CATGTTTTCTAATTAACAGAAGTTGGGTTATTACAATGCAGTGGAGGATTGTTCTTCTTC
rJMFF016J19- CATGTTTTCTAATTAACAGAAGTTGGGTTATTACAATGCAGTGGAGGATTGTTCTTCTTC
rJMFF031F18- CATGTTTTCTAATTAACAGAAGTTGGGTTATTACAATGCAGTGGAGGATTGTTCTTCTTC
rJMFF016L08- CATGTTTTCTAATTAACAGAAGTTGGGTTATTACAATGCAGTGGAGGATTGTTCTTCTTC
                      ____________________________________________________________
consensus CATGTTTTCTAATTAACAGAAGTTGGGTTATTACAATGCAGTGGAGGATTGTTCTTCTTC
 
. : . : . : . : . : . :
rJMFF013G19- TCAAACAGGGAAAGCCTGTTGTCAGCCAACTTTGTCTTGTAAGCAGATTTCTTGTATTCA
rJMFF029O03- TCAAACAGGGAAAGCCTGTTGTCAGCCAACTTTGTCTTGTAAGCAGATTTCTTGTATTCA
rJMFF029G16- TCAAACAGGGAAAGCCTGTTGTCAGCCAACTTTGTCTTGTAAGCAGATTTCTTGTATTCA
rJMFF043N05- TCAAACAGGGAAAGCCTGTTGTCAGCCAACTTTGTCTTGTAAGCAAATTTCTTGAATTCA
JMFN019I09+ TCAAACAGGGAAAGCCTGTTGTCAGCCAACTTTGTCTTGTAAGCAGATTTCTTGTATTCA
rJMFF016J19- TCAAACAGGGAAAGCCTGTTGTCAGCCAACTTTGTCTTGTAAGCAGATTTCTTGTATTCA
rJMFF031F18- TCAAACAGGGAAAGCCTGTTGTCAGCCAACTTTGTCTTGTAAGCAGATTTCTTGTATTCA
rJMFF016L08- TCAAACAGGGAAAGCCTGTTGTCAGCCAACTTTGTCTTGTAAGCAGATTTCTTGTATTCA
                      ____________________________________________________________
consensus TCAAACAGGGAAAGCCTGTTGTCAGCCAACTTTGTCTTGTAAGCAGATTTCTTGTATTCA
 
. : . : . : . : . : . :
rJMFF013G19- TGCCATGTGAATTCATTGTAGAGGCTCTCTTCCCCTTCTTCCATAAGGGAAGATAAAGCT
rJMFF029O03- TGCCATGTGAATTCATTGTAGAGGCTCTCTTCCCCTTCTTCCATAAGGGAAGATAAAGCT
rJMFF029G16- TGCCATGTGAATTCATTGTAGAGGCTCTCTTCCCCTTCTTCCATAAGGGAAGATAAAGCT
rJMFF043N05- TGCCATGTGAATTCATTGTAGAGGCTCTCTTCCCCTTCTTCCATAAGGGAAGATAAAGCT
JMFN019I09+ TGCCATGTGAATTCATTGTAGAGGCTCTCTTCCCCTTCTTCCATAAGGGAAGATAAAGCT
rJMFF016J19- TGCCATGTGAATTCATTGTAGAGGCTCTCTTCCCCTTCTTCCATAAGGGAAGATAAAGCT
rJMFF031F18- TGCCATGTGAATTCATTGTAGAGGCTCTCTTCCCCTTCTTCCATAAGGGAAGATAAAGCT
rJMFF016L08- TGCCATGTGAATTCATTGTAGAGGCTCTCTTCCCCTTCTTCCATAAGGGAAGATAAAGCT
                      ____________________________________________________________
consensus TGCCATGTGAATTCATTGTAGAGGCTCTCTTCCCCTTCTTCCATAAGGGAAGATAAAGCT
 
. : . : . : . : . : . :
rJMFF013G19- GCAATCTTTGCATTCAAAGGTGGACCTCCAAAGTATATCATGGACACCCTGGCCTTCAGG
rJMFF029O03- GCAATCTTTGCATTCAAAGGTGGACCTCCAAAGTATATCATGGACACCCTGGCCTTCAGG
rJMFF029G16- GCAATCTTTGCATTCAAAGGTGGACCTCCAAAGTATATCATGGACACCCTGGCCTTCAGG
rJMFF043N05- GCAATCTTTGCATTCAAAGGTGGACCTCCAAAGTATATCATGGACACCCTGGCCTTCAGG
JMFN019I09+ GCAATCTTTGCATTCAAAGGTGGACCTCCAAAGTATATCATGGACACCCTGGCCTTCAGG
rJMFF016J19- GCAATCTTTGCATTCAAAGGTGGACCTCCAAAGTATATCATGGACACCCTGGCCTTCAGG
rJMFF031F18- GCAATCTTTGCATTCAAAGGTGGACCTCCAAAGTATATCATGGACACCCTGGCCTTCAGG
rJMFF016L08- GCAATCTTTGCATTCAAAGGTGGACCTCCAAAGTATATCATGGACACCCTGGCCTTCAGG
                      ____________________________________________________________
consensus GCAATCTTTGCATTCAAAGGTGGACCTCCAAAGTATATCATGGACACCCTGGCCTTCAGG
 
. : . : . : . : . : . :
rJMFF013G19- CTGTCTGCCAGCACCCTGTGCTTCACACTCCTGAACCTCCCATTAGTCATCACCTGGAGG
rJMFF029O03- CTGTCTGCCAGCACCCTGTGCTTCACACTCCTGAACCTCCCATTAGTCATCACCTGGAGG
rJMFF029G16- CTGTCTGCCAGCACCCTGTGCTTCACACTCCTGAACCTCCCATTAGTCATCACCTGGAGG
rJMFF043N05- CTGTCTGCCAGCACCCTGTGCTTCACACTCCTGAA
JMFN019I09+ CTGTCTGCCAGCACCCTGTGCTTCACACTCCTGAACCTCCCATTAGTCATCACCTGGAGG
rJMFF016J19- CTGTCTGCCAGCACCCTGTGCTTCACACTCCTGAACCTCCCATTAGTCATCACCTGGAGG
rJMFF031F18- CTGTCTGCCAGCACCCTGTGCTTCACACTCCTGAACCTCCCATTAGTCATCACCTGGAGG
rJMFF016L08- CTGTCTGCCAGCACCCTGTGCTTCACACTCCTGAACCTCCCATTAGTCATCACCTGGAGG
                      ____________________________________________________________
consensus CTGTCTGCCAGCACCCTGTGCTTCACACTCCTGAACCTCCCATTAGTCATCACCTGGAGG
 
. : . : . : . : . : . :
rJMFF013G19- GAATCACCAACATTGATGAAGAAAGAGTACTGGTCAGGGGGGACCGAGACCCAAGTGCCA
rJMFF029O03- GAATCACCAACATTGATGAAGAAAGAGTACTGGTCAGGGGGGACCGAGACCCAAGTGCCA
rJMFF029G16- GAATCACCAACATTGATGAAGAAAGAGTACTGGTCAGGGGGGACCGAGACCCAAGTGCCA
JMFN019I09+ GAATCACCAACATTGATGAAGAAAGAGTACTGGTCAGGGGGGACCGAGACCCAAGTGCCA
rJMFF016J19- GAATCACCAACATTGATGAAGAAAGAGTACTGGTCAGGGGGGACCGAGACCCAAGTGCCA
rJMFF031F18- GAATCACCAACATTGATGAAGAAAGAGTACTGGTCAGGGGGGACCGAGACCCAAGTGCCA
rJMFF016L08- GAATCACCAACATTGATGAAGAAAGAGTACTGGTCAGGGGGGACCGAGACCCAAGTGCCA
JMFN015E16+ GGGGGACCGAGACCCAAGTGCCA
                      ____________________________________________________________
consensus GAATCACCAACATTGATGAAGAAAGAGTACTGGTCAGGGGGGACCGAGACCCAAGTGCCA
 
. : . : . : . : . : . :
rJMFF013G19- TCTTTGAGGGAGATTTGCAGGCCTGTGG-TGTCATTGGACCTGACAACAG
rJMFF029O03- TCTTTGAGGGAGATTTGCAGGCCTGTGG-TGTCATTGGACCTGACAACAGAGATCACTTG
rJMFF029G16- TCTTTGAGGGAGATTTGCAGGCCTGTGG-TGTCATTGGACCTGACAACAGAGATCACTTG
JMFN019I09+ TCTTTGAGGGAGATTTGCAGGCCTGTGG-TGTCATTGGACCTGACAACAGAGATCAC-TG
rJMFF016J19- TCTTTGAGGGAGATTTGCAGGCCTGTGG-TGTCATTGGACCTGACAACAGAGATCACTTG
rJMFF031F18- TCTTTGAGGGAGATTTGCAGGCCTGTGG-TGTCATTGGACCTGACAACAGAGATCACTTG
rJMFF016L08- TCTTTGAGGGAGATTTGCAGGCCTGTGG-TGTCATTGGACCTGACAACAGAGATCACTTG
JMFN015E16+ TCTTTGAGGGAGA-TTGCAGGCCTGTGGNTGTCATTGGACCTGACAACAGAGATCACTTG
                      ____________________________________________________________
consensus TCTTTGAGGGAGATTTGCAGGCCTGTGG-TGTCATTGGACCTGACAACAGAGATCACTTG
 
. : . : . : . : . : . :
rJMFF029O03- TGGGTCTGTGTGCTCTCCAAAACCAATCAGATTTCTGCCACTCAATGCTTGGAAATCTGG
rJMFF029G16- TGGGTCTGTGTGCTCTCCAAAACCAATCAGATTTCTGCCACTCAATGCTTGGAAATCTGG
JMFN019I09+ TGGGTCTGTGTGCTCTC
rJMFF016J19- TGGGTCTGTGTGCTCTCCAAAACCAATCAGATTTCTGCCACTCAATGCTTGGAAATCTGG
rJMFF031F18- TGGGTCTGTGTGCTCTCCAAAACCAATCAGATTTCTGCCACTCAATGCTTGGAAATCTGG
rJMFF016L08- TGGGTCTGTGTGCTCTCCAAAACCAATCAGATTTCTGCCACTAAATGCTTGGAAATCTGG
JMFN015E16+ TGGGTCTGTGTGCTCTCCAAAACCAATCAGATTTCTGCCACTCAATGCTTGGAAATCTGG
                      ____________________________________________________________
consensus TGGGTCTGTGTGCTCTCCAAAACCAATCAGATTTCTGCCACTCAATGCTTGGAAATCTGG
 
. : . : . : . : . : . :
rJMFF029O03- GCATGG
rJMFF016J19- GCATGG
rJMFF031F18- GCATGGGTGGATAGTGGTTTACCCTGAAGCAACAATCACTTTTCTCATCCCTGATCAGCT
rJMFF016L08- GCATGGTGGGATAGTGGTTTACCCTGAAGCAACAATCACTTTTCTCATCCCTGATCAGCT
JMFN015E16+ GCATGGT-GGATAGTGGTTTACCCTGAAGCAACAATCACTTTTCTCATCCCTGATCAGCT
JMFN020F07+ TGATCAGCT
                      ____________________________________________________________
consensus GCATGGTTGGATAGTGGTTTACCCTGAAGCAACAATCACTTTTCTCATCCCTGATCAGCT
 
. : . : . : . : . : . :
rJMFF031F18- TGCTCAGCACATTTTTTGGCCCAATCTTCAACCCCTCAGCCATCATCTCCAGTAACTCAC
rJMFF016L08- TGCTCAGCACATTTTTTGGCCCAATCTTCAACCCCTCAGCCATCATCTCCAGTAACTCAC
JMFN015E16+ TGCTCAGCACATTTTTTGGCCCAATCTTCAACCCCTCAGCCATCATCTCCAGTAACTCAC
JMFN020F07+ TGCTCAGCACA-TTTTTGGCCCAATCTTCAACCCCTCAGCCATCATCTCCAGTAACTCAC
                      ____________________________________________________________
consensus TGCTCAGCACATTTTTTGGCCCAATCTTCAACCCCTCAGCCATCATCTCCAGTAACTCAC
 
. : . : . : . : . : . :
rJMFF031F18- ACGCCATGTTCTTC
rJMFF016L08- ACGCCATGTTCTTC
JMFN015E16+ ACGCCATGTTCTTCACAGCCCCAGTATACTCATTCACAAGCCCCCAAAAAAGCTCAGAAT
JMFN020F07+ ACGCCATGTTCTTCACAGCCCCAGTATACTCATTCACAAGCCCCCAAAAAAGCTCAGAAT
JMFN036B03+ CAGCCCCAGTATACTCATTCACAAGCCCCCAAAAAAGCTCAGAAT
JMFF029G16+ ATTCACAAGCCCCCAAAAAAGCTCAGAAT
JMFF016J19+ TCACAAGCCCCCAAAAAAGCTCAGAAT
JMFF043N05+ TCATTCACAAGCCCCCAAAAAAGCTCAGAAT
                      ____________________________________________________________
consensus ACGCCATGTTCTTCACAGCCCCAGTATACTCATTCACAAGCCCCCAAAAAAGCTCAGAAT
 
. : . : . : . : . : . :
JMFN015E16+ TGCCAGGAATGGTAATGGGTTTCTGGGAAATGAGTTGAGGGTTGGTGGTGAAGAGGAGGT
JMFN020F07+ TGCCAGGAATGGTAATGGGTTTCTGGGAAATGAGTTGAGGGTTGGTGGTGAAGAGGAGGT
JMFN036B03+ TGCCAGGAATGGTAATGGGTTTCTGGGAAATGAGTTGAGGGTTGGTGGTGAAGAGGAGGT
JMFF029G16+ TGCCAGGAATGGTAATGGGTTTCTGGGAAATGAGTTGAGGGTTGGTGGTGAAGAGGAGGT
JMFF016J19+ TGCCAGGAATGGTAATGGGTTTCTGGGAAATGAGTTGAGGGTTGGTGGTGAAGAGGAGGT
JMFF016L08+ TGCCAGGAATGGTAATGGGTTTCTGGGAAATGAGTTGAGGGTTGGTGGTGAAGAGGAGGT
JMFF013G19+ GGGAAATGAGTTGAGGGTTGGTGGTGAAGAGGAGGT
JMFF043N05+ TGCCAGGAATGGTAATGGGTTTCTGGGAAATGAGTTGAGGGTTGGTGGTGAAGAGGAGGT
                      ____________________________________________________________
consensus TGCCAGGAATGGTAATGGGTTTCTGGGAAATGAGTTGAGGGTTGGTGGTGAAGAGGAGGT
 
. : . : . : . : . : . :
JMFN015E16+ ACTCAATCCAACCCACATCGCCATTGGACCCAATCCTCCTATTCCCATACCCGTAGGGGG
JMFN020F07+ ACTCAATCCAACCCACATCGCCATTGGACCCAATCCTCCTATTCCCATACCCGTAGGGGG
JMFN036B03+ ACTCAATCCAACCCACATCGCCATTGGACCCAATCCTCCTATTCCCATACCCGTAGGGGG
JMFF029G16+ ACTCAATCCAACCCACATCGCCATTGGACCCAATCCTCCTATTCCCATACCCGTAGGGGG
JMFF016J19+ ACTCAATCCAACCCACATCGCCATTGGACCCAATCCTCCTATTCCCATACCCGTAGGGGG
JMFF005N14+ TATTCCCATACCCGTAGGGGG
JMFF016L08+ ACTCAATCCAACCCACATCGCCATTGGACCCAATCCTCCTATTCCCATACCCGTAGGGGG
JMFF013G19+ ACTCAATCCAACCCACATCGCCATTGGACCCAATCCTCCTATTCCCATACCCGTAGGGGG
JMFF043N05+ ACTCAATCCAACCCACATCGCCATTGGACCCAATCCTCCTATTCCCATACCCGTAGGGGG
JMFF031F18+ TTCCCATACCCGTAGGGGG
                      ____________________________________________________________
consensus ACTCAATCCAACCCACATCGCCATTGGACCCAATCCTCCTATTCCCATACCCGTAGGGGG
 
. : . : . : . : . : . :
JMFN015E16+ TAGGGGGCCCAGCTTTATCCTTCTCATGCTGGGGCAAACCAAAGAATTTCACAGCTTCAC
JMFN020F07+ TAGGGGGCCCAGCTTTATCCTTCTCATGCTGGGGCAAACCAAAGAATTTCACAGCTTCAC
JMFN036B03+ TAGGGGGCCCAGCTTTATCCTTCTCATGCTGGGGCAAACCAAAGAATTTCACAGCTTCAC
JMFF029G16+ TAGGGGGCCCAGCTTTATCCTTCTCATGCTGGGGCAAACCAAAGAATTTCACAGCTTCAC
JMFF016J19+ TAGGGGGCCCAGCTTTATCCTTCTCATGCTGGGGCAAACCAAAGAATTTCACAGCTTCAC
JMFF005N14+ TAGGGGGCCCAGCTTTATCCTTCTCATGCTGGGGCAAACCAAAGAATTTCACAGCTTCAC
JMFF016L08+ TAGGGGGCCCAGCTTTATCCTTCTCATGCTGGGGCAAACCAAAGAATTTCACAGCTTCAC
JMFF013G19+ TAGGGGGCCCAGCTTTATCCTTCTCATGCTGGGGCAAACCAAAGAATTTCACAGCTTCAC
JMFF043N05+ TAGGGGGCCCAGCTTTATCCTTCTCATGCTGGGGCAAACCAAAGAATTTCACAGCTTCAC
JMFF031F18+ TAGGGGGCCCAGCTTTATCCTTCTCATGCTGGGGCAAACCAAAGAATTTCACAGCTTCAC
                      ____________________________________________________________
consensus TAGGGGGCCCAGCTTTATCCTTCTCATGCTGGGGCAAACCAAAGAATTTCACAGCTTCAC
 
. : . : . : . : . : . :
JMFN015E16+ TTTCCAATTTCGCCATGGCCTCCATGGGAACTCCATGGTTGACCACCTTGAAGAACCCAA
JMFN020F07+ TTTCCAATTTCGCCATGGCCTCCATGGGAACTCCATGGTTGACCACCTTGAAGAACCCAA
JMFN036B03+ TTTCCAATTTCGCCATGGCCTCCATGGGAACTCCATGGTTGACCACCTTGAAGAACCCAA
JMFF029G16+ TTTCCAATTTCGCCATGGCCTCCATGGGAACTCCATGGTTGACCACCTTGAAGNACCCAA
JMFF016J19+ TTTCCAATTTCGTCATGGCCTCCATGGGAACTCCATGGTTGACCACCTTGAAGAACCCAA
JMFF005N14+ TTTCCAATTTCGCCATGGCCTCCATGGGAACTCCATGGTTGACCACCTTGAAGAACCCAA
JMFF016L08+ TTTCCAATTTCGCCATGGCCTCCATGGGAACTCCATGGTTGACCACCTTGAAGAACCCAA
JMFF013G19+ TTTCCAATTTCGCCATGGCCTCCATGGGAACTCCATGGTTGACCACCTTGAAGAACCCAA
JMFF043N05+ TTTCCAATTTCGCCATGGCCTCCATGGGAACTCCATGGTTGACCACCTTGAAGAACCCAA
JMFF031F18+ TTTCCAATTTCGCCATGGCCTCCATGGGAACTCCATGGTTGACCACCTTGAAGAACCCAA
                      ____________________________________________________________
consensus TTTCCAATTTCGCCATGGCCTCCATGGGAACTCCATGGTTGACCACCTTGAAGAACCCAA
 
. : . : . : . : . : . :
JMFN015E16+ ACTCCTGGCAAGCCTTCACAATCTGGGTTTTAGCCTCCGGGTCAAGAAGA
JMFN020F07+ ACTCCTGGCAAGCCTT-ACAATCTGGGTTTTAGCCTCCGGGTCAAGAAGATCTATCACCG
JMFN036B03+ ACTCCTGGCAAGCCTTCACAATCTGGGTTTTAGCCTCCGGGTCAAGAAGATCTATCACCG
JMFF029G16+ ACTCCTGGCAAGCCTTCACAATCTGGGTTTTAGCCTCCGGGTCAAGAAGATCTATCACCG
JMFF016J19+ ACTCCTGGCAAGCCTTCACAATCTGGGTTTTAGCCTCCGGGTCAAGAAGATCTATCACCG
JMFF005N14+ ACTCCTGGCAAGCCTTCACAATCTGGGTTTTAGCCTCCGGGTCAAGAAGATCTATCACCG
JMFF016L08+ ACTCCTGGCAAGCCTTCACAATCTGGGTTTTAGCCTCCGGGTCAAGAAGATCTATCACCG
JMFF013G19+ ACTCCTGGCAAGCCTTCACAATCTGGGTTTTAGCCTCCGGGTCAAGAAGATCTATCACCG
JMFF043N05+ ACTCCTGGCAAGCCTTCACAATCTGGGTTTTAGCCTCCGGGTCAAGAAGATCTATCACCG
JMFF031F18+ ACTCCTGGCAAGCCTTCACAATCTGGGTTTTAGCCTCCGGGTCAAGAAGATCTATCACCG
                      ____________________________________________________________
consensus ACTCCTGGCAAGCCTTCACAATCTGGGTTTTAGCCTCCGGGTCAAGAAGATCTATCACCG
 
. : . : . : . : . : . :
JMFN020F07+ GAATCCCGCCGAACGCCGCCGTGTTGGATTTGCACGCTTTGACCAGCGAGAAATCCTCAA
JMFN036B03+ GAATCCCGCCGAACGCCGCCGTGTTGGATTTGCACGCTTTGACCAGCGAGAAATCCTCAA
JMFF029G16+ GAATCCCGCCGAACGCCGCCGTGTTGGATTTGCACGCTTTGACCAGCGAGAAACCCTCAA
JMFF016J19+ GAATCCCGCCGAACGCCGCCGTGTTGGATTTGCACGCTTTGACCAGCGAGAAATCCTCAA
JMFF005N14+ GAATCCCGCCGAACGCCGCCGTGTTGGATTCGCACGCTTTGACCAGCGAGAAATCCTCAA
JMFF016L08+ GAATCCCGCCGAACGCCGCCGTGTTGGATTTGCACGCTTTGACCAGCGAGAAATCCTCAA
JMFF013G19+ GAATCCCGCCGAACGCCGCCGTGTTGGATTTGCACGCTTTGACCAGCGAGAAACCCTCAA
JMFF043N05+ GAATCCCGCCGAACGCCGCCGTGTTGGATTTGCACGCTTTGACCAGCGAGAAATCCTCAA
JMFF031F18+ GAATCCCGCCGAACGCCGCCGTGTTGGATTTGCACGCTTTGACCAGCGAGAAATCCTCAA
                      ____________________________________________________________
consensus GAATCCCGCCGAACGCCGCCGTGTTGGATTTGCACGCTTTGACCAGCGAGAAATCCTCAA
 
. : . : . : . : . : . :
JMFN020F07+ GAATTGGCTGAGACAAAACCACCATGGCTACCAGAAAAACAGAGGGCAACAACGTTTTAG
JMFN036B03+ GAATTGGCTGAGACAAAACCACCATGGCTACCAGAAAAACAGAGGGCAACAACGTTTTAG
JMFF029G16+ GAATTGGCTGAGACAAAACCACCATGGCTACCAGAAAAACAGAGGGCAACAACGTTTTAG
JMFF016J19+ GAATTGGCTGAGACAAAACCACCATGGCTACCAGAAAAACAGAGGGCAACAACGTTTTAG
JMFF005N14+ GAATTGGCTGAGACAAAACCACCATGGCTACCAGAAAAACAGAGGGCAACAACGTTTTAG
JMFF016L08+ GAATTGGCTGAGACAAAACCACCATGGCTACCAGAAAAACAGAGGGCAACAACGTTTTAG
JMFF029O03+ CCAGAAAAACAGAGGGCAACAACGTTTTAG
JMFF013G19+ GAATTGGCTGAGACAAAACCACCATGGCTACCAGAAAAACAGAGGGCAACAACGTTTTAG
JMFF043N05+ GAATTGGCTGAGACAAAACCACCATGGCTACCAGAAAAACAGAGGGCAACAACGTTTTAG
JMFF031F18+ GAATTGGCTGAGACAAAACCACCATGGCTACCAGAAAAACAGAGGGCAACAACGTTTTAG
                      ____________________________________________________________
consensus GAATTGGCTGAGACAAAACCACCATGGCTACCAGAAAAACAGAGGGCAACAACGTTTTAG
 
. : . : . : . : . : . :
JMFN020F07+ TTTAATTTCTTAGCGGATTTTAAGATTGGG-TTTTGGAACTAACAAAGAAGAGTTTCCGG
JMFN036B03+ TTTAATTTCTTAGCGGATTTTAAGATTGGGTTTTTGGAACTAACAAAGAAGAGTTTCCGG
JMFF029G16+ TTTAATTTCTTAGCGGATTTTAAGATTGGGTTTTTGGAACTAACAAAGAAGAGTTTCCGG
JMFF016J19+ TTTAATTTCTTAGCGGATTTTAAGATTGGGTTTTTGGAACTAACAAAGAAGAGTTTCCGG
JMFF005N14+ TTTAATTTCTTAGCGGATTTTAAGATTGGGTTTTTGGAACTAACAAAGAAGAGTTTCCGG
JMFF016L08+ TTTAATTTCTTAGCGGATTTTAAGATTGGGTTTTTGGAACTAACAAAGAAGAGTTTCCGG
JMFF029O03+ TTTAATTTCTTAGCGGATTTTAAGATTGGGTTTTTGGAACTAACAAAGAAGAGTTTCCGG
JMFF013G19+ TTTAATTTCTTAGCGGATTTTAAGATTGGGTTTTTGGAACTAACAAAGAAGAGTTTCCGG
JMFF043N05+ TTTAATTTCTTAGCGGATTTTAAGATTGGGTTTTTGGAACTAACAAAGAAGAGTTTCCGG
JMFF031F18+ TTTAATTTCTTAGCGGATTTTAAGATTGGGTTTTTGGAACTAACAAAGAAGAGTTTCCGG
                      ____________________________________________________________
consensus TTTAATTTCTTAGCGGATTTTAAGATTGGGTTTTTGGAACTAACAAAGAAGAGTTTCCGG
 
. : . : . : . : . : . :
JMFN020F07+ AA
JMFN036B03+ AAACTGTCGATGAAGTTTGAGAAGGAAACGGTACGGAGTTTAAATGGACAAATGGTAATG
JMFF029G16+ AAACTGTCGATGAAGTTTGAGAAGGAAACGGTACGGAGTTTAAATGGACAAATGGTAATG
JMFF016J19+ AAACTGTCGATGAAGTTTGAGAAGGAAACGGTACGGAGTTTAAATGGACAAATGGTAATG
JMFF005N14+ AAACTGTCGATGAAGTTTGAGAAGGAAACGGTACGGAGTTTAAATGGACAAATGGTAATG
JMFF016L08+ AAACTGTCGATGAAGTTTGAGAAGGAAACGGTACGGAGTTTAAATGGACAAATGGTAATG
JMFF029O03+ AAACTGTCGATGAAGTTTGAGAAGGAAACGGTACGGAGTTTAAATGGACAAATGGTAATG
JMFF013G19+ AAACTGTCGATGAAGTTTGAGAAGGAAACGGTACGGAGTTTAAATGGACAAATGGTAATG
JMFF043N05+ AAACTGTCGATGAAGTTTGAGAAGGAAACGGTACGGAGTTTAAATGGACAAATGGTAATG
JMFF031F18+ AAACTGTCGATGAAGTTTGAGAAGGAAACGGTACGGAGTTTAAATGGACAAATGGTAATG
                      ____________________________________________________________
consensus AAACTGTCGATGAAGTTTGAGAAGGAAACGGTACGGAGTTTAAATGGACAAATGGTAATG
 
. : . : . : . : . : . :
JMFN036B03+ CATGA
JMFF029G16+ CATGAGAGAGCTAAGAGGCGTTAGAAACTATAGTGAGAAGAAGCCATCTGGC
JMFF016J19+ CATGAGAGAGCTAAGAGGCGTTAGAAACTATAGTGAGAAGAAGCCATCT
JMFF005N14+ CATGAGAGAGCTAAGAGGCGTTAGAAACTATAGTGAGAAGAAGCCATCT
JMFF016L08+ CATGAGAGAGCTAAGAGGCGTTAGAAACTATAGTGAGAAGAAGCCATCTGGC
JMFF029O03+ CATGAGAGAGCTAAGAGGCGTTAGAAACTATAGTGAGAAGAAGCCATCTG
JMFF013G19+ CATGAGAGAGCTAAGAGGCGTTAGAAACTATAGTGAGAAGAAGCCATCTGGC
JMFF043N05+ CATGAGAGAGCTAAGAGGCGTTAGAAACTATAGTGAGAAGAAGCCATCTGGC
JMFF031F18+ CATGAGAGAGCTAAGAGGCGTTAGAAACTATAGTGAGAAGAAGCCATCTGGCATCGATGA
                      ____________________________________________________________
consensus CATGAGAGAGCTAAGAGGCGTTAGAAACTATAGTGAGAAGAAGCCATCTGGCATCGATGA