Previous Contig 001406:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF018G03Sequence532001406 (2)727021068gb:AP003044_18243480.025Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P003
JMFF030O19Sequence437001406 (2)657011235 (3)gb:BT002894_16364843e-74Arabidopsis thaliana clone RAFL15-20-M04 (R20457) putative short chain alcohol d

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF018G03+ TCTATCGACACCGCCTC
                      ____________________________________________________________
consensus TCTATCGACACCGCCTC
 
. : . : . : . : . : . :
JMFF018G03+ TTAAGGCGGTGGTGAACCCGCCACTCGTTCCACCTCCGAATGGGCTAGAAATGCTAACAT
                      ____________________________________________________________
consensus TTAAGGCGGTGGTGAACCCGCCACTCGTTCCACCTCCGAATGGGCTAGAAATGCTAACAT
 
. : . : . : . : . : . :
JMFF018G03+ TGCTATGAACATTAGCATCACAAAAGCCTAAGCTTGCTGAACTTGCAGATTGATCCCAAA
                      ____________________________________________________________
consensus TGCTATGAACATTAGCATCACAAAAGCCTAAGCTTGCTGAACTTGCAGATTGATCCCAAA
 
. : . : . : . : . : . :
JMFF018G03+ CATTCAAGCAAAACGCATCCACCATCGGGTTGCTATTGGGAATCATTCCAATAGGCGTGT
JMFF030O19+ CATTCCAATAGGCGTGT
                      ____________________________________________________________
consensus CATTCAAGCAAAACGCATCCACCATCGGGTTGCTATTGGGAATCATTCCAATAGGCGTGT
 
. : . : . : . : . : . :
JMFF018G03+ TCGCGAGATCGGAACCATTGATTTGCCAGTCAGATGACACATTTGCTGACTGAAAGCTCA
JMFF030O19+ TCGCGAGATCGGAACCATTGATTTGCCAGTCAGATGACACATTTGCTGACTGAAAGCTCA
                      ____________________________________________________________
consensus TCGCGAGATCGGAACCATTGATTTGCCAGTCAGATGACACATTTGCTGACTGAAAGCTCA
 
. : . : . : . : . : . :
JMFF018G03+ TAGCATCATCACCTCTCTTTGCTGCCATGGCCTCATCCTTGCCACCCTTATCCATTCTTG
JMFF030O19+ TAGCATCATCACCTCTCTTTGCTGCCATGGCCTCATCCTTGCCACCCTTATCCATTCTTG
                      ____________________________________________________________
consensus TAGCATCATCACCTCTCTTTGCTGCCATGGCCTCATCCTTGCCACCCTTATCCATTCTTG
 
. : . : . : . : . : . :
JMFF018G03+ AAAACAGTAGCAAATTTCAGAAACAAAATCCTCTCCCTTGCAGCTTATTTCAGATAGTTT
JMFF030O19+ AAAACAGTAGCAAATTTCAGAAACAAAATCCTCTCCCTTGCAGCTTATTTCAGATAGTTT
                      ____________________________________________________________
consensus AAAACAGTAGCAAATTTCAGAAACAAAATCCTCTCCCTTGCAGCTTATTTCAGATAGTTT
 
. : . : . : . : . : . :
JMFF018G03+ GCTACTTTTGGTTCTCTGCAAGACATTCTTTGAAGGTTTCATTCAAGAAAAGGGGAAAAA
JMFF030O19+ GCTACTTTTGGTTCTCTGCAAGACATTCTTTGAAGGTTTCATTCAAGAAAAGGGGAAAAA
                      ____________________________________________________________
consensus GCTACTTTTGGTTCTCTGCAAGACATTCTTTGAAGGTTTCATTCAAGAAAAGGGGAAAAA
 
. : . : . : . : . : . :
JMFF018G03+ GGGAGAGAAAATACAACAAAATCTCTTGAATTTAGGCTCTGGGGAGTGGGGACTTTGTTC
JMFF030O19+ GGGAGAGAAAATACAACAAAATCTCTTGAATTTAGGCTCTGGGGAGTGGGGACTTTGTTC
                      ____________________________________________________________
consensus GGGAGAGAAAATACAACAAAATCTCTTGAATTTAGGCTCTGGGGAGTGGGGACTTTGTTC
 
. : . : . : . : . : . :
JMFF018G03+ ACAACAGTTCATACTCTGCTAGATCCTGTCACTCT
JMFF030O19+ ACAACAGTTCATACTCTGCTAGATCCTGTCACTCTATCAAGAAAATAAACACCCAAGAAA
                      ____________________________________________________________
consensus ACAACAGTTCATACTCTGCTAGATCCTGTCACTCTATCAAGAAAATAAACACCCAAGAAA
 
. : . : . : . : . : . :
JMFF030O19+ GTAATAAAGATGACAGAGAAGAAGAGAGAGAGAGAGAGAGAGAAATGGGAAATTGAAGGA
                      ____________________________________________________________
consensus GTAATAAAGATGACAGAGAAGAAGAGAGAGAGAGAGAGAGAGAAATGGGAAATTGAAGGA