Previous Contig 001412:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001L13Sequence536001412 (14)gb:AY498745_11784715e-84Capsicum annuum 60S ribosomal protein L13a (RpL13a) mRNA, complete cds.664001412 (14)sp|Q9LRX8|R1AB_ARATH4e-8960S ribosomal protein L13a-2.>gb:AB028609_1517921 Arabidopsis thaliana genomic D
JMFF031B18Sequence553001412 (14)gb:AY498745_11784712e-86Capsicum annuum 60S ribosomal protein L13a (RpL13a) mRNA, complete cds.688001412 (14)sp|Q9LRX8|R1AB_ARATH3e-9960S ribosomal protein L13a-2.>gb:AB028609_1517921 Arabidopsis thaliana genomic D
JMFF034H09Sequence533001412 (14)gb:AY498745_11784712e-84Capsicum annuum 60S ribosomal protein L13a (RpL13a) mRNA, complete cds.626001412 (14)sp|Q9LRX8|R1AB_ARATH1e-7660S ribosomal protein L13a-2.>gb:AB028609_1517921 Arabidopsis thaliana genomic D
JMFN005I11Sequence593001412 (14)gb:AY498745_11784712e-95Capsicum annuum 60S ribosomal protein L13a (RpL13a) mRNA, complete cds.
JMSF005E17Sequence427004694 (5)gb:AP002057_18217317e-21Arabidopsis thaliana genomic DNA, chromosome 3, BAC clone: T19N8.152001412 (14)
JMSF005G19Sequence201001412 (14)
JMSF016B15Sequence340001412 (14)gb:AY846823_16307245e-46Triticum aestivum ribosomal protein L13a mRNA, complete cds.792001412 (14)sp|Q9LRX8|R1AB_ARATHe-10460S ribosomal protein L13a-2.>gb:AB028609_1517921 Arabidopsis thaliana genomic D
JMSF038G08Sequence624001412 (14)gb:AY498745_11784712e-97Capsicum annuum 60S ribosomal protein L13a (RpL13a) mRNA, complete cds.779001412 (14)sp|Q9LRX8|R1AB_ARATHe-10460S ribosomal protein L13a-2.>gb:AB028609_1517921 Arabidopsis thaliana genomic D
JMSF046H18Sequence228001412 (14)gb:AY846823_16307249e-21Triticum aestivum ribosomal protein L13a mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF005G19+ TT
                      ____________________________________________________________
consensus TT
 
. : . : . : . : . : . :
rJMSF005E17- TGTACCACA
JMSF005G19+ TTTTTTTTAACAGCTTCAAGCAAATAATTTGTCACAT-GTAACACAAAAATTGTACCACA
rJMFF001L13- ATTTGTCACAT-GTAACACAAAAATTGTACCACA
rJMSF016B15- ATTTGTCACATGGTAACACAAAAATTGTACCACA
rJMSF038G08- CACA
                      ____________________________________________________________
consensus TTTTTTTTAACAGCTTCAAGCAAATAATTTGTCACAT-GTAACACAAAAATTGTACCACA
 
. : . : . : . : . : . :
rJMSF005E17- GGCCACAAGAAAAATGTTCCACNTCAATACCATTGTCTCTGAAATTCCAAGGCTACTTAA
JMSF005G19+ -GCCACAAG-AAAATGTTCCAC-TCAATACCATTGTCTCTGAAATTCCAAGGCTACTTAA
rJMFF031B18- GCCACAAG-AAAATGTTCCAC-TCAATACCATTGTCTCTGAAATTCCAAGGCTACTTAA
rJMFF001L13- -GCCACAAG-AAAATGTTCCAC-TCAATACCATTGTCTCTGAAATTCCAAGGCTACTTAA
rJMSF016B15- -GCCACAAG-AAAATGTTCCAC-TCAATACCATTGTCTCTGAAATTCCAAGGCTACTTAA
rJMSF038G08- -GCCACAAG-AAAATGTTCCAC-TCAATACCATTGTCTCTGAAATTCCAAGGCTACTTAA
                      ____________________________________________________________
consensus -GCCACAAG-AAAATGTTCCAC-TCAATACCATTGTCTCTGAAATTCCAAGGCTACTTAA
 
. : . : . : . : . : . :
rJMSF005E17- TACTATATTTAAGATTTAGGATCTACTAACTCAATTTAGTACTTCACTGAGGATAAGATG
JMSF005G19+ TACTATATTTAAGATTTAGGATCTACTAACTCAATTTAGTACTTCACTGAGGATAAGATG
rJMFF031B18- TACTATATTTAAGATTTAGGATCTACTAACTCAATTTAGTACTTCACTGAGGATAAGATG
rJMFF034H09- GATG
rJMFF001L13- TACTATATTTAAGATTTAGGATCTACTAACTCAATTTAGTACTTCACTGAGGATAAGATG
rJMSF016B15- TACTATATTTAAGATTTAGGATCTACTAACTCAATTTAGTACTTCACTGAGGATAAGATG
rJMSF038G08- TACTATATTTAAGATTTAGGATCTACTAACTCAATTTAGTACTTCACTGAGGATAAGATG
                      ____________________________________________________________
consensus TACTATATTTAAGATTTAGGATCTACTAACTCAATTTAGTACTTCACTGAGGATAAGATG
 
. : . : . : . : . : . :
rJMSF005E17- TCAAGTTGGGTACCCAGTCTC
JMSF005G19+ TCAAGTTGGGTACCCAGTCTC
rJMFF031B18- TCAAGTTGGGTACCCAGTCTCTCCTCTGCAGCCTTCTCAGCTTTGACCCTAAGCTTTGTC
rJMFF034H09- TCAAGTTGGGTACCCAGTCTCTCCTCTGCAGCCTTCTCAGCTTTGACCCTAAGCTTTGTC
rJMFF001L13- TCAAGTTGGGTACCCAGTCTCTCCTCTGCAGCCTTCTCAGCTTTGACCCTAAGCTTTGTC
rJMSF016B15- TCAAGTTGGGTACCCAGTCTCTCCTCTGCAGCCTTCTCAGCTTTGACCCTAAGCTTTGTC
JMFN005I11+ AAGCTTTGTC
rJMSF038G08- TCAAGTTGGGTACCCAGTCTCTCCTCTGCAGCCTTCTCAGCTTTGACCCTAAGCTTTGTC
JMSF038G08+ TCTCAGCTTTGACCNTAAGCTTTGTC
                      ____________________________________________________________
consensus TCAAGTTGGGTACCCAGTCTCTCCTCTGCAGCCTTCTCAGCTTTGACCCTAAGCTTTGTC
 
. : . : . : . : . : . :
rJMFF031B18- AACTGCTTCCTCCTCTCGTATGCAGCTTGGGCCCTCTCCTTCCTCTTATTCTCTAGAACC
rJMFF034H09- AACTGCTTCCTCCTCTCGTATGCAGCTTGGGCCCTCTCCTTCCTCTTATTCTCTAGAACC
rJMFF001L13- AACTGCTTCCTCCTCTCGTATGCAGCTTGGGCCCTCTCCTTCCTCTTATTCTCTAGAACC
rJMSF016B15- AACTGCTTCCTCCTCTCGTATGCAGCTTGGGCCCTCTCCTTCCTCTTATTCTCTAGAACC
JMFN005I11+ AACTGCTTCCTCCTCTCGTATGCAGCTTGGGCCCTCTCCTTCCTCTTATTCTCTAGAACC
rJMSF038G08- AACTGCTTCCTCCTCTCGTATGCAGCTTGGGCCCTCTCCTTCCTCTTATTCTCTAGAACC
JMSF038G08+ AACTGCTTCCTCCTCTCGTATGCAGCTTGGGCCCTCTCCTTCCTCTTATTCTCTAGAACC
JMFF031B18+ ATTCTCTAGAACC
                      ____________________________________________________________
consensus AACTGCTTCCTCCTCTCGTATGCAGCTTGGGCCCTCTCCTTCCTCTTATTCTCTAGAACC
 
. : . : . : . : . : . :
rJMFF031B18- TTGATGGTATCATAGTGGTTCCAGCCAACCTCAGATGAAAGCTTACCCAGCAGGCAGTAC
rJMFF034H09- TTGATGGTATCATAGTGGTTCCAGCCAACCTCAGATGAAAGCTTACCCAGCAGGCAGTAC
rJMFF001L13- TTGATGGTATCATAGTGGTTCCAGCCAACCTCAGATGAAAGCTTACCCAGCAGGCAGTAC
rJMSF016B15- TTGATGGTATCATAGTGGTTCCAGCCAACCTCAGATGAAAGCTTACCCAGCAGGCAGTAC
JMFN005I11+ TTGATGGTATCATAGTGGTTCCAGCCAACCTCAGATGAAAGCTTACCCAGCAGGCAGTAC
rJMSF038G08- TTGATGGTATCATAGTGGTTCCAGCCAACCTCAGATGAAAGCTTACCCAGCAGGCAGTAC
JMSF038G08+ TTGATGGTATCATAGTGGTTCCAGCCAACCTCAGATGAAAGCTTACCCAGCAGGCAGTAC
JMFF001L13+ GATGGTATCATAGTGGTTCCAGCCAACCTCAGATGAAAGCTTACCCAGCAGGCAGTAC
JMFF034H09+ GGTATCATAGTGGTTCCAGCCAACCTCAGATGAAAGCTTACCCAGCAGGCAGTAC
JMFF031B18+ TTGATGGTATCATAGTGGTTCCAGCCAACCTCAGATGAAAGCTTACCCAGCAGGCAGTAC
                      ____________________________________________________________
consensus TTGATGGTATCATAGTGGTTCCAGCCAACCTCAGATGAAAGCTTACCCAGCAGGCAGTAC
 
. : . : . : . : . : . :
rJMFF031B18- TTGTGCCCAGCCTGGAGCCTCAATACCTTGAGGGCATCAGGAATAACCATCCGCTTCACC
rJMFF034H09- TTGTGCCCAGCCTGGAGCCTCAATACCTTGAGGGCATCAGGAATAACCATCCGCTTCACC
rJMFF001L13- TTGTGCCCAGCCTGGAGCCTCAATACCTTGAGGGCATCAGGAATAACCATCCGCTTCACC
rJMSF016B15- TTGTGCCCAGCCTGGAGCCTCAATACCTTGAGGGCATCAGGAATAACCATCCGCTTCACC
JMFN005I11+ TTGTGCCCAGCCTGGAGCCTCAATACCTTGAGGGCATCAGGAATAACCATCCGCTTCACC
rJMSF038G08- TTGTGCCCAGCCTGGAGCCTCAATACCTTGAGGGCATCAGGAATAACCATCCGCTTCACC
JMSF038G08+ TTGTGCCCAGCCTGGAGCCTCAATACCTTGAGGGCATCAGGAATAACCATCCGCTTCACC
JMFF001L13+ TTGTGCCCAGCCTGGAGCCTCAATACCTTGAGGGCATCAGGAATAACCATCCGCTTCACC
JMFF034H09+ TTGTGCCCAGCCTGGAGCCTCAATACCTTGAGGGCATCAGGAATAACCATCCGCTTCACC
JMFF031B18+ TTGTGCCCAGCCTGGAGCCTCAATACCTTGAGGGCATCAGGAATAACCATCCGCTTCACC
                      ____________________________________________________________
consensus TTGTGCCCAGCCTGGAGCCTCAATACCTTGAGGGCATCAGGAATAACCATCCGCTTCACC
 
. : . : . : . : . : . :
rJMFF031B18- TTATCATACGGCGGAGGAACACCCTCGTACACCTTCAATCGAGCCAGCGCCGCAGCTCCT
rJMFF034H09- TTATCATACGGCGGAGGAACACCCTCGTACACCTTCAATCGAGCCAGCGCCGCAGCTCCT
rJMFF001L13- TTATCATACGGCGGAGGAACACCCTCGTACACCTTCAATCGAGCCAGCGCCGCAGCTCCT
rJMSF016B15- TTATCATACGGCGGAGGAACACCCTCGTACACCTTCAATCGAGCCAGCGCCGCAGCTCCT
JMFN005I11+ TTATCATACGGCGGAGGAACACCCTCGTACACCTTCAATCGAGCCAGCGCCGCAGCTCCT
rJMSF038G08- TTATCATACGGCGGAGGAACACCCTCGTACACCTTCAATCGAGCCAGCGCCGCAGCTCCT
JMSF038G08+ TTATCATACGGCGGAGGAACACCCTCGTACACCTTCAATCGAGCCAGCGCCGCAGCTCCT
JMFF001L13+ TTATCATACGGCGGAGGAACACCCTCGTACACCTTCAATCGAGCCAGCGCCGCAGCTCCT
JMFF034H09+ TTATCATACGGCGGAGGAACACCCTCGTACACCTTCAATCGAGCCAGCGCCGCAGCTCCT
JMFF031B18+ TTATCATACGGCGGAGGAACACCCTCGTACACCTTCAATCGAGCCAGCGCCGCAGCTCCT
                      ____________________________________________________________
consensus TTATCATACGGCGGAGGAACACCCTCGTACACCTTCAATCGAGCCAGCGCCGCAGCTCCT
 
. : . : . : . : . : . :
rJMFF031B18- CTCTTCGTCTTATGCGGAATCATTCCTCGGATGGTGCGCCAGAGGATCTTAGACGGTGCG
rJMFF034H09- CTCTTCGTCTTATGCGGAACCATTCCTCGGATGGTGCGCCAGAGGATCTTAGACGGTGCG
rJMFF001L13- CTCTTCGTCTTATGCGGAATCATTCCTCGGATGGTGCGCCAGAGGATCTTAGACGGTGCG
rJMSF016B15- CTCTTCGTCTTATGCGGAATCATTCCTCGGATGGTGCGCCAGAGGATCTTAGACGGTGCG
JMFN005I11+ CTCTTCGTCTTATGCGGAATCATTCCTCGGATGGTGCGCCAGAGGATCTTAGACGGTGCG
rJMSF038G08- CTCTTCGTCTTATGCGGAATCATTCCTCGGATGGTGCGCCAGAGGATCTTAGACGGTGCG
JMSF038G08+ CTCTTCGTCTTATGCGGAATCATTCCTCGGATGGTGCGCCAGAGGATCTTAGACGGTGCG
JMFF001L13+ CTCTTCGTCTTATGCGGAATCATTCCTCGGATGGTGCGCCAGAGGATCTTAGACGGTGCG
JMFF034H09+ CTCTTCGTCTTATGCGGAACCATTCCTCGGATGGTGCGCCAGAGGATCTTAGACGGTGCG
JMSF016B15+ GCGGAATCATTCCTCGGATGGTGCGCCAGAGGATCTTAGACGGTGCG
JMFF031B18+ CTCTTCGTCTTATGCGGAATCATTCCTCGGATGGTGCGCCAGAGGATCTTAGACGGTGCG
                      ____________________________________________________________
consensus CTCTTCGTCTTATGCGGAATCATTCCTCGGATGGTGCGCCAGAGGATCTTAGACGGTGCG
 
. : . : . : . : . : . :
rJMFF031B18- CGGAAGTGGATGGGGCCGTGGGAGGGCTTGGTGTTCATGCGCTTGCGGAGGAAGCGGTGA
rJMFF034H09- CGGAAGTGGATGGGGCCGTGGGAGGGCTTGGTGTTCATGCGCTTGCGGAGGAAGCGGTGA
rJMFF001L13- CGGAAGTGGATGGGGCCGTGGGAGGGCTTGGTGTTCATGCGCTTGCGGAGGAAGCGGTGA
rJMSF016B15- CGGAAGTGGATGGGGCCGTGGGAGGGCTTGGTGTTCATGCGCTTGCGGAGGAAGCGGTGA
JMFN005I11+ CGGAAGTGGATGGGGCCGTGGGAGGGCTTGGTGTTCATGCGCTTGCGGAGGAAGCGGTGA
rJMSF038G08- CGGAAGTGGATGGGGCCGTGGGAGGGCTTGGTGTTCATGCGCTTGCGGAGGAAGCGGTGA
JMSF038G08+ CGGAAGTGGATGGGGCCGTGGGAGGGCTTGGTGTTCATGCGCTTGCGGAGGAAGCGGTGA
JMFF001L13+ CGGAAGTGGATGGGGCCGTGGGAGGGCTTGGTGTTCATGCGCTTGCGGAGGAAGCGGTGA
JMFF034H09+ CGGAAGTGGATGGGGCCGTGGGAGGGCTTGGTGTTCATGCGCTTGCGGAGGAAGCGGTGA
JMSF016B15+ CGGAAGTGGATGGGGCCGTGGGAGGGCTTGGTGTTCATGCGCTTGCGGAGGAAGCGGTGA
JMFF031B18+ CGGAAGTGGATGGGGCCGTGGGAGGGCTTGGTGTTCATGCGCTTGCGGAGGAAGCGGTGA
                      ____________________________________________________________
consensus CGGAAGTGGATGGGGCCGTGGGAGGGCTTGGTGTTCATGCGCTTGCGGAGGAAGCGGTGA
 
. : . : . : . : . : . :
rJMFF031B18- TACTTCATTTTCTGACGGACAAGGCCGCCGGAGAGGCAGATTTCCTCGCAGCGGACAACA
rJMFF034H09- TACTTCATTTTCTGACGGACAAGG
rJMFF001L13- TACTTCATTTTCTGACGGACAAGGCCGCCGGAGAGGCAGATTTCCTCGCAGCGGACAACA
rJMSF016B15- TACTTCATTTTCTGACGGACAAGGCCGCCGGAGAGGCAGATTTCCTCGCAGCGGACAACA
JMFN005I11+ TACTTCATTTTCTGACGGACAAGGCCGCCGGAGAGGCAGATTTCCTCGCAGCGGACAACA
rJMSF038G08- TACTTCATTTTCTGACGGACAAGGCCGCCGGAGAGGCAGATTTCCTCGCAGCGGACAACA
JMSF038G08+ TACTTCATTTTCTGACGGACAAGGCCGCCGGAGAGGCAGATTTCCTCGCAGCGGACAACA
JMFF001L13+ TACTTCATTTTCTGACGGACAAGGCCGCCGGAGAGGCAGATTTCCTCGCAGCGGACAACA
JMFF034H09+ TACTTCATTTTCTGACGGACAAGGCCGCCGGAGAGGCAGATTTCCTCGCAGCGGACAACA
JMSF016B15+ TACTTCATTTTCTGACGGACAAGGCCGCCGGAGAGGCAGATTTCCTCGCAGCGGACAACA
JMSF046H18+ TGACGGACAAGGCCGCCGGAGAGGCAGATTTCCTCGCAGCGGACAACA
JMFF031B18+ TACTTCATTTTCTGACGGACAAGGCCGCCGGAGAGGCAGATTTCCTCGCAGCGGACAACA
                      ____________________________________________________________
consensus TACTTCATTTTCTGACGGACAAGGCCGCCGGAGAGGCAGATTTCCTCGCAGCGGACAACA
 
. : . : . : . : . : . :
rJMFF031B18- ACCACTCGCTGACCATTGAGCAGCTCCTTGGCCAAGATGGAGGCCAGCCGTCCCAACATA
rJMFF001L13- ACCACTCGCTGACCATTGAGCAGCTCCTTG
rJMSF016B15- ACCACTCGCTGACCATTGAGCAGCTCCTTGGCCAAGATGGAGGCCAGCCGTCCCAACATA
JMFN005I11+ ACCACTCGCTGACCATTGAGCAGCTCCTTGGCCAAGATGGAGGCCAGCCGTCCCAACATA
rJMSF038G08- ACCACTCGCTGACCATTGAGCAGCTCCTTGGCCAAGATGGAGGCCAGCCGTCCCAACATA
JMSF038G08+ ACCACTCGCTGACCATTGAGCAGCTCCTTGGCCAAGATGGAGGCCAGCCGTCCCAACATA
JMFF001L13+ ACCACTCGCTGACCATTGAGCAGCTCCTTGGCCAAGATGGAGGCCAGCCGTCCCAACATA
JMFF034H09+ ACCACTCGCTGACCATTGAGCAGCTCCTTGGCCAAGATGGAGGCCAGCCGTCCCAACATA
JMSF016B15+ ACCACTCGCTGACCATTGAGCAGCTCCTTGGCCAAGATGGAGGCCAGCCGTCCCAACATA
JMSF046H18+ ACCACTCGCTGACCATTGAGCAGCTCNTTGGCCAAGANGGAGGCCAGCCGTCCCAACATA
JMFF031B18+ ACCACTCGCTGACCATTGAGCAGCTCCTTGGCCAAGATGGAGGCCAGCCGTCCCAACATA
                      ____________________________________________________________
consensus ACCACTCGCTGACCATTGAGCAGCTCCTTGGCCAAGATGGAGGCCAGCCGTCCCAACATA
 
. : . : . : . : . : . :
rJMFF031B18- TGATGCCTCGCGTCCACCACCACTCTACGAG
rJMSF016B15- TGATGCCTCGCGTCCACCACCACTCTACGAGCGCAGATTCCAGATCCCGACACCATTTTT
JMFN005I11+ TGATGCCTCGCGTCCACCACCACTCTACGAGCGCAGATTCCAGATCCCGACACCATTTTT
rJMSF038G08- TGATGCCTCGCGTCCACCACCACTCTACGAGCGCAGATTCCAGATCCCGACACCATTTTT
JMSF038G08+ TGATGCCTCGCGTCCACCACCACTCTACGAGCGCAGATTCCAGATCCCGACACCATTTTT
JMFF001L13+ TGATGCCTCGCGTCCACCACCACTCTACGAGCGCAGATTCGAGATCCCGACACCATTTTT
JMFF034H09+ TGATGCCTCGCGTCCACCACCACTCTACGAGCGCAGATTCCAGATCCCGACACCATTTTT
JMSF016B15+ TGATGCCTCGCGTCCACCACCACTCTACGAGCGCAGATTCCAGATCCCGACACCATTTTT
JMSF046H18+ TGATGCCTNGCGTCCACCACCACTCTACGAGCGCAGATTCCAGATCCCGACACCATTTAT
JMFF031B18+ TGATGCCTCGCGTCCACCACCACTCTACGAGCGCAGATTCCAGATCCCGACACCATTTTT
                      ____________________________________________________________
consensus TGATGCCTCGCGTCCACCACCACTCTACGAGCGCAGATTCCAGATCCCGACACCATTTTT
 
. : . : . : . : . : . :
rJMSF016B15- GCTGCGTCTTCTCTTCACTCCCTTCCTATCCGGCGA
JMFN005I11+ GCTGCGTCTTCTCTTCACTCCCTTCCTATCCGGCGATGACTAG
rJMSF038G08- GCTGCGTCTTCTCTTCACTCCCTTCCTATCCGGCGATGACTAGCTTAGCTCTGCTCT
JMSF038G08+ GCTGCGTCTTCTCTTCACTCCCTTCCTATCCGGCGATGACTAGCTTAGCTCTGCTCT
JMFF001L13+ GCTGCGTCTTCTCTTCACTCCCTTCCTATCCGGCGATGACTAGCTTAGCTCTGCTCT
JMFF034H09+ GCTGCGTCTTCTCTTCACTCCCTTCCTATCCGGCGATGACTAGCTTAGCTCTGCTCT
JMSF016B15+ GCTGCGTCTTCTCTTCACTCCCTTCCTATCCGGCGATGACTAGCTTAGCTC
JMSF046H18+ GCTGCGTCTTCTCTTCACTCCCTTCNTATCCGGNGATGACTAGCTTAGCTCTGCTC
JMFF031B18+ GCTGCGTCTTCTCTTCACTCCCTTCCTATCCGGCGATGACTAGCTTAGCTCTGCTCTAGC
                      ____________________________________________________________
consensus GCTGCGTCTTCTCTTCACTCCCTTCCTATCCGGCGATGACTAGCTTAGCTCTGCTCTAGC