Previous Contig 001402:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF030M14Sequence431001402 (3)gb:AP005002_18470853e-27Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P048
JMFS071A04Sequence622001402 (3)gb:AP005002_18470851e-47Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P048
JMFS094D05Sequence589001402 (3)gb:AP005002_18470859e-38Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P048

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS071A04+ GAAACACAATCAAACATGAACTGGACACCTTCTCTTTGATGTGGTCGGAGGTAC
JMFS094D05+ GGTAC
                      ____________________________________________________________
consensus GAAACACAATCAAACATGAACTGGACACCTTCTCTTTGATGTGGTCGGAGGTAC
 
. : . : . : . : . : . :
JMFS071A04+ TTAACAAGTAAAGGTTCCACTGCTATAGGTTTTGAATCACAGCCTTCCTCCCCAAATCCT
JMFS094D05+ TTAACAAGTAAAGGTTCCACTGCTATAGGTTTTGAATCACAGCCTTCCTCCCCAAATCCT
                      ____________________________________________________________
consensus TTAACAAGTAAAGGTTCCACTGCTATAGGTTTTGAATCACAGCCTTCCTCCCCAAATCCT
 
. : . : . : . : . : . :
JMFS071A04+ TCAGGCTGCCACAACAGCAATGGTTCCACATCTGGTGGCAGATATATCTCTTCTTCAGGC
JMFS094D05+ TCAGGCTGCCACAACAGCAATGGTTCCACATCTGGTGGCAGATATATCTCTTCTTCAGGC
                      ____________________________________________________________
consensus TCAGGCTGCCACAACAGCAATGGTTCCACATCTGGTGGCAGATATATCTCTTCTTCAGGC
 
. : . : . : . : . : . :
JMFS071A04+ ACATCTTTATGAGCAGTCTCAAGGACAGTTACCCTGTTCGTGATTGCAACCAAAGCTGGC
JMFS094D05+ ACATCTTTATGAGCAGTCTCAAGGACAGTTACCCTGTTCGTGATTGCAACCAAAGCTGGC
JMFF030M14+ CCAAAGCTGGC
                      ____________________________________________________________
consensus ACATCTTTATGAGCAGTCTCAAGGACAGTTACCCTGTTCGTGATTGCAACCAAAGCTGGC
 
. : . : . : . : . : . :
JMFS071A04+ CTATTGGACCCCCATGGCACAAACCTTTTGCGTGCCCAGAGACGGCGTGCCAGATGTTCA
JMFS094D05+ CTATTGGACCCCCATGGCACAAACCTTTTGCGTGCCCAGAGACGGCGTGCCAGATGTTCA
JMFF030M14+ CTATTGGACCCCCATGGCACAAACCTTTTGCGTGCCCAGAGACGGCGTGCCAGATGTTCA
                      ____________________________________________________________
consensus CTATTGGACCCCCATGGCACAAACCTTTTGCGTGCCCAGAGACGGCGTGCCAGATGTTCA
 
. : . : . : . : . : . :
JMFS071A04+ TTGTTACTACTATAACCATTTGAGCTCGGAGGTTTAAAAGGCTTTCTGACGTTGACAGCT
JMFS094D05+ TTGTTACTACTATAACCATTTGAGCTCGGAGGTTTAAAAGGCTTTCTGACGTTGACAGCT
JMFF030M14+ TTGTTACTACTATAACCATTTGAGCTCGGAGGTTTAAAAGGCTTTCTGACGTTGACAGCT
                      ____________________________________________________________
consensus TTGTTACTACTATAACCATTTGAGCTCGGAGGTTTAAAAGGCTTTCTGACGTTGACAGCT
 
. : . : . : . : . : . :
JMFS071A04+ GCATCAGTTACTGAATAGACTCGTGGAAGTATTGACTGTCTTCTCACTTCAAGGTTTCCC
JMFS094D05+ GCATCAGTTACTGAATAGACTCGTGGAAGTATTGACTGTCTTCTCACTTCAAGGTTTCCC
JMFF030M14+ GCATCAGTTACTGAATAGACTCGTGGAAGTATTGACTGTCTTCTCACTTCAAGGTTTCCC
                      ____________________________________________________________
consensus GCATCAGTTACTGAATAGACTCGTGGAAGTATTGACTGTCTTCTCACTTCAAGGTTTCCC
 
. : . : . : . : . : . :
JMFS071A04+ CTGACTAAAGCGGCCACATTTTCCGACTTCCGATCTTCCGGACTGCAGCGGAGATTGGAT
JMFS094D05+ CTGACTAAAGCGGCCACATTTTCCGACTTCCGATCTTCCGGACTGCAGCGGAGATTGGAT
JMFF030M14+ CTGACTAAAGCGGCCACATTTTCCGACTTCCGATCTTCCGGACTGCAGCGGAGATTGGAT
                      ____________________________________________________________
consensus CTGACTAAAGCGGCCACATTTTCCGACTTCCGATCTTCCGGACTGCAGCGGAGATTGGAT
 
. : . : . : . : . : . :
JMFS071A04+ GTTTGAGCTCCATGGCCATCGTCTTCGTCGCCGCTATTACAATTGTAATCGAGGTCGTCC
JMFS094D05+ GTTTGAGCTCCATGGCCATCGTCTTCGTCGCCGCTATTACAATTGTAATCGAGGTCGTCC
JMFF030M14+ GTTTGAGCTCCATGGCCATCGTCTTCGTCGCCGCTATTACAATTGTAATCGAGGTCGTCC
                      ____________________________________________________________
consensus GTTTGAGCTCCATGGCCATCGTCTTCGTCGCCGCTATTACAATTGTAATCGAGGTCGTCC
 
. : . : . : . : . : . :
JMFS071A04+ TCGTCATTGTCTGACTCAGAGATGAACTCGACACTCGAATCGCTTGGTTCTGAAGCGGAA
JMFS094D05+ TCGTCATTGTCTGACTCAGAGATGAACTCGACACTCGAATCGCTTGGTTCTGAAGCGGAA
JMFF030M14+ TCGTCATTGTCTGACTCAGAGATGAACTCGACACTCGAATCGCTTGGTTCTGAAGCGGAA
                      ____________________________________________________________
consensus TCGTCATTGTCTGACTCAGAGATGAACTCGACACTCGAATCGCTTGGTTCTGAAGCGGAA
 
. : . : . : . : . : . :
JMFS071A04+ AGAGCCTCATCTTCATCGTCCATTTGAC
JMFS094D05+ AGAGCCTCATCTTCATCGTCCATTTGACGACCTCCTGTGCTTCG
JMFF030M14+ AGAGCCTCATCTTCATCGTCCATTTGACGACCTCCTGTGCTTCGCTGAGTACTTGAGTTC
                      ____________________________________________________________
consensus AGAGCCTCATCTTCATCGTCCATTTGACGACCTCCTGTGCTTCGCTGAGTACTTGAGTTC