Previous Contig 001398:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF030J19Sequence438001398 (5)gb:AB016061_15127541e-16Petunia x hybrida IMT-6 mRNA for cytochrome P450, complete cds.661010730 (4)gb:AB016061_15127545e-74Petunia x hybrida IMT-6 mRNA for cytochrome P450, complete cds.
JMFF047G12Sequence360001398 (5)gb:AB016061_15127541e-07Petunia x hybrida IMT-6 mRNA for cytochrome P450, complete cds.351010730 (4)gb:AB016061_15127546e-17Petunia x hybrida IMT-6 mRNA for cytochrome P450, complete cds.
JMSF003O18Sequence289001398 (5)gb:AB016061_15127540.004Petunia x hybrida IMT-6 mRNA for cytochrome P450, complete cds.714010730 (4)gb:AB016060_15127531e-79Petunia x hybrida IMT-4 mRNA for cytochrome P450, complete cds.
JMSF009F22Sequence412001398 (5)gb:AB016061_15127548e-22Petunia x hybrida IMT-6 mRNA for cytochrome P450, complete cds.763010730 (4)gb:AB016060_15127531e-79Petunia x hybrida IMT-4 mRNA for cytochrome P450, complete cds.
JMSF037L24Sequence662001398 (5)gb:AB016061_15127546e-56Petunia x hybrida IMT-6 mRNA for cytochrome P450, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF037L24+ CCGACACAGGATCCACCAAATCGCTGGAAAACATTATGTTTCCCAGCAGGTTGAAT
                      ____________________________________________________________
consensus CCGACACAGGATCCACCAAATCGCTGGAAAACATTATGTTTCCCAGCAGGTTGAAT
 
. : . : . : . : . : . :
JMSF037L24+ GTTGCCAGGAAAACAAAGCGAGTTACATGAATCCCAGAGCCTCTCTTGATAGAGCCTGCT
                      ____________________________________________________________
consensus GTTGCCAGGAAAACAAAGCGAGTTACATGAATCCCAGAGCCTCTCTTGATAGAGCCTGCT
 
. : . : . : . : . : . :
JMSF037L24+ TCGTTTTCTACCCACCGGAGCAAATCGTCGATGCATTTTCGCCGGACGGCGGCCGTTTCG
                      ____________________________________________________________
consensus TCGTTTTCTACCCACCGGAGCAAATCGTCGATGCATTTTCGCCGGACGGCGGCCGTTTCG
 
. : . : . : . : . : . :
JMSF009F22+ TAT
JMSF037L24+ TTCACCTTCTTGTGCACGAACATTTCCACGGAGCATATCCGCCTTAACACCCGCCAGTAT
                      ____________________________________________________________
consensus TTCACCTTCTTGTGCACGAACATTTCCACGGAGCATATCCGCCTTAACACCCGCCAGTAT
 
. : . : . : . : . : . :
JMSF009F22+ GATCCATACTGGGCTAGCGCCATGGACCCCTTGTTGTAACCNTGCGCCAGCATGACGTCG
JMSF037L24+ GATCCATACTGGGCTAGCGCCATGGACCCCTTGTTGTAACCCTGCGCCAGCATGACGTCG
JMFF030J19+ TGCGCCAGCATGACGTCG
                      ____________________________________________________________
consensus GATCCATACTGGGCTAGCGCCATGGACCCCTTGTTGTAACCCTGCGCCAGCATGACGTCG
 
. : . : . : . : . : . :
JMSF009F22+ CCGATGCTGCGGCCGGCGAATGGGACGTCGTGGTTCTTGAAGAGCTCGGCGGCGGCCTTG
JMSF037L24+ CCGATGCTGCGGCCGGCGAATGGGACGTCGTGGTTCTTGAAGAGCTCGGCGGCGGCCTTG
JMFF030J19+ CCGATGCTGCGGCCGGCGAATGGGACGTCGTGGTTCTTGAAGAGCTCGGCGGCGGCCTTG
                      ____________________________________________________________
consensus CCGATGCTGCGGCCGGCGAATGGGACGTCGTGGTTCTTGAAGAGCTCGGCGGCGGCCTTG
 
. : . : . : . : . : . :
JMSF009F22+ GCCGACTGGATTGCCAGGGTGCTGACGGAGCCTATCCTTAGCCAAACCACAGGCCCGTAC
JMSF037L24+ GCCGACTGGATTGCCAGGGTGCTGACGGAGCCTATCCTTAGCCAAACCACAGGCCCGTAC
JMFF047G12+ GCCGACTGGATGCCCAGGGTGCTGACGGAGCCTATCCTTAGCCAAACCACAGGCCCGTAC
JMSF003O18+ CCAAACCACAGGCCCGTAC
JMFF030J19+ GCCGACTGGATTGCCAGGGTGCTGACGGAGCCTATCCTTAGCCAAACCACAGGCCCGTAC
                      ____________________________________________________________
consensus GCCGACTGGATTGCCAGGGTGCTGACGGAGCCTATCCTTAGCCAAACCACAGGCCCGTAC
 
. : . : . : . : . : . :
JMSF009F22+ TTGTTTCTCATCGCGGCTATTGTTTGGTGTGGTACTGATCCGAGGTCCAACATGTTGCCC
JMSF037L24+ TTGTTTCTCATCGCGGCTATTGTTTGGTGTGGTACTGATCCGAGGTCCAACATGTTGCCC
JMFF047G12+ TTGTTTCTCATCGCGGCTATTGTTTGGTGTGGTACTGATCCGAGGTCCAACATGTTGCCC
JMSF003O18+ TTGTTTCTCATCGCGGCTATTGTTTGGTGTGGTACTGATCCGAGGTCCAACATGTTGCCC
JMFF030J19+ TTGTTTCTCATCGCGGCTATTGTTTGGTGTGGTACTGATCCGAGGTCCAACATGTTGCCC
                      ____________________________________________________________
consensus TTGTTTCTCATCGCGGCTATTGTTTGGTGTGGTACTGATCCGAGGTCCAACATGTTGCCC
 
. : . : . : . : . : . :
JMSF009F22+ AACACGGGCAGCCCAGGTGGTCCCGGCGGCAGTCTGCCGGAGCGTGACTTGTTCCGGGAG
JMSF037L24+ AACACGGGCAGCCCAGGTGGTCCCGGCGGCAGTCTGCCGGAGCGTGACTTGTTCCGGGAG
JMFF047G12+ AACACGGGCAGCCCAGGTGGTCCCGGCGGCAGTCTGCCGGAGCGTGACTTGTTCCGGGAG
JMSF003O18+ AACACGGGCAGCCCAGGTGGTCCCGGCGGCAGTCTGCCGGAGCGTGACTTGTTCCGGGAG
JMFF030J19+ AACACGGGCAGCCCAGGTGGTCCCGGCGGCAGTCTGCCGGAGCGTGACTTGTTCCGGGAG
                      ____________________________________________________________
consensus AACACGGGCAGCCCAGGTGGTCCCGGCGGCAGTCTGCCGGAGCGTGACTTGTTCCGGGAG
 
. : . : . : . : . : . :
JMSF009F22+ ATTAGAAGGAGCAAAGCCGCCGGGATCAAGAAGGCCGCGGACAAGATGATGATGTATCTC
JMSF037L24+ ATTAGAAGGAGCAAAGCCGCCGGGATCAAGAAGGCCGCGGACAAGATGATGATGTATCTC
JMFF047G12+ ATTAGAAGGAGCAAAGCCGCCTGGATCAAGAAGGCCGCGGACAAGATGATGATGTATCTC
JMSF003O18+ ATTAGAAGGAGCAAAGCCGCCGGGATCAAGAAGGCCGCGGACAAGATGATGATGTATCTC
JMFF030J19+ ATTAGAAGGAGCAAAGCCGCCGGGATCAAGAAGGCCGCGGACAAGATGATGATGTATCTC
                      ____________________________________________________________
consensus ATTAGAAGGAGCAAAGCCGCCGGGATCAAGAAGGCCGCGGACAAGATGATGATGTATCTC
 
. : . : . : . : . : . :
JMSF009F22+ CCATCCCAGTACTCCATCTCTTGCAAGCTAACTAAAGCTAGTGGTCTT
JMSF037L24+ CCATCCCAGTACTCCATCTCTTGCAAGCTAACTAAAGCTAGTGGTCTTGGAAATTGCAGG
JMFF047G12+ CCATCCCAGTACTCCATCTCTTGCAAGCTAACTAAAGCTAGTGGTCTTGGAAATTGCAGG
JMSF003O18+ CCATCCCAGTACTCCATCTCTTGCAAGCTAACTAAAGCTAGTGGTCTTGGAAATTGCAGG
JMFF030J19+ CCATCCCAGTACTCCATCTCTTGCAAGCTAACTAAAGCTAGTGGTCTTGGAAATTGCAGG
                      ____________________________________________________________
consensus CCATCCCAGTACTCCATCTCTTGCAAGCTAACTAAAGCTAGTGGTCTTGGAAATTGCAGG
 
. : . : . : . : . : . :
JMSF037L24+ CGGCT
JMFF047G12+ CGGCTAAACCAACGGTATTTAAAAGAATCATTAAATAAGGAAAGTTTGAGATGGGATATT
JMSF003O18+ CGGCTAAACCAACGGTATTTAAAAGAA
JMFF030J19+ CGGCTAAACCAACGGTATTTAAAAGAATCATTAAATAAGGAAAGTTTGAGATGGGATATT
                      ____________________________________________________________
consensus CGGCTAAACCAACGGTATTTAAAAGAATCATTAAATAAGGAAAGTTTGAGATGGGATATT