Previous Contig 001416:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF017K11Sequence516001416 (3)gb:AY140038_15824782e-72Arabidopsis thaliana Ca2+-dependent lipid-binding protein, putative (At1g05500)
JMFF031C22Sequence589001416 (3)gb:AY140038_15824782e-43Arabidopsis thaliana Ca2+-dependent lipid-binding protein, putative (At1g05500) 789009658 (2)gb:AP004458_18412816e-74Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P004
JMSF045E23Sequence668001416 (3)gb:AY140038_15824785e-49Arabidopsis thaliana Ca2+-dependent lipid-binding protein, putative (At1g05500) 723009658 (2)gb:AP004458_18412813e-67Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P004

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF017K11+ ATACAGCTCCAAAGCAAGGAAGCTCTTCTACAAGTGGACG
                      ____________________________________________________________
consensus ATACAGCTCCAAAGCAAGGAAGCTCTTCTACAAGTGGACG
 
. : . : . : . : . : . :
JMFF017K11+ AAAGATCAGCCTG-AAAACCCCAGTAAAACCAATGTTTTTCACCTGCACTGGTAGTGCGA
JMSF045E23+ AAGATCAGCCTGAAAAACCCCTGTAAACCCAATGTTTTTCACCTGCACAGGTAGTGCAA
                      ____________________________________________________________
consensus AAAGATCAGCCTGAAAAACCCCTGTAAACCCAATGTTTTTCACCTGCACTGGTAGTGCGA
 
. : . : . : . : . : . :
JMFF017K11+ CACCGAGGTAAGTCTTAATATCAAGTACTATATTAGGATTTCCATCCCATTGCATCTCTA
JMSF045E23+ CACCGAGATAAGTCTTAATATCAAGTATTATACTCGGATTTCCATCCCACTGCACCTGTA
                      ____________________________________________________________
consensus CACCGAGGTAAGTCTTAATATCAAGTATTATATTCGGATTTCCATCCCATTGCATCTGTA
 
. : . : . : . : . : . :
JMFF017K11+ ACTCCATAGTAATACCATCACTTCCATCTTCGACGATAGAAATCCCTGTAAATTGTGGAG
JMSF045E23+ ACTCGATGGTAATCCCTTCACTTCCATCTTCAATGATAGAAATTCCTGTGCACTGTGGGG
JMFF031C22+ ATCCCTTCACTTCCATCTTCAATGATAGAAATTCCTGTGCACTGTGGGG
                      ____________________________________________________________
consensus ACTCGATGGTAATCCCTTCACTTCCATCTTCAATGATAGAAATTCCTGTGCACTGTGGGG
 
. : . : . : . : . : . :
JMFF017K11+ CAACAGTGCCAAGAGTGAACTTTGAAAACTTCAATGAGGCTAAAACCACAGGTCGGTATG
JMSF045E23+ CAACAGTACCAAGAGTGAACCTTGAAAATTTCAATGATGCCAAAATCACTGGCCTGTATG
JMFF031C22+ CAACAGTACCAAGAGTGAACCTTGAAAATTTCAATGATGCCAAAATCACTGGCCTGTATG
                      ____________________________________________________________
consensus CAACAGTACCAAGAGTGAACCTTGAAAATTTCAATGATGCCAAAATCACTGGCCTGTATG
 
. : . : . : . : . : . :
JMFF017K11+ ATTCCAGAACTGGCTCTACATTCATCTTAATCAA
JMSF045E23+ ATTCCAGAACAGGCTCGACGTTCATCTTAATCAACTCCGACGCCGCC---TTCTGGTA--
JMFF031C22+ ATTCCAGAACAGGCTCGACGTTCATCTTAATCAACTCCGACGCCGCCTCATTCACGTATG
                      ____________________________________________________________
consensus ATTCCAGAACAGGCTCGACGTTCATCTTAATCAACTCCGACGCCGCCTCATTCTGGTATG
 
. : . : . : . : . : . :
JMSF045E23+ ---------CTTAGAGAAGAC-------------AACCCAAGAAGGGTACTGGTCAGGGG
JMFF031C22+ GCCAGATCTTTTCGAGATGACTATTTAGCCACTTCAACCAAGAAGGGTACTGGTCAGGGG
                      ____________________________________________________________
consensus GCCAGATCTTTTCGAGATGACTATTTAGCCACTTCACCCAAGAAGGGTACTGGTCAGGGG
 
. : . : . : . : . : . :
JMSF045E23+ TGAAGATCTTTCTGGAATCTTCCACGCTCATTCTTGCATACGCCGCAACCGTAGTAGCCA
JMFF031C22+ TGAAGATCTTTCTGGAATCTTCCACGCTCATTCTTGCATACGCCGCAACCGTAGTAGCCA
                      ____________________________________________________________
consensus TGAAGATCTTTCTGGAATCTTCCACGCTCATTCTTGCATACGCCGCAACCGTAGTAGCCA
 
. : . : . : . : . : . :
JMSF045E23+ GTTCACAACGGCGTTTGGACCGACTGTTTTCCGACTTCACAAACGCGATAACTAAAGCCA
JMFF031C22+ GTTCACAACGGCGTTTGGACCGACTGTTTTCCGACTTCACAAACGCGATAACTAAAGCCA
                      ____________________________________________________________
consensus GTTCACAACGGCGTTTGGACCGACTGTTTTCCGACTTCACAAACGCGATAACTAAAGCCA
 
. : . : . : . : . : . :
JMSF045E23+ ACCCGAATGCGATTCCGATCACTATTCCAAACAAAAACGCCATCTTTGGGCCTCTGAAAG
JMFF031C22+ ACCCGAATGCGATTCCGATCACTATTCCAAACAAAAACGCCATCTTTGGGCCTCTGAAAG
                      ____________________________________________________________
consensus ACCCGAATGCGATTCCGATCACTATTCCAAACAAAAACGCCATCTTTGGGCCTCTGAAAG
 
. : . : . : . : . : . :
JMSF045E23+ ACTCTATGGAGTGAATTGAAGTCCTTGGAAGAGTGAAGTGCTTTCTGGCGATTACTGATT
JMFF031C22+ ACTCTATGGAGTGAATTGAAGTCCTTGGAAGAGTGAAGTGCTTTCTGGCGATTACTGATT
                      ____________________________________________________________
consensus ACTCTATGGAGTGAATTGAAGTCCTTGGAAGAGTGAAGTGCTTTCTGGCGATTACTGATT
 
. : . : . : . : . : . :
JMSF045E23+ ATGGGGTATTAGAGTTGGCGAAATGAGTGGATTTTGGTCGTTGTAATCAAAGGATTTGCG
JMFF031C22+ ATGGGGTATTAGAGTTGGCGAAATGAGTGGATTTTGGTCGTTGTAATCAAAGGATTTGCG
                      ____________________________________________________________
consensus ATGGGGTATTAGAGTTGGCGAAATGAGTGGATTTTGGTCGTTGTAATCAAAGGATTTGCG
 
. : . : . : . : . : . :
JMSF045E23+ CGGCCAAAAGCGCGAATTCTGTT
JMFF031C22+ CGGCCAAAAGCGCGAATTCTGTTGCCAGAAAGCGAAAAGATGAAAAGGATGCATGGCTGC
                      ____________________________________________________________
consensus CGGCCAAAAGCGCGAATTCTGTTGCCAGAAAGCGAAAAGATGAAAAGGATGCATGGCTGC