Previous Contig 001397:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF030J18Sequence561001397 (3)pir|T07169|T071695e-36subtilisin-like proteinase (EC 3.4.21.-) 3 - tomato>gb:LES6376_1684619 Lycopersi605013846 (3)pir|T07169|T071693e-68subtilisin-like proteinase (EC 3.4.21.-) 3 - tomato>gb:LES6376_1684619 Lycopersi
JMFS060A12Sequence622001397 (3)pir|T07170|T071706e-68subtilisin-like proteinase (EC 3.4.21.-) 4 - tomato>gb:LES6377_1684620 Lycopersi
JMSF006B22Sequence385001397 (3)gb:LES6483_16846281e-09Lycopersicon esculentum sbt4e gene.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS060A12+ CGTGTCCATTGGTGTCCCGGGCGGAATTC
                      ____________________________________________________________
consensus CGTGTCCATTGGTGTCCCGGGCGGAATTC
 
. : . : . : . : . : . :
JMFS060A12+ ATGGAGATATTAATCCCGGGATTCGCGGCGAGTACTCCGGCGTTGAAATAGTTAGCGCCA
                      ____________________________________________________________
consensus ATGGAGATATTAATCCCGGGATTCGCGGCGAGTACTCCGGCGTTGAAATAGTTAGCGCCA
 
. : . : . : . : . : . :
JMFS060A12+ ATGAGCTTTCTGTTACACAACGAAGAATTGAACTCCGTTCCTTCCTTGCAAACCCCCTTC
                      ____________________________________________________________
consensus ATGAGCTTTCTGTTACACAACGAAGAATTGAACTCCGTTCCTTCCTTGCAAACCCCCTTC
 
. : . : . : . : . : . :
JMFS060A12+ CACCTCTTGGGAATCAGCGGCATGCCGTCGTCCCTAAAGCTCCTGGATTCCGGCCATACA
                      ____________________________________________________________
consensus CACCTCTTGGGAATCAGCGGCATGCCGTCGTCCCTAAAGCTCCTGGATTCCGGCCATACA
 
. : . : . : . : . : . :
JMFS060A12+ CCGGAGTCAACCACGCCGACGATCACATCCTCGCCGAACTTCGACGCCGGCCATAGCCCC
JMFF030J18+ TTCGACGCCGGCCATAGCCCC
                      ____________________________________________________________
consensus CCGGAGTCAACCACGCCGACGATCACATCCTCGCCGAACTTCGACGCCGGCCATAGCCCC
 
. : . : . : . : . : . :
JMFS060A12+ GTATTCGAATTAAGCTTCAGAAAGCTAGGAGTATACGTGGTTTGCAGCTCAAAGGTCCGA
JMFF030J18+ GTATCCGAATTAAGCTTCAGAAAGCTAGGAGTATACGTGGTTTGCAGCTCAAAGGTTCGA
                      ____________________________________________________________
consensus GTATTCGAATTAAGCTTCAGAAAGCTAGGAGTATACGTGGTTTGCAGCTCAAAGGTTCGA
 
. : . : . : . : . : . :
JMFS060A12+ TCTTTATAAGCCGATACGAATCCCGGAGACTTCTTCAAGGCCTGAAGTTCCTCCTCCGAC
JMFF030J18+ TCTTTATAAGCCGAAACGAATCCCGGAGACTTCTTCAAGGCCTGAAGTTCCTCCTCCGAC
                      ____________________________________________________________
consensus TCTTTATAAGCCGATACGAATCCCGGAGACTTCTTCAAGGCCTGAAGTTCCTCCTCCGAC
 
. : . : . : . : . : . :
JMFS060A12+ AACAAAGCGCTAAAGCCGTGAA
JMSF006B22+ TAGGAGTACACAAGCTTGGNCGAGGCG
JMFF030J18+ AACACAGCGCTAAAGCCGTGAATCACATTGTCGTAGGAGTACACAAGCTTGGGCGAGGCG
                      ____________________________________________________________
consensus AACACAGCGCTAAAGCCGTGAATCACATTGTCGTAGGAGTACACAAGCTTGGGCGAGGCG
 
. : . : . : . : . : . :
JMSF006B22+ GCGGCGGCGCCATGCGGTGAAACGTTGANGGGATCAACGGCGGAGGAGTACCAGTGGTGG
JMFF030J18+ GCGGCGGCGCCATGCGGTGAANCGTTGAGGGAATCAACGGCGGAGGAGTACCAGTGGTGG
                      ____________________________________________________________
consensus GCGGCGGCGCCATGCGGTGAAACGTTGAGGGGATCAACGGCGGAGGAGTACCAGTGGTGG
 
. : . : . : . : . : . :
JMSF006B22+ TGGCCGGCAAAGGCGGCGGGCATGAAGGACTTGTCCATGTGGACAATGTAGGTGGATCTC
JMFF030J18+ TGGCCGGCAAAGGCGGCGGGCATGAAGGACTTGTCCATGTGGACAATGTAGGTGGATCTC
                      ____________________________________________________________
consensus TGGCCGGCAAAGGCGGCGGGCATGAAGGACTTGTCCATGTGGACAATGTAGGTGGATCTC
 
. : . : . : . : . : . :
JMSF006B22+ TGCTGCGCCGATAAGGGTGAGGGGAAGATCTGAAGAGCAAAGAGAAGCCATGGGAGGAGA
JMFF030J18+ TGCTGCGCCGATAAGGGTGAGGGGAAGATCTGAAGAGCAAAGAGAAGCCATGGGAGGAGA
                      ____________________________________________________________
consensus TGCTGCGCCGATAAGGGTGAGGGGAAGATCTGAAGAGCAAAGAGAAGCCATGGGAGGAGA
 
. : . : . : . : . : . :
JMSF006B22+ ATCTGAAGCAGAGAAACTGGAAAATCCATTGGATTTTGAACTCGGGCCGAAGAAGAAATG
JMFF030J18+ ATNTGAAGCAGAGAAACTGGAAAATCCATTGGATTTTGAACTCGGGCCGAAGAAGAAATG
                      ____________________________________________________________
consensus ATCTGAAGCAGAGAAACTGGAAAATCCATTGGATTTTGAACTCGGGCCGAAGAAGAAATG
 
. : . : . : . : . : . :
JMSF006B22+ AAATCAGGGGATATTATAGGATTTGGTCAACATGGGAAGAAGTAAAAATCGGCGGCCATC
JMFF030J18+ AAATCAGGGGATATTATAGGATTTGGTCAACATGGGAAGAAGTAAAAATCGGCGGCCATC
                      ____________________________________________________________
consensus AAATCAGGGGATATTATAGGATTTGGTCAACATGGGAAGAAGTAAAAATCGGCGGCCATC
 
. : . : . : . : . : . :
JMSF006B22+ CGCCATTGTTTAATCTGTGTCGGTGCGCTGCAGCCTGGGATAGATCAAAGATAGC
JMFF030J18+ CGCCATTGTTTAATCTGTGTCGGTGCGCTGCAGCNTGGGATAGATCAAAGATAGCACTAC
                      ____________________________________________________________
consensus CGCCATTGTTTAATCTGTGTCGGTGCGCTGCAGCCTGGGATAGATCAAAGATAGCACTAC