Previous Contig 001413:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF018G11Sequence494001413 (7)gb:AY088773_15737852e-43Arabidopsis thaliana clone 948 mRNA, complete sequence.682001413 (7)gb:AY088773_15737855e-47Arabidopsis thaliana clone 948 mRNA, complete sequence.
JMFF031C06Sequence585001413 (7)gb:AY088773_15737851e-41Arabidopsis thaliana clone 948 mRNA, complete sequence.834021348
JMFN035M12Sequence584001413 (7)gb:AY088773_15737853e-45Arabidopsis thaliana clone 948 mRNA, complete sequence.
JMFS095D02Sequence611001413 (7)gb:AY088773_15737859e-47Arabidopsis thaliana clone 948 mRNA, complete sequence.
JMSF041F09Sequence251001413 (7)gb:AP005909_18599301e-15Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OSJN623001413 (7)gb:AY088773_15737852e-42Arabidopsis thaliana clone 948 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF041F09- TCATTCTTGCTCTTTCCGGATGACTTCACCTTA
JMFS095D02+ TTCCGGATGACTTCACCTTA
rJMFF018G11- TTCTTGCTCTTTCCGGATGACTTCACCTTA
                      ____________________________________________________________
consensus TCATTCTTGCTCTTTCCGGATGACTTCACCTTA
 
. : . : . : . : . : . :
rJMSF041F09- CGACTAATCTTCTTTGTGTTCTTCCCATACTTCTCAGCAATTGCTCTTTCAATTTCAGAG
JMFS095D02+ CGACTAATCTTCTNTGTGTTCTTCCCATACTTCTCAGCAATTGCTCTTTCAATTTCAGAG
JMFN035M12+ G
rJMFF018G11- CGACTAATCTTCTTTGTGTTCTTCCCATACTTCTCAGCAATTGCTCTTTCAATTTCAGAG
                      ____________________________________________________________
consensus CGACTAATCTTCTTTGTGTTCTTCCCATACTTCTCAGCAATTGCTCTTTCAATTTCAGAG
 
. : . : . : . : . : . :
rJMSF041F09- TCGTACCCTGAATCTGAACTCTCACTCTCCTCTTCTTCACTACTCTCCTCACTCTCAGCA
JMFS095D02+ TCGTACCCTGAATCTGAACTCTCACTCTCCTCTTCTTCACTACTCTCCTCACTCTCAGCA
JMFN035M12+ TCGTACCCTGAATCTGAACTCTCACTCTCCTCTTCTTCACTACTCTCCTCACTCTCAGCA
rJMFF018G11- TCGTACCCTGAATCTGAACTCTCACTCTCCTCTTCTTCACTACTCTCCTCACTCTCAGCA
JMFF031C06+ GAACTCTCACTCTCCTCTTCTTCACTACTCTCCTCACTCTCAGCA
                      ____________________________________________________________
consensus TCGTACCCTGAATCTGAACTCTCACTCTCCTCTTCTTCACTACTCTCCTCACTCTCAGCA
 
. : . : . : . : . : . :
rJMSF041F09- CTACCCTTCTTATCTCTGTTCCCCTTCCACTTCTCCAACCTAGACAAAACTGCTGCATC-
JMFS095D02+ CTACCCTTCTTATCTCTGTTCCCCTTCCACTTCTCCAACCTAGACAAAACTGCTGCATC-
JMFN035M12+ CTACCCTTCTTATCTCTGTTCCCCTTCCACTTCTCCAACCTAGACAAAACTGCTGCATC-
rJMFF018G11- CTACCCTTCTTATCTCTGTTCCCCTTCCACTTCTCCAACCTAGACAAAACTGCTGCATC-
JMFF018G11+ CCTAGACAAAACTGCTGCATC-
JMFF031C06+ CTACCCTTCTTATCTCTGTTCCCCTTCCACTTCTCCAACCTAGACAAAACTGCTGCATCG
                      ____________________________________________________________
consensus CTACCCTTCTTATCTCTGTTCCCCTTCCACTTCTCCAACCTAGACAAAACTGCTGCATC-
 
. : . : . : . : . : . :
rJMSF041F09- GATTCCCTCCTCATCCTTGTCTTTACCACTGTCCTCCTTAACACTCAAGAAATTTCTACA
JMFS095D02+ GATTCCCTCCTCATCCTTGTCTTTACCACTGTCCTCCTTAACACTCAAGAAATTTCTACA
JMFN035M12+ GATTCCCTCCTCATCCTTGTCTTTACCACTGTCCTCCTTAACACTCAAGAAATTTCTACA
rJMFF018G11- GATTCCCTCCTCATCCTTGTCTTTACCACTGTCCTCCTTAACACTCAAGAAATTTCTACA
JMFF018G11+ GATTCCCTCCTCATCCTTGTCTTTACCACTGTCCTCCTTAACACTCAAGAAATTTCTACA
JMFF031C06+ GATTCCCTCCTCATCCTTGTCTTTACCACTGTCCTCCTTAACACTCAAGAAATTTCTACA
                      ____________________________________________________________
consensus GATTCCCTCCTCATCCTTGTCTTTACCACTGTCCTCCTTAACACTCAAGAAATTTCTACA
 
. : . : . : . : . : . :
rJMSF041F09- CTGATAAGTTAGGTGCCCAACTCGCCCACACTTCTTGCATGATCCACGAGCCTCATCAGC
JMFS095D02+ CTGATAAGTTAGGTGCCCAACTCGCCCACACTTCTTGCATGATCCACGAGCCTCATCAGC
JMFN035M12+ CTGATAAGTTAGGTGCCCAACTCGCCCACACTTCTTGCATGATCCACGAGCCTCATCAGC
rJMFF018G11- CTGATAAGTTAGGTGCCCAACTCGCCCACACTTCTTGCATGATCCACGAGCCTCATCAGC
JMFF018G11+ CTGATAAGTTAGGTGCCCAACTCGCCCACACTTNTTGCATGATCCACGAGCCTCATCAGC
JMFF031C06+ CTGATAAGTTAGGTGCCCAACTCGCCCACACTTCTTGCATGATCCACGAGCCTCATCAGC
                      ____________________________________________________________
consensus CTGATAAGTTAGGTGCCCAACTCGCCCACACTTCTTGCATGATCCACGAGCCTCATCAGC
 
. : . : . : . : . : . :
rJMSF041F09- ATTAGAACCAGTGATCCTAGCAAGCGCAAGCAAACCCTGAAAGTTGGCATAGGGATTATC
JMFS095D02+ ATTAGAACCAGTGATCCTAGCAAGCGCAAGCAAACCCTGAAAGTTGGCATAGGGATTATC
JMFN035M12+ ATTAGAACCAGTGATCCTAGCAAGCGCAAGCAAACCCTGAAAGTTGGCATAGGGATTATC
rJMFF018G11- ATTAGAACCAGTGATCCTAGCAAGCGCAAGCAAACCCTGAAAGTTGGCATAGGGATTATC
JMFF018G11+ ATTAGAACCAGTGATCCTAGCAAGCGCAAGCAAACCCTGAAAGTTGGCATAGGGATTATC
JMFF031C06+ ATTAGAACCAGTGATCCTAGCAAGCGCAAGCAAACCCTGAAAGTTGGCATAGGGATTATC
                      ____________________________________________________________
consensus ATTAGAACCAGTGATCCTAGCAAGCGCAAGCAAACCCTGAAAGTTGGCATAGGGATTATC
 
. : . : . : . : . : . :
rJMSF041F09- CGGCTCGGCAGCAGATTTTGGCGCANACTTCTTCNAATCATCCTTGTTGGGTGCATATGG
JMFS095D02+ CGGCTCGGCAGCAGATTTTGGCGCAGACTTCTTCGAATCATCCTTGTTGGGTGCATATGG
JMFN035M12+ CGGCTCGGCAGCAGATTTTGGCGCAGACTTCTTCGAATCATCCTTGTTGGGTGCATATGG
rJMFF018G11- CGGCTCGGCAGCAGATTTTGGCGCAGACTTCTTCGAATCATCCTTGTTGGGTGCATATGG
JMFF018G11+ CGGCTCGGCAGCAGATTTTGGCGCAGACTTCTTCGAATCATCCTTGTTGGGTGCATATGG
JMSF041F09+ TGGGTGCATATGG
JMFF031C06+ CGGCTCGGCAGCAGATTTTGGCGCAGACTTCTTCGAATCATCCTTGTTGGGTGCATATGG
                      ____________________________________________________________
consensus CGGCTCGGCAGCAGATTTTGGCGCAGACTTCTTCGAATCATCCTTGTTGGGTGCATATGG
 
. : . : . : . : . : . :
rJMSF041F09- GTCATACCCAATTGCACTTTGNCAGATACCATGGGTCTGTAGGGCAGCACTACTGTGCAC
JMFS095D02+ GTCATACCCAATTGCACTTTGCCAGATACCATGGGTCTGTAGGGCAGCACTACTGTGCAC
JMFN035M12+ GTCATACCCAATTGCACTTTGCCAGATACCATGGGTCTGTAGGGCAGCACTACTGTGCAC
rJMFF018G11- GTCATACCCAATTGCACTTTGCCAGATACCATGGGTCTGTAGGGCAGCACTACTGTGCAC
JMFF018G11+ GTCATACCCAATTGCACTTTGCCAGATACCATGGGTCTGTAGGGCAGCACTACTGTGCAC
JMSF041F09+ GTCATACCCAATTGCACTTTGCCAGATACCATGGGTNTGTAGGGCAGCACTACTGTGCAC
JMFF031C06+ GTCATACCCAATTGCACTTTGCCAGATACCATGGGTCTGTAGGGCAGCACTACTGTGCAC
                      ____________________________________________________________
consensus GTCATACCCAATTGCACTTTGCCAGATACCATGGGTCTGTAGGGCAGCACTACTGTGCAC
 
. : . : . : . : . : . :
rJMSF041F09- CCGATTGTTCGCCGGCATGCGAACTCTTCCTGCTGTCGCCGGCATTTTGATATTTTATCT
JMFS095D02+ CCGATTGTTCGCCGGCATGCGAACTCTTCCTGCTGTCGCCGGCATTTTGATATTTTATCT
JMFN035M12+ CCGATTGTTCGCCGGCATGCGAACTCTTCCTGCTGTCGCCGGCATTTTGATATTTTATCT
rJMFF018G11- CCGATTGTTCGCCGGCATGCGAACTCTTCCTGCTGTCGCCGGCATTTTGATATTTTATCT
JMFF018G11+ CCGATTGTTCGCCGGCATGCGAACTCTTCCTGCTGTCGCCGGCATTTTGATATTTTATCT
JMSF041F09+ CCGATTGTTCGCCGGCATGCGAACTCTTCCTGCTGTCGCCGGCATTTTGATATTTTATCT
JMFF031C06+ CCGATTGTTCGCCGGCATGCGAACTCTTCCTGCTGTCGCCGGCATTTTGATATTTTATCT
                      ____________________________________________________________
consensus CCGATTGTTCGCCGGCATGCGAACTCTTCCTGCTGTCGCCGGCATTTTGATATTTTATCT
 
. : . : . : . : . : . :
rJMSF041F09- AAAACCCTTGGCTGACNAGTAAACTGAGAGAGCTGTGATCAGATCAACCGA
JMFS095D02+ AAAACCCTTGGCTGACAAGTAAACTGAGAGAGCTGTGATCAGATCAACCGAC
JMFN035M12+ AAAACCCTTGGCTGACAAGTAAACTGAGAGAGCTGTGATCAGATCAACCGACTATGATGA
rJMFF018G11- AAAACCCTTGGCTGACAAGTAAACTGAGAGAGCTGTGATCAGATCAACCGACTATGATGA
JMFF018G11+ AAAACCCTTGGCTGACAAGTAAACTGAGAGAGCTGTGATCAGATCAACCGACTATGATGA
JMSF041F09+ AAAACCCTTGGCTGACAAGTAAACTGAGAGAGCTGTGATCAGATCAACCGACTATGATGA
JMFF031C06+ AAAACCCTTGGCTGACAAGTAAACTGAGAGAGCTGTGATCAGATCAACCGACTATGATGA
                      ____________________________________________________________
consensus AAAACCCTTGGCTGACAAGTAAACTGAGAGAGCTGTGATCAGATCAACCGACTATGATGA
 
. : . : . : . : . : . :
JMFN035M12+ TCAAACGCCGAAACACGAGAGCGAAGGAGACGACGAGGAACTGA
rJMFF018G11- TCAAACGCCGAAACACGAGAGCGAAGGAGACGACGAGGAACTGAGGAAGCAAT
JMFF018G11+ TCAAACGCCGAAACACGAGAGCGAAGGAGACGACGAGGAACTGAGGAAGCAAT
JMSF041F09+ TCAAACGCCGAAACACGAGAGCGAAGGAGACGACGAGGAACTGAGGAAGCAAT
JMFF031C06+ TCAAACGCCGAAACACGAGAGCGAAGGAGACGACGAGGAACTGAGGAAGCAATGGAATTT
                      ____________________________________________________________
consensus TCAAACGCCGAAACACGAGAGCGAAGGAGACGACGAGGAACTGAGGAAGCAATGGAATTT