Previous Contig 001405:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF030N21Sequence511001405 (2)gb:AC012329_15375771e-41Arabidopsis thaliana chromosome 1 BAC T1G12 genomic sequence, complete sequence.705021339gb:AC012329_15375772e-25Arabidopsis thaliana chromosome 1 BAC T1G12 genomic sequence, complete sequence.
JMSF012E15Sequence498001405 (2)gb:AC012329_15375772e-39Arabidopsis thaliana chromosome 1 BAC T1G12 genomic sequence, complete sequence.783022483gb:AC012329_15375776e-32Arabidopsis thaliana chromosome 1 BAC T1G12 genomic sequence, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF030N21+ AGAAGGAAGGCCAGTAACAATAACTCGATAT
                      ____________________________________________________________
consensus AGAAGGAAGGCCAGTAACAATAACTCGATAT
 
. : . : . : . : . : . :
JMFF030N21+ TCAGAATGCTTAGAAATCCCATAACGTGATGCACTCCTGCCCCCACCACCATAGCCACCA
                      ____________________________________________________________
consensus TCAGAATGCTTAGAAATCCCATAACGTGATGCACTCCTGCCCCCACCACCATAGCCACCA
 
. : . : . : . : . : . :
JMSF012E15+ CTACCACCATGAGCAAGCTCAACCCTCAGTCGA
JMFF030N21+ CGCCGATCAACTGAAGATGATGGCCCCCTACCACCATGAGCAAGCTCAACCCTCAGTCGA
                      ____________________________________________________________
consensus CGCCGATCAACTGAAGATGATGGCCCCCTACCACCATGAGCAAGCTCAACCCTCAGTCGA
 
. : . : . : . : . : . :
JMSF012E15+ CAACCATCAAAGTNGTAGCCATCTCTACCCCTGATGGCATCTTCTGCATCTCTAGAATTT
JMFF030N21+ CAACCATCAAAGTTGTAGCCATCTCTACCCCTGATGGCATCTTCTGCATCTCTAGAATTT
                      ____________________________________________________________
consensus CAACCATCAAAGTTGTAGCCATCTCTACCCCTGATGGCATCTTCTGCATCTCTAGAATTT
 
. : . : . : . : . : . :
JMSF012E15+ TCAAACTCAACAAAACAATAGCCCGGGGGACGAGGTGGAATCTTCAATTCAATATCCTGA
JMFF030N21+ TCAAACTCAACAAAACAATAGCCCGGGGGACGAGGTGGAATCTTCAATTCAATATCCTGA
                      ____________________________________________________________
consensus TCAAACTCAACAAAACAATAGCCCGGGGGACGAGGTGGAATCTTCAATTCAATATCCTGA
 
. : . : . : . : . : . :
JMSF012E15+ ATACGTCCATACTTATAGAACAAATCTTCAATTTCCCATTCTCTGATGTCCAGGGGAAGG
JMFF030N21+ ATACGTCCATACTTATAGAACAAATCTTCAATTTCCCATTCTCTGATGTCCAGGGGAAGG
                      ____________________________________________________________
consensus ATACGTCCATACTTATAGAACAAATCTTCAATTTCCCATTCTCTGATGTCCAGGGGAAGG
 
. : . : . : . : . : . :
JMSF012E15+ TTTCCCACATAGATTGTCCGAGAGAAACGGCCACTCAT
JMFF030N21+ TTTCCCACATAGATTGTCCGAGAGAAACGGCCACTCATTCTGAGGTTCAATTAGGATCGG
                      ____________________________________________________________
consensus TTTCCCACATAGATTGTCCGAGAGAAACGGCCACTCATTCTGAGGTTCAATTAGGATCGG
 
. : . : . : . : . : . :
JMFF030N21+ AGGAGAATCTGATAATAGGAGGAAGACGAAGGGTAAGCGTGTCCGTCTTCGGAGCTCCGA
                      ____________________________________________________________
consensus AGGAGAATCTGATAATAGGAGGAAGACGAAGGGTAAGCGTGTCCGTCTTCGGAGCTCCGA
 
. : . : . : . : . : . :
JMFF030N21+ TTTCTTGGACCTCGTTATCGGGTTTTCTCTTTGCTTCGACGAGTCTCGCTGTTAAGATGC
                      ____________________________________________________________
consensus TTTCTTGGACCTCGTTATCGGGTTTTCTCTTTGCTTCGACGAGTCTCGCTGTTAAGATGC