Previous Contig 001391:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF010H19Sequence585001391 (34)pir|T06407|T064072e-80monodehydroascorbate reductase (NADH2) (EC 1.6.5.4), cytosolic - tomato>gb:TOMAF699001391 (34)pir|T06407|T064073e-94monodehydroascorbate reductase (NADH2) (EC 1.6.5.4), cytosolic - tomato>gb:TOMAF
JMFF010J17Sequence469001391 (34)pir|T06407|T064072e-75monodehydroascorbate reductase (NADH2) (EC 1.6.5.4), cytosolic - tomato>gb:TOMAF717011828 (2)gb:AP003297_18275841e-34Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P069
JMFF023L19Sequence484001391 (34)pir|T06407|T064073e-61monodehydroascorbate reductase (NADH2) (EC 1.6.5.4), cytosolic - tomato>gb:TOMAF798001391 (34)pir|T06407|T064074e-89monodehydroascorbate reductase (NADH2) (EC 1.6.5.4), cytosolic - tomato>gb:TOMAF
JMFF026E24Sequence492001391 (34)pir|T06407|T064078e-72monodehydroascorbate reductase (NADH2) (EC 1.6.5.4), cytosolic - tomato>gb:TOMAF766021251gb:MCR301553_16858165e-67Mesembryanthemum crystallinum mRNA for monodehydroascorbate reductase (mdhar1 ge
JMFF026O19Sequence571001391 (34)pir|T06407|T064079e-80monodehydroascorbate reductase (NADH2) (EC 1.6.5.4), cytosolic - tomato>gb:TOMAF792001391 (34)pir|T06407|T064074e-94monodehydroascorbate reductase (NADH2) (EC 1.6.5.4), cytosolic - tomato>gb:TOMAF
JMFF030H10Sequence446001391 (34)pir|T06407|T064072e-55monodehydroascorbate reductase (NADH2) (EC 1.6.5.4), cytosolic - tomato>gb:TOMAF682001391 (34)pir|T06407|T064072e-95monodehydroascorbate reductase (NADH2) (EC 1.6.5.4), cytosolic - tomato>gb:TOMAF
JMFF030O09Sequence416001391 (34)pir|T06407|T064076e-52monodehydroascorbate reductase (NADH2) (EC 1.6.5.4), cytosolic - tomato>gb:TOMAF700001391 (34)pir|T06407|T064076e-80monodehydroascorbate reductase (NADH2) (EC 1.6.5.4), cytosolic - tomato>gb:TOMAF
JMFF034G21Sequence574001391 (34)pir|T06407|T064074e-79monodehydroascorbate reductase (NADH2) (EC 1.6.5.4), cytosolic - tomato>gb:TOMAF714001391 (34)gb:MCR301553_16858161e-86Mesembryanthemum crystallinum mRNA for monodehydroascorbate reductase (mdhar1 ge
JMFF035O14Sequence719001391 (34)pir|T06407|T064071e-78monodehydroascorbate reductase (NADH2) (EC 1.6.5.4), cytosolic - tomato>gb:TOMAF
JMFF038O10Sequence563001391 (34)pir|T06407|T064076e-76monodehydroascorbate reductase (NADH2) (EC 1.6.5.4), cytosolic - tomato>gb:TOMAF537010018 (4)
JMFF045L02Sequence628001391 (34)pir|T06407|T064072e-77monodehydroascorbate reductase (NADH2) (EC 1.6.5.4), cytosolic - tomato>gb:TOMAF612001391 (34)pir|T06407|T064072e-60monodehydroascorbate reductase (NADH2) (EC 1.6.5.4), cytosolic - tomato>gb:TOMAF
JMFF049B08Sequence612001391 (34)pir|T06407|T064077e-76monodehydroascorbate reductase (NADH2) (EC 1.6.5.4), cytosolic - tomato>gb:TOMAF625001391 (34)pir|T06407|T064071e-56monodehydroascorbate reductase (NADH2) (EC 1.6.5.4), cytosolic - tomato>gb:TOMAF
JMFF050L01Sequence621001391 (34)pir|T06407|T064077e-77monodehydroascorbate reductase (NADH2) (EC 1.6.5.4), cytosolic - tomato>gb:TOMAF610001391 (34)pir|T06407|T064072e-67monodehydroascorbate reductase (NADH2) (EC 1.6.5.4), cytosolic - tomato>gb:TOMAF
JMFF051J07Sequence521001391 (34)pir|T06407|T064073e-70monodehydroascorbate reductase (NADH2) (EC 1.6.5.4), cytosolic - tomato>gb:TOMAF472001391 (34)gb:MCR301553_16858166e-28Mesembryanthemum crystallinum mRNA for monodehydroascorbate reductase (mdhar1 ge
JMFS069F01Sequence621001391 (34)pir|T06407|T064079e-85monodehydroascorbate reductase (NADH2) (EC 1.6.5.4), cytosolic - tomato>gb:TOMAF
JMSF005O14Sequence253001391 (34)pir|T06407|T064071e-21monodehydroascorbate reductase (NADH2) (EC 1.6.5.4), cytosolic - tomato>gb:TOMAF337011333 (3)gb:AF324984_17864382e-06Arabidopsis thaliana At2g27680 (At2g27680/F15K20.22) mRNA, complete cds.
JMSF005O16Sequence191000291 (57)gb:AY568719_16154771e-08Lycopersicon esculentum photosystem II oxygen-evolving complex protein 3 (PsbQ) 376001391 (34)pir|T06407|T064072e-42monodehydroascorbate reductase (NADH2) (EC 1.6.5.4), cytosolic - tomato>gb:TOMAF
JMSF006A02Sequence296001391 (34)pir|T06407|T064071e-31monodehydroascorbate reductase (NADH2) (EC 1.6.5.4), cytosolic - tomato>gb:TOMAF417022164gb:ATAC013483_15435611e-40Arabidopsis thaliana chromosome III BAC F17A17 genomic sequence, complete sequen
JMSF013M21Sequence465001391 (34)pir|T06407|T064076e-73monodehydroascorbate reductase (NADH2) (EC 1.6.5.4), cytosolic - tomato>gb:TOMAF744001391 (34)pir|T06407|T06407e-105monodehydroascorbate reductase (NADH2) (EC 1.6.5.4), cytosolic - tomato>gb:TOMAF
JMSF049A13Sequence735001391 (34)pir|T06407|T064077e-98monodehydroascorbate reductase (NADH2) (EC 1.6.5.4), cytosolic - tomato>gb:TOMAF754001391 (34)pir|T06407|T06407e-106monodehydroascorbate reductase (NADH2) (EC 1.6.5.4), cytosolic - tomato>gb:TOMAF
JMSF052P04Sequence624001391 (34)pir|T06407|T064071e-79monodehydroascorbate reductase (NADH2) (EC 1.6.5.4), cytosolic - tomato>gb:TOMAF913001391 (34)pir|T06407|T06407e-136monodehydroascorbate reductase (NADH2) (EC 1.6.5.4), cytosolic - tomato>gb:TOMAF

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF051J07- ACCCTGGAGAGTTTTTTTTTTTTTTTTA
rJMFF049B08- CCTGGAGAGTTTTTTTTTTTTTTTTA
rJMFF035O14- TTA
                      ____________________________________________________________
consensus ACCCTGGAGAGTTTTTTTTTTTTTTTTA
 
. : . : . : . : . : . :
rJMFF051J07- TAGAACTTTCAAGTGGATTATATGACAATGTAAATCCATGGCAAACAGACAGCATAAATT
rJMFF049B08- TAGAACTTTCAAGTGGATTATATGACAATGTAAATCCATGGCAAACAGACAGCATAAATT
rJMFF035O14- TAGAACTTTC-AGTGGATTATATGACAATGTAAATCCATGGCAAACAGACAGCATAAATT
rJMFF026O19- TATATGACAATGTAAATCCATGGCAAACAGACAGCATAAATT
rJMFF030O09- ATATGACAATGTAAATCCATGGCAAACAGACAGCATAAATT
rJMFF023L19- GTGGATTATATGACAATGTAAATCCATGGCAAACAGACAGCATAAATT
                      ____________________________________________________________
consensus TAGAACTTTCAAGTGGATTATATGACAATGTAAATCCATGGCAAACAGACAGCATAAATT
 
. : . : . : . : . : . :
rJMFF051J07- TGTGTAGTTTTGGCACCTGAACTTCAATAACTTGTAATTCATTGAAATCCAATCATTAAA
rJMFF049B08- TGTGTAGTTTTGGCACCTGAACTTCAATAACTTGTAATTCATTGAAATCCAATCATTAAA
rJMFF035O14- TGTGTAGTTTTGGCACCTGAACTTCAATAACTTGTAATTCATTGAAATCCAATCATTAAA
rJMFF026O19- TGTGTAGTTTTGGCACCTGAACTTCAATAACTTGTAATTCATTGAAATCCAATCATTAAA
rJMFF030O09- TGTGTAGTTTTGGCACCTGAACTTCAATAACTTGTAATTCATTGAAATCCAATCATTAAA
rJMFF034G21- AATCCAATCATTAAA
rJMFF050L01- ATAACTTGTAATTCATTGAAATCCAATCATTAAA
rJMFF045L02- CAATAACTTGTAATTCATTGAAATCCAATCATTAAA
rJMFF023L19- TGTGTAGTTTTGGCACCTGAACTTCAATAACTTGTAATTCATTGAAATCCAATCATTAAA
rJMSF013M21- A
rJMFF010H19- TCATTAAA
rJMSF049A13- ATCATTAAA
                      ____________________________________________________________
consensus TGTGTAGTTTTGGCACCTGAACTTCAATAACTTGTAATTCATTGAAATCCAATCATTAAA
 
. : . : . : . : . : . :
rJMFF051J07- AAGCAGATATCTTGAAACCATCAA-GTTTATTTATATGTATTCTATCAATTCAAGCAACA
rJMFF049B08- AAGCAGATATCTTGAAACCATCAA-GTTTATTTATATGTATTCTATCAATTCAAGCAACA
rJMFF035O14- AAGCAGATATCTTGAAACCATCAA-GTTTATTTATATGTATTCTATCAATTCAAGCAACA
rJMFF026O19- AAGCAGATATCTTGAAACCATCAA-GTTTATTTATATGTATTCTATCAATTCAAGCAACA
rJMFF030O09- AAGCAGATATCTTGAAACCATCAA-GTTTATTTATATGTATTCTATCAATTCAAGCAACA
rJMFF034G21- AAGCAGATATCTTGAAACCATA---GTTTATTTATATGTATTCTATCAATTCAAGCAACA
rJMFF050L01- AAGCAGATATCTTGAAACCATCAA-GTTTATTTATATGTATTCTATCAATTCAAGCAACA
rJMFF045L02- AAGCAAATTTCTTGAAACCATCAG-GTTTATTTATATGTATTCTATCAATTCAAGCAACA
rJMFF023L19- AAGCAGATATCTTGAAACCATCAA-GTTTATTTATATGTATTCTATCAATTCAAGCAACA
rJMSF013M21- AAGCAGATATCTTGAAACCATCAAGGTTTATTTATATGTATTCTATCAATTCAAGCAACA
rJMSF005O16- ATCAA-GTTTATTTATATGTATTCTATCAATTCAAGCAACA
rJMFF010H19- AAGCAGATATCTTGAAACCATCAA-GTTTATTTATATGTATTCTATCAATTCAAGCAACA
rJMFF030H10- CTTGAAACCATCAA-GTTTATTTATATGTATTCTATCAATTCAAGCAACA
rJMSF049A13- AAGCAGATATCTTGAAACCATCAA-GTTTATTTATATGTATTCTATCAATTCAAGCAACA
rJMSF052P04- AGCAACA
                      ____________________________________________________________
consensus AAGCAGATATCTTGAAACCATCAA-GTTTATTTATATGTATTCTATCAATTCAAGCAACA
 
. : . : . : . : . : . :
rJMFF051J07- TAGGGAAAACAATGGGTAGAAAGAAACAGAAGGCTTCAGATCTTAGAGGCAAAGGAGAGA
rJMFF049B08- TAGGGAAAACAATGGGTAGAAAGAAACAGAAGGCTTCAGATCTTAGAGGCAAAGGAGAGA
rJMFF035O14- TAGGGAAAACAATGGGTAGAAAGAAACAGAAGGCTTCAGATCTTAGAGGCAAAGGAGAGA
rJMFF026O19- TAGGGAAAACAATGGGTAGAAAGAAACAGAAGGCTTCAGATCTTAGAGGCAAAGGAGAGA
rJMFF030O09- TAGGGAAAACAATGGGTAGAAAGAAACAGAAGGCTTCAGATCTTAGAGGCAAAGGAGAGA
rJMFF034G21- TAGGGAAAACAATGGGTAGAAAGAAACAGAAGGCTTCAGATCTTAGAGGCAAAGGAGAGA
rJMFF050L01- TAGGGAAAACAATGGGTAGAAAGAAACAGAAGGCTTCAGATCTTAGAGGCAAAGGAGAGA
rJMFF045L02- TAGGGAAAACAATGGGTAAAAAAAAACAAAAGGTTTCAAATCTTAAAGGCAAAGGAAAAA
rJMFF023L19- TAGGGAAAACAATGGGTAGAAAGAAACAGAAGGCTTCAGATCTTAGAGGCAAAGGAGAGA
rJMSF013M21- TAGGGAAAACAATGGGTAGAAAGAAACAGAAGGCTTCAGATCTTAGAGGCAAAGGAGAGA
rJMSF005O16- TAGGGAAAACAATGGGTAGAAAGAAACAGAAGGCTTCAGATCTTAGAGGCAAAGGAGAGA
rJMFF010H19- TAGGGAAAACAATGGGTAGAAAGAAACAGAAGGCTTCAGATCTTAGAGGCAAAGGAGAGA
rJMFF030H10- TAGGGAAAACAATGGGTAGAAAGAAACAGAAGGCTTCAGATCTTAGAGGCAAAGGAGAGA
rJMSF049A13- TAGGGAAAACAATGGGTAGAAAGAAACAGAAGGCTTCAGATCTTAGAGGCAAAGGAGAGA
rJMSF052P04- TAGGGAAAACAATGGGTAGAAAGAAACAGAAGGCTTCAGATCTTAGAGGCAAAGGAGAGA
                      ____________________________________________________________
consensus TAGGGAAAACAATGGGTAGAAAGAAACAGAAGGCTTCAGATCTTAGAGGCAAAGGAGAGA
 
. : . : . : . : . : . :
rJMFF051J07- CCCTGGTTTGCCATTTCGTCCAAGCTAAGAGCAGGAGGCTGAGCTCTAGCAACTTTTGCA
rJMFF049B08- CCCTGGTTTGCCATTTCGTCCAAGCTAAGAGCAGGAGGCTGAGCTCTAGCAACTTTTGCA
rJMFF035O14- CCCTGGTTTGCCATTTCGTCCAAGCTAAGAGCAGGAGGCTGAGCTCTAGCAACTTTTGCA
rJMFF026O19- CCCTGGTTTGCCATTTCGTCCAAGCTAAGAGCAGGAGGCTGAGCTCTAGCAACTTTTGCA
rJMFF030O09- CCCTGGTTTGCCATTTCGTCCAAGCTAAGAGCAGGAGGCTGAGCTCTAGCAACTTTTGCA
rJMFF034G21- CCCTGGTTTGCCATTTCGTCCAAGCTAAGAGCAGGAGGCTGAGCTCTAGCAACTTTTGCA
rJMFF050L01- CCCTGGTTTGCCATTTCGTCCAAGCTAAGAGCAGGAGGCTGAGCTCTAGCAACTTTTGCA
rJMFF045L02- CCCTGGTTTGCCATTTCGTCCAAGCTAAAAGCAGGAGGCTGAGCTCTACCAACTTTTGCA
rJMFF023L19- CCCTGGTTTGCCATTTCGTCCAAGCTAAGAGCAGGAGGCTGAGCTCTAGCAACTTTTGCA
rJMSF013M21- CCCTGGTTTGCCATTTCGTCCAAGCTAAGAGCAGGAGGCTGAGCTCTAGCAACTTTTGCA
rJMSF005O16- CCCTGGTTTGCCATTTCGTCCAAGCTAAGAGCAGGAGGCTGAGCTCTAGCAACTTTTGCA
rJMFF010H19- CCCTGGTTTGCCATTTCGTCCAAGCTAAGAGCAGGAGGCTGAGCTCTAGCAACTTTTGCA
rJMFF030H10- CCCTGGTTTGCCATTTCGTCCAAGCTAAGAGCAGGAGGCTGAGCTCTAGCAACTTTTGCA
rJMSF049A13- CCCTGGTTTGCCATTTCGTCCAAGCTAAGAGCAGGAGGCTGAGCTCTAGCAACTTTTGCA
rJMSF052P04- CCCTGGTTTGCCATTTCGTCCAAGCTAAGAGCAGGAGGCTGAGCTCTAGCAACTTTTGCA
                      ____________________________________________________________
consensus CCCTGGTTTGCCATTTCGTCCAAGCTAAGAGCAGGAGGCTGAGCTCTAGCAACTTTTGCA
 
. : . : . : . : . : . :
rJMFF051J07- ATAGCCTTGTTCTCTTCCGGAGTCCCGCTCTCCAAGAATGCACCCACAACCTTGCCATTT
rJMFF049B08- ATAGCCTTGTTCTCTTCCGGAGTCCCGCTCTCCAAGAATGCACCCACAACCTTGCCATTT
rJMFF035O14- ATAGCCTTGTTCTCTTCCGGAGTCCCGCTCTCCAAGAATGCACCCACAACCTTGCCATTT
rJMFF026O19- ATAGCCTTGTTCTCTTCCGGAGTCCCGCTCTCCAAGAATGCACCCACAACCTTGCCATTT
rJMFF030O09- ATAGCCTTGTTCTCTTCCGGAGTCCCGCTCTCCAAGAATGCACCCACAACCTTGCCATTT
rJMFF034G21- ATAGCCTTGTTCTCTTCCGGAGTCCCGCTCTCCAAGAATGCACCCACAACCTTGCCATTT
rJMFF050L01- ATAGCCTTGTTCTCTTCCGGAGTCCCGCTCTCCAAGAATGCACCCACAACCTTGCCATTT
rJMFF045L02- ATACCCTTGTTCTCTTCCGGAGTCCCGCTCTCCAAAAATGCACCCACAACCTTGCCATTT
rJMFF023L19- ATAGCCTTGTTCTCTTCCGGAGTCCCGCTCTCCAAGAATGCACCCACAACCTTGCCATTT
rJMSF013M21- ATAGCCTTGTTCTCTTCCGGAGTCCCGCTCTCCAAGAATGCACCCACAACCTTGCCATTT
rJMSF005O16- ATAGCCTTGTTCTCTTCCGGAGTCCCGCTCTCCAAGAATGCACCCACAACCTTGCCATTT
rJMFF010H19- ATAGCCTTGTTCTCTTCCGGAGTCCCGCTCTCCAAGAATGCACCCACAACCTTGCCATTT
rJMFF030H10- ATAGCCTTGTTCTCTTCCGGAGTCCCGCTCTCCAAGAATGCACCCACAACCTTGCCATTT
rJMSF049A13- ATAGCCTTGTTCTCTTCCGGAGTCCCGCTCTCCAAGAATGCACCCACAACCTTGCCATTT
rJMSF052P04- ATAGCCTTGTTCTCTTCCGGAGTCCCGCTCTCCAAGAATGCACCCACAACCTTGCCATTT
                      ____________________________________________________________
consensus ATAGCCTTGTTCTCTTCCGGAGTCCCGCTCTCCAAGAATGCACCCACAACCTTGCCATTT
 
. : . : . : . : . : . :
rJMFF051J07- TGGATCCAATATTGTCCAAACTTGTGATTTGGAGATTTTGGGTCATTATCTCCAAATAAC
rJMFF049B08- TGGATCCAATATTGTCCAAACTTGTGATTTGGAGATTTTGGGTCATTATCTCCAAATAAC
rJMFF035O14- TGGATCCAATATTGTCCAAACTTGTGATTTGGAGATTTTGGGTCATTATCTCCAAATAAC
rJMFF026O19- TGGATCCAATATTGTCCAAACTTGTGATTTGGAGATTTTGGGTCATTATCTCCAAATAAC
rJMFF030O09- TGGATCCAATATTGTCCAAACTTGTGATTTGGAGATTTTGGGTCATTATCTCCAAATAAC
rJMFF034G21- TGGATCCAATATTGTCCAAACTTGTGATTTGGAGATTTTGGGTCATTATCTCCAAATAAC
rJMFF050L01- TGGATCCAATATTGTCCAAACTTGTGATTTGGAGATTTTGGGTCATTATCTCCAAATAAC
rJMFF045L02- TGGATCCAATATTGTCCAAACTTGTGATTTGGAAATTTTGGGTCATTATCTCCAAATAAC
rJMFF023L19- TGGATCCAATATTGTCCAAACTTGTGATTTGGAGATTTTGGGTCATTATCTCCAAATAAC
rJMSF013M21- TGGATCCAATATTGTCCAAACTTGTGATTTGGAGATTTTGGGTCATTATCTCCAAATAAC
rJMSF005O16- TGGATCCAATATTGTCCAAACTTGTGATTTGGAGATTTTGGGTCATTATCTCCAAATAAC
rJMFF010H19- TGGATCCAATATTGTCCAAACTTGTGATTTGGAGATTTTGGGTCATTATCTCCAAATAAC
rJMFF030H10- TGGATCCAATATTGTCCAAACTTGTGATTTGGAGATTTTGGGTCATTATCTCCAAATAAC
rJMSF049A13- TGGATCCAATATTGTCCAAACTTGTGATTTGGAGATTTTGGGTCATTATCTCCAAATAAC
rJMSF052P04- TGGATCCAATATTGTCCAAACTTGTGATTTGGAGATTTTGGGTCATTATCTCCAAATAAC
                      ____________________________________________________________
consensus TGGATCCAATATTGTCCAAACTTGTGATTTGGAGATTTTGGGTCATTATCTCCAAATAAC
 
. : . : . : . : . : . :
rJMFF051J07- ACTGTTTCACCTACGTTGTCGCCAT
rJMFF049B08- ACTGTTTCACCTACGTTGTCGCCATAGAACTGCCAAGACAAATCAAAGGCACGAGAATAG
rJMFF035O14- ACTGTTTCACCTACGTTGTCGCCATAGAACTGCCAAGACAAATCAAAGGCACGAGAATAG
rJMFF026O19- ACTGTTTCACCTACGTTGTCGCCATAGAACTGCCAAGACAAATCAAAGGCACGAGAATAG
rJMFF030O09- ACTGTTTCACCTACGTTGTCGCCATAGAACTGCCAAGACAAATCAAAGGCACGAGAATAG
rJMFF034G21- ACTGTTTCACCTACGTTGTCGCCATAGAACTGCCAAGACAAATCAAAGGCACGAGAATAG
rJMFF050L01- ACTGTTTCACCTACGTTGTCGCCATAGAACTGCCAAGACAAATCAAAGGCACGAGAATAG
rJMFF045L02- ACTGTTTCACCTACGTTGTCCCCATAAAACTGCCAAAACAAATCAAAGGCACAAAAATAA
rJMFF023L19- ACTGTTTCACCTACGTTGTCGCCATAGAACTGCCAAGACAAATCAAAGGCACGAGAATAG
rJMSF013M21- ACTGTTTCACCTACGTTGTCGCCATAGAACTGCCAAGACAAATCAAAGGCACGAGAATAG
rJMSF005O16- ACTGTTTCACCTACGTTGTCGCCATAGAACTGCCAAGACAAATCAAAGGCACGAGAATAG
rJMFF010H19- ACTGTTTCACCTACGTTGTCGCCATAGAACTGCCAAGACAAATCAAAGGCACGAGAATAG
rJMFF030H10- ACTGTTTCACCTACGTTGTCGCCATAGAACTGCCAAGACAAATCAAAGGCACGAGAATAG
rJMSF049A13- ACTGTTTCACCTACGTTGTCGCCATAGAACTGCCAAGACAAATCAAAGGCACGAGAATAG
rJMSF052P04- ACTGTTTCACCTACGTTGTCGCCATAGAACTGCCAAGACAAATCAAAGGCACGAGAATAG
                      ____________________________________________________________
consensus ACTGTTTCACCTACGTTGTCGCCATAGAACTGCCAAGACAAATCAAAGGCACGAGAATAG
 
. : . : . : . : . : . :
rJMFF049B08- AAGTATGGAAGGTAGTCATACTCATCAATGGATGCCCCCTTTTCACTTGCAAAAATGGCC
rJMFF035O14- AAGTATGGAAGGTAGTCATACTCATCAATGGATGCCCCCTTTTCACTTGCAAAAATGGCC
rJMFF026O19- AAGTATGGAAGGTAGTCATACTCATCAATGGATGCCCCCTTTTCACTTGCAAAAATGGCC
rJMFF030O09- AAGTATGGAAGGTAGTCATACTCATCAATGGATGCCCCCTTTTCACTTGCAAAAATGGCC
rJMFF034G21- AAGTATGGAAGGTAGTCATACTCATCAATGGATGCCCCCTTTTCACTTGCAAAAATGGCC
rJMFF050L01- AAGTATGGAAGGTAGTCATACTCATCAATGGATGCCCCCTTTTCACTTGCAAAAATGGCC
rJMFF045L02- AATTATGGAAGGTAGCCATACTCATCAATGGATGCCCCCTTTTCACTTGCAAAAATGGCC
rJMFF023L19- AAGTATGGAAGGTAGTCATACTCATCAATGGATGCCCCCTTTTCACTTGCAAAAATGGCC
rJMSF013M21- AAGTATGGAAGGTAGTCATACTCATCAATGGATGCCCCCTTTTCACTTGCAAAAATGGCC
rJMSF005O16- AAGTATGGAAAGTAGTCATACTCATCAATGGATGCC
rJMFF010H19- AAGTATGGAAGGTAGTCATACTCATCAATGGATGCCCCCTTTTCACTTGCAAAAATGGCC
rJMFF030H10- AAGTATGGAAGGTAGTCATACTCATCAATGGATGCCCCCTTTTCACTTGCAAAAATGGCC
rJMSF049A13- AAGTATGGAAGGTAGTCATACTCATCAATGGATGCCCCCTTTTCACTTGCAAAAATGGCC
rJMSF052P04- AAGTATGGAAGGTAGTCATACTCATCAATGGATGCCCCCTTTTCACTTGCAAAAATGGCC
                      ____________________________________________________________
consensus AAGTATGGAAGGTAGTCATACTCATCAATGGATGCCCCCTTTTCACTTGCAAAAATGGCC
 
. : . : . : . : . : . :
rJMFF049B08- TTTACAGCCTGTTCAGCAGATTTGCGAGCATGATCAACATGTTCAACTCGTCTCTGCTCA
rJMFF035O14- TTTACAGCCTGTTCAGCAGATTTGCGAGCATGATCAACATGTTCAACTCGTCTCTGCTCA
rJMFF026O19- TTTACAGCCTGTTCAGCAGATTTGCGAGCATGATCAACATGTTCAACTCGTCTCTGCTCA
rJMFF030O09- TTTACAGCCTGTTCAGCAGATTTGCGAGCATGATCAACATGTTCAACTCGTCTCTGCTCA
rJMFF034G21- TTTACAGCCTGTTCAGCAGATTTGCGAGCATGATCAACATGTTCAACTCGTCTCTGCTCA
rJMFF050L01- TTTACAGCCTGTTCAGCAGATTTGCGAGCATGATCAACATGTTCAACTCGTCTCTGCTCA
rJMFF045L02- TTTACAGCCTGTTCAGCAAATTTGCGAGCATGATCAACATGTTCAACTCGTCTCTGCTCA
rJMFF023L19- TTTACAGCCTGTTCAGCAGATTTGCGAGCATGATCAACATGTTCAACTCGTCTCTGCTCA
rJMSF013M21- TTTACAGCCTGTTCAGCAGATTTGCGAGCATGATCAACATGTTCAACTCGTCTCTGCTCA
rJMFF010H19- TTTACAGCCTGTTCAGCAGATTTGCGAGCATGATCAACATGTTCAACTCGTCTCTGCTCA
rJMFF030H10- TTTACAGCCTGTTCAGCAGATTTGCGAGCATGATCAACATGTTCAACTCGTCTCTGCTCA
rJMSF049A13- TTTACAGCCTGTTCAGCAGATTTGCGAGCATGATCAACATGTTCAACTCGTCTCTGCTCA
rJMSF052P04- TTTACAGCCTGTTCAGCAGATTTGCGAGCATGATCAACATGTTCAACTCGTCTCTGCTCA
                      ____________________________________________________________
consensus TTTACAGCCTGTTCAGCAGATTTGCGAGCATGATCAACATGTTCAACTCGTCTCTGCTCA
 
. : . : . : . : . : . :
rJMFF035O14- TTGTATAGCTTCAAAGGGAAAGTGACTACATCACCAACAGCATATACATCAGGAACACTG
rJMFF026O19- TTGTATAGCTTCAAAGGGAAAGTGACTACATCACCAACAGCATATACATCAGGAACACTG
rJMFF030O09- TTGTATAGCTTCAAAGGGAAAGTGACTACATCACCAACAGCATATACATCAGGAACACTG
rJMFF034G21- TTGTATAGCTTCAAAGGGAAAGTGACTACATCACCAACAGCATATACATCAGGAACACTG
rJMFF050L01- TTGTATAGCTTCAAAGGGAAAGTGACTACATCACCAACAGCATATACATCAGGAAC
rJMFF045L02- TTGTATAGCTTCAAAGGGAAAGTGACTACTTCCCCAACAGCATATACTTCAGGAACACTG
rJMFF023L19- TTGTATAGCTTCAAAGGGAAAGTGACTACATCACCAACAGCATATACATCAGGAACACTG
rJMSF013M21- TTGTATAGCTTCAAAGGGAAAGTGACTACATCACCAACAGCATATACATCAGGAACACTG
rJMFF010H19- TTGTATAGCTTCAAAGGGAAAGTGACTACATCACCAACAGCATATACATCAGGAACACTG
rJMFF030H10- TTGTATAGCTTCAAAGGGAAAGTGACTACATCACCAACAGCATATACATCAGGAACACTG
rJMSF049A13- TTGTATAGCTTCAAAGGGAAAGTGACTACATCACCAACAGCATATACATCAGGAACACTG
rJMSF052P04- TTGTATAGCTTCAAAGGGAAAGTGACTACATCACCAACAGCATATACATCAGGAACACTG
                      ____________________________________________________________
consensus TTGTATAGCTTCAAAGGGAAAGTGACTACATCACCAACAGCATATACATCAGGAACACTG
 
. : . : . : . : . : . :
rJMFF035O14- G-TCTTAAAGAAAGCATCAGTCTTAATTCCCCCTTTCTCCT-CCTCAACTTGCCCT
rJMFF026O19- G-TCTTAAAGAAAGCATCAGTCTTAATTCCCCCTTTCTCCT-CCTCAACTTGCCCTTTAA
rJMFF030O09- G-TCTTAAAGAAAGCATCAGTCTTAATTCCCCCTTTCTCCT-CCTCAACTTGCCCTTTAA
rJMFF034G21- G-TCTTAAAGAAAGCATCAGTCTTAATTCCCCCTTTCTCCTCCCTCAACTTGCCCTTTAA
rJMFF045L02- GCTCTTAAAGAAAGCATCAGTCTTAATTCCCCCTTT
rJMFF023L19- G-TCTTAAAGAAAGCATCAGTCTTAATTCCCCCTTTCTCCT-CCTCAACTTGCCCTTTAA
rJMSF013M21- G-TCTTAAAGAAAGCATCAGTCTTAATTCCCCCTTTCTCCT-CCTCAACTTGCCCTTTAA
rJMFF010H19- G-TCTTAAAGAAAGCATCAGTCTTAATTCCCCCTTTCTCCT-CCTCAACTTGCCCTTTAA
rJMFF030H10- G-TCTTAAAGAAAGCATCAGTCTTAATTCCCCCTTTCTCCT-CCTCAACTTGCCCTTTAA
rJMSF049A13- G-TCTTAAAGAAAGCATCAGTCTTAATTCCCCCTTTCTCCT-CCTCAACTTGCCCTTTAA
rJMSF052P04- G-TCTTAAAGAAAGCATCAGTCTTAATTCCCCCTTTCTCCT-CCTCAACTTGCCCTTTAA
                      ____________________________________________________________
consensus G-TCTTAAAGAAAGCATCAGTCTTAATTCCCCCTTTCTCCT-CCTCAACTTGCCCTTTAA
 
. : . : . : . : . : . :
rJMFF026O19- ATAATATTGTAAGAGGCTTTGCACCAACACCTACNACTACNATGTCAGCTTCCAATGACC
rJMFF030O09- AT
rJMFF034G21- ATAATATTGTAAGAGGCTTTGCACCAACACCTACAACTACAATGTCAGCTTCCAATGACC
rJMFF023L19- ATAATATTGTAAGANGCTTTGCACCAACACCTACNACTACNATGTCAGCTTCCAATGACC
rJMSF013M21- ATAATATTGTAAGAGGCTTTGCACCAACACCTACAACTACAATGTCAGCTTCCAATGACC
rJMFF010H19- ATAATATTGTAAGAGGCTTTGCACCAACACCTACAACTACNATGTCAGCTTCCAATGACC
rJMFF030H10- ATAATATTGTAAGAGGCTTTGCACCAACACCTACAACTACAATGTCAGCTTCCAATGACC
rJMSF049A13- ATAATATTGTAAGAGGCTTTGCACCAACACCTACAACTACAATGTCAGCTTCCAATGACC
rJMSF052P04- ATAATATTGTAAGAGGCTTTGCACCAACACCTACAACTACAATGTCAGCTTCCAATGACC
                      ____________________________________________________________
consensus ATAATATTGTAAGAGGCTTTGCACCAACACCTACAACTACAATGTCAGCTTCCAATGACC
 
. : . : . : . : . : . :
rJMFF026O19- TACCATCCTTCAGTTTAACTTCCTTTACCTCCC
rJMFF034G21- TACCATCCTTCAGTTTAACTTCCTTTACCTC
rJMFF023L19- TACCATCCTTCAGTTTAACTTCCTTTACCTCCC
rJMSF013M21- TACCATCCTTCAGTTTAACTTCCTTTACCTCCCCATTAGGATGGGTGTCAAACCCAACTG
rJMFF010H19- TACCATCCTTCAGNTTAACTTCCTTTACCTCCCC
rJMFF030H10- TACCATCCTTCAGTTTAACTTCCTTTACCTCCCCA
rJMSF049A13- TACCATCCTTCAGTTTAACTTCCTTTACCTCCCCATTAGGATGGGTGTCAAACCCAACTG
rJMSF052P04- TACCATCCTTCAGTTTAACTTCCTTTACCTCCCCATTAGGATGGGTGTCAAACCCAACTG
JMFF026E24+ CCCCGTTAGGATGGGTTTCAAATCCAGATG
                      ____________________________________________________________
consensus TACCATCCTTCAGTTTAACTTCCTTTACCTCCCCATTAGGATGGGTGTCAAACCCAACTG
 
. : . : . : . : . : . :
rJMSF013M21- CTACAGTACCTTTGATGATTTTGAC
rJMSF049A13- CTACAGTACCTTTGATGATTTTGAC
rJMSF052P04- CTACAGTACCTTTGATGATTTTGACTCCCTTGTTTTCATAGTATCCTTCATAGAAAGCTG
JMFF026E24+ CTACAGTACCCTTGATGATTTTGATTCCCTTGTTCTGATAATATCCTTCATAGAAATTGG
                      ____________________________________________________________
consensus CTACAGTACCTTTGATGATTTTGACTCCCTTGTTTTGATAGTATCCTTCATAGAAATTTG
 
. : . : . : . : . : . :
rJMSF052P04- CTATGCTAGCTGTGAAAAGCCTAGGCATGCACCATGGTTCTGGGAATACCATAGTAACAT
JMFF026E24+ CAATTCCAGCTGTGAAAAGCCTAGGCATGCACCATGGTTCTGGGTATACCATACTGACAT
JMFS069F01+ TGGGAATACCATAGTAACAT
JMSF049A13+ AGCTGTGAAAAGCCTAGGCATGCACCATGGTTCTGGGAATACCATAGTAACAT
                      ____________________________________________________________
consensus CTATTCTAGCTGTGAAAAGCCTAGGCATGCACCATGGTTCTGGGAATACCATAGTAACAT
 
. : . : . : . : . : . :
rJMSF052P04- CAATGTTGTTCATCCTGAGCACAGCACTGAGTTCAAGTCCAATGTACCCTCCCCCAACAA
JMFF026E24+ CTATATTGTTCATTTTGAGCGCAGCACTAAGCTCAAGACCAATGTACCCTCCACCAACAA
JMFS069F01+ CAATGTTGTTCATCCTGAGCACAGCACTGAGTTCAAGTCCAATGTACCCTCCCCCAACAA
JMFF049B08+ GTCCAATGTACCCTCCCCCAACAA
JMFF050L01+ TGAGTTCAAGTCCAATGTACCCTCCCCCAACAA
JMSF052P04+ GCACTGAGTTCAAGTCCAATGTACCCTCCCCCAACAA
JMSF049A13+ CAATGTTGTTCATCCTGAGCACAGCACTGAGTTCAAGTCCAATGTACCCTCCCCCAACAA
JMFF045L02+ TTCAAGTCCAATGTACCCTCCCCCAACAA
                      ____________________________________________________________
consensus CAATGTTGTTCATCCTGAGCACAGCACTGAGTTCAAGTCCAATGTACCCTCCCCCAACAA
 
. : . : . : . : . : . :
rJMSF052P04- CAACAGCTTTTTCCATTTTTCTTTGCCTTTATTGCTTCACNAAGCTTATCTGCTTCATCA
JMFF026E24+ TAACAGC-CTTCCCATCTTTCTTTTCCTTGATTGCTTCCACAAGCTTATCTACATCATTA
JMFS069F01+ CAACAGC-TTTTCCATTTTTCTTTGCCTTTATTGCTTCAACAAGCTTATCTGCTTCATCA
JMFF049B08+ CAACAGC-TTTTCCATTTTTCTTTGCCTNTATTGCTTCAACAAGCTTATCTGCTTCATCA
JMFF050L01+ CAACAGC-TTTTCCATTTTTCTTTGCCTTTATGCTTTCAACAAGCTTATCTGCTTCATCA
JMSF052P04+ CAACAGC-TNTTCCATTTTTCTNTGCCTTTATTGCTTCAACAAGCTTATNTGCTTCATCA
JMFF034G21+ CCATTTTTCTTTGCCTTTATTGCTTCAACAAGCTTATCTGCTTCATCA
JMFF026O19+ TTTCCATTTTTCTTTGCCTTTATTGCTTCAACAAGCTTATCTGCTTCATCA
JMFF010J17+ TTTTCCATTTTTCTTTGCCTTTATTGCTTCAACAAGCTTATCTGCTTCATCA
JMSF013M21+ TTCATCA
JMFF010H19+ TTTTCCATTTTTCTTTGCCTTTATTGCTTCAACAAGCTTATCTGCTTCATCA
JMFF038O10+ CTTTATTGCTTCAACAAGCTTATNTGCTTCATCA
JMSF049A13+ CAACAGC-TTTTCCATTTTTCTTTGCCTTTATTGCTTCAACAAGCTTATCTGCTTCATCA
JMFF045L02+ CAACAGC-TTTTCCATTTTTCTTTGCCTTTATGCTTTCAACAAGCTTATCTGCTTCATCA
                      ____________________________________________________________
consensus CAACAGC-TTTTCCATTTTTCTTTGCCTTTATTGCTTCAACAAGCTTATCTGCTTCATCA
 
. : . : . : . : . : . :
rJMSF052P04- ATTTCTCT
JMFF026E24+ ATATCTCTCAAGTAGAAGATGTTTTTAGCATCAGCACCTTGCACACCAAAATCTGATAAT
JMFS069F01+ ATTTCTCTCAAGTAGAAGATGTTTTTGGAGTCAGCACCTTGTACACCAAAGTCCGACAAC
JMFF049B08+ ATTTCTCTCAAGTAGAAGATGTTTTTGGAGTCAGCACCTTGTACACCAAAGTCCGACAAC
JMFF050L01+ ATTTCTCTCAAGTAGAAGATGTTTTTGGAGTCAGCACCTTGTACACCAAAGTCCGACAAC
JMSF052P04+ ATTTCTCTCAAGTAGAAGATGTTTTTGGAGTCAGCACCTTGTACACCAAAGTCCGACAAC
JMFF034G21+ ATTTCTCTCAAGTAGAAGATGTTTTTGGAGTCAGCACCTTGTACACCAAAGTCCGACAAC
JMFF026O19+ ATTTCTCTCAAGTAGAAGATGTTTTTGGAGTCAGCACCTTGTACACCAAAGTCCGACAAC
JMFF010J17+ ATTTCTCTCAAGTAGAAGATGTTTTTGGAGTCAGCACCTTGTACACCAAAGTCCGACAAC
JMFF023L19+ CCGACAAC
JMSF013M21+ ATTTCTCTCAAGTAGAAGATGTTTTTGGAGTCAGCACCTTGTACACCAAAGTCCGACAAC
JMFF010H19+ ATTTCTCTCAAGTAGAAGATGTTTTTGGAGTCAGCACCTTGTACACCAAAGTCCGACAAC
JMFF038O10+ ATTTCTCTCAAGTAGAAGATGTTTTTGGAGTCAGCACCTTGTACACCAAAGTCCGACAAC
JMSF049A13+ ATTTCTCTCAAGTAGAAGATGTTTTTGGAGTCAGCACCTTGTACACCAAAGTCCGACAAC
JMFF051J07+ CAAGTAGAAGATGTTTTTGGAGTCAGCACCTTGTACACCAAAGTCCGACAAC
JMFF045L02+ ATTTCTCTCAAGTAGAAGATGTTTTTGGAGTCAGCACCTTGTACACCAAAGTCCGACAAC
                      ____________________________________________________________
consensus ATTTCTCTCAAGTAGAAGATGTTTTTGGAGTCAGCACCTTGTACACCAAAGTCCGACAAC
 
. : . : . : . : . : . :
JMFF026E24+ CTTATAACCGTTGAACCAGTTGCAATAACCAGTACTTCATATGTGAATGATTCCCCTGCT
JMFS069F01+ CTTAGAACTGTGGAACCAGTTGCAATAATCAACACTTCATATTTAAATGATTCTCCAGCA
JMFF049B08+ CTTAGAACTGTGGAACCAGTTGCAATAATCAACACTTCATATTTAAATGATTCTCCAGCA
JMFF050L01+ CTTAGAACTGTGGAACCAGTTGCAATAATCAACACTTCATATTTAAATGATTCTCCAGCA
JMSF052P04+ CTTAGAACTGTGGAACCAGTTGCAATAATCAACACTTCATATTTAAATGATTCTCCAGCA
JMFF034G21+ CTTAGAACTGTGGAACCAGTTGCAATAATCAACACTTCATATTTAAATGATTCTCCAGCA
JMFF026O19+ CTTAGAACTGTGGAACCAGTTGCAATAATCAACACTTCATATTTAAATGATTCTCCAGCA
JMFF010J17+ CTTAGAACTGTGGAACCAGTTGCAATAATCAACACTTCATATTTAAATGATTCTCCAGCA
JMFF023L19+ CTTAGAACTGTGGAACCAGTTGCAATAATCAACACTTCATATTTAAATGATTCTCCAGCA
JMSF013M21+ CTTAGAACTGTGGAACCAGTTGCAATAATCAACACTTCATATTTAAATGATTCTCCAGCA
JMFF030O09+ TTCTCCAGCA
JMFF010H19+ CTTAGAACTGTGGAACCAGTTGCAATAATCAACACTTCATATTTAAATGATTCTCCAGCA
JMFF038O10+ CTTAGAACTGTGGAACCAGTTGCAATAATCAACACTTCATATTTAAATGATTCTCCAGCA
JMSF049A13+ CTTAGAACTGTGGAACCAGTTGCAATAATCAACACTTCATATTTAAATGATTCTCCAGCA
JMFF051J07+ CTTAGAACTGTGGAACCAGTTGCAATAATCAACACTTCATATTTAAATGATTCTCCAGCA
JMFF045L02+ CTTAGAACTGTGGAACCAGTTGCAATAATCAACACTTCATATTTAAATGATTCTCCAGCA
JMFF030H10+ CTTCATATTTAAATGATTCTCCAGCA
                      ____________________________________________________________
consensus CTTAGAACTGTGGAACCAGTTGCAATAATCAACACTTCATATTTAAATGATTCTCCAGCA
 
. : . : . : . : . : . :
JMFF026E24+ GCACTAACAAGTTTCTTTGAAGCAAGATCAACTTCAACAATCTCCGTACCCAGGATCAAT
JMFS069F01+ GCACTAGTAAGTGTCTTTGAAGCAAGATCTGCTTTCACAATTTCTGTACCAAGGATCAAT
JMFF049B08+ GCACTAGTAAGTGTCTTTGAAGCAAGATCTGCTTTCACAATTTCTGTACCAAGGATCAAT
JMFF050L01+ GCACTAGTAAGTGTCTTTGAAGCAAGATCTGCTTTCACAATTTCTGTACCAAGGATCAAT
JMSF052P04+ GCANTAGTAAGTGTCTTTGAAGCAAGATCTGCTTTCACAATTTCTGTACCAAGGATCAAT
JMFF034G21+ GCACTAGTAAGTGTCTTTGAAGCAAGATCTGCTTTCACAATTTCTGTACCAAGGATCAAT
JMFF026O19+ GCACTAGTAAGTGTCTTTGAAGCAAGATCTGCTTTCACAATTTCTGTACCAAGGATCAAT
JMFF010J17+ GCACTAGTAAGTGTCTTTGAAGCAAGATCTGCTTTCACAATTTCTGTACCAAGGATCAAT
JMFF023L19+ GCACTAGTAAGTGTCTTTGAAGCAAGATCTGCTTTCACAATTTCTGTACCAAGGATCAAT
JMSF013M21+ GCACTAGTAAGTGTCTTTGAAGCAAGATCTGCTTTCACAATTTCTGTACCAAGGATCAAT
JMFF030O09+ GCACTAGTAAGTGTCTTTGAAGCAAGATCTGCTTTCACAATTTCTGTACCAAGGATCAAT
JMFF010H19+ GCACTAGTAAGTGTCTTTGAAGCAAGATCTGCTTTCACAATTTCTGTACCAAGGATCAAT
JMFF038O10+ GCACTAGTAAGTGTCTTTGAAGCAAGATCTGCTTTCACAATTTCTGTACCAAGGATCAAT
JMSF049A13+ GCACTAGTAAGTGTCTTTGAAGCAAGATCTGCTTTCACAATTTCTGTACCAAGGATCAAT
JMFF051J07+ GCACTAGTAAGTGTCTTTGAAGCAAGATCTGCTTTCACAATTTCTGTACCAAGGATCAAT
JMFF045L02+ GCACTAGTAAGTGTCTTTGAAGCAAGATCTGCTTTCACAATTTCTGTACCAAGGATCAAT
JMFF030H10+ GCACTAGTAAGTGTCTTNGAAGCAAGATCTGCTTTCACAATTTCTGTACCAAGGATCAAT
                      ____________________________________________________________
consensus GCACTAGTAAGTGTCTTTGAAGCAAGATCTGCTTTCACAATTTCTGTACCAAGGATCAAT
 
. : . : . : . : . : . :
JMFF026E24+ GAAATACCTTTCTCTGTGTACCACTCAGGAAGTA
JMFS069F01+ GAAATCCCTTTCTCTGTGTACCACTCAGGGAGTAGTCTCTCCCCTCCACTCCCAACACAT
JMFF049B08+ GAAATCCCTTTCTCTGTGTACCACTCAGGGAGTAGTCTCTCCCCTCCACTCCCAACACAT
JMFF050L01+ GAAATCCCTTTCTCTGTGTACCACTCAGGGAGTAGTCTCTCCCCTCCACTCCCAACACAT
JMSF052P04+ GAAATCCCTTTCTCTGNGTACCACTCAGGGAGTAGTCTCTCCCCTCCACTCCCAACACAT
JMFF034G21+ GAAATCCCTTTCTCTGTGTACCACTCAGGGAGTAGTCTCTCCCCTCCACTCCCAACACAT
JMFF026O19+ GAAATCCCTTTCTCTGTGTACCACTCAGGGAGTAGTCTCTCCCCTCCACTCCCAACACAT
JMFF010J17+ GAAATCCCTTTCTCTGTGTACCACTCAGGGAGTAGTCTCTCCCCTCCACTCCCAACACAT
JMFF023L19+ GAAATCCCTTTCTCTGTGTACCACTCAGGGAGTAGTCTCTCCCCTCCACTCCCAACACAT
JMSF013M21+ GAAATCCCTTTCTCTGTGTACCACTCAGGGAGTAGTCTCTCCCCTCCACTCCCAACACAT
JMFF030O09+ GAAATCCCTTTCTCTGTGTACCACTCAGGGAGTAGTCTCTCCCCTCCACTCCCAACACAT
JMFF010H19+ GAAATCCCTTTCTCTGTGTACCACTCAGGGAGTAGTCTCTCCCCTCCACTCCCAACACAT
JMFF038O10+ GAAATCCCTTTCTCTGTGTACCACTCAGGGAGTAGTCTCTCCCCTCCACTCCCAACACAT
JMSF006A02+ AACACAT
JMSF049A13+ GAAATCCCTTTCTCTGTGTACCACTCAGGGAGTAGTCTCTCCCCTCCACTCCCAACACAT
JMFF051J07+ GAAATCCCTTTCTCTGTGTACCACTCAGGGAGTAGTCTCTCCCCTCCACTCCCAACACAT
JMFF045L02+ GAAATCCCTTTCTCTGTGTACCACTCAGGGAGTAGTCTCTCCCCTCCACTCCCAACACAT
JMFF030H10+ GAAATCCCTTTCTCTGTGTACCACTCAGGGAGTAGTCTCTCCCCTCCACTCCCAACACAT
                      ____________________________________________________________
consensus GAAATCCCTTTCTCTGTGTACCACTCAGGGAGTAGTCTCTCCCCTCCACTCCCAACACAT
 
. : . : . : . : . : . :
JMFS069F01+ ACATGAAAGCCTGGGAGTCTTGCAGCACCTTCAGGAAAGAGATACCCTTTGCTAAGAGCT
JMFF049B08+ ACATGAAAGCCTGGGAGTCTTGCAGCACCTTCAGGAAAGAGATACCCTTTGCTAAGAGCT
JMFF050L01+ ACATGAAAGCCTGGGAGTCTTGCAGCACCTTCAGGAAAGAGATACCCTTTGCTAAGAGCT
JMSF052P04+ ACATGAAAGCCTGGGAGTCTTGCAGCACCTTCAGGAAAGAGATACCCTTTGCTAAGAGCT
JMFF034G21+ ACATGAAAGCCTGGGAGTCTTGCAGCACCTTCAGGAAAGAGATACCCTTTGCTAAGAGCT
JMFF026O19+ ACATGAAAGCCTGGGAGTCTTGCAGCACCTTCAGGAAAGAGATACCCTTTGCTAAGAGCT
JMFF010J17+ ACATGAAAGCCTGGGAGTCTTGCAGCACCTTCAGGAAAGAGATACCCTTTGCTAAGAGCT
JMFF023L19+ ACATGAAAGCCTGGGAGTCTTGCAGCACCTTCAGGAAAGAGATACCCTTTGCTAAGAGCT
JMSF013M21+ ACATGAAAGCCTGGGAGTCTTGCAGCACCTTCAGGAAAGAGATACCCTTTGCTAAGAGCT
JMFF030O09+ ACATGAAAGCCTGGGAGTCTTGCAGCACCTTCAGGAAAGAGATACCCTTTGCTAAGAGCT
JMFF010H19+ ACATGAAAGCCTGGGAGTCTTGCAGCACCTTCAGGAAAGAGATACCCTTTGCTAAGAGCT
JMFF038O10+ ACATGAAAGCCTGGGAGTCTTGCAGCACCTTCAGGAAAGAGATACCCTTTGCTAAGAGCT
JMSF006A02+ ACATGAAAGCCTGGGAGTCTTGCAGCACCTTCAGGAAAGAGATACCCTTTGCTAAGAGCT
JMSF049A13+ ACATGAAAGCCTGGGAGTCTTGCAGCACCTTCAGGAAAGAGATACCCTTTGCTAAGAGCT
JMFF051J07+ ACATGAAAGCCTGGGAGTCTTGCAGCACCTTCAGGAAAGAGATACCCTTTGCTAAGAGCT
JMFF045L02+ ACATGAAAGCCTGGGAGTCTTGCAGCACCTTCAGGAAAGAGATACCCTTTGCTAAGAGCT
JMSF005O14+ AGAGATACCCTTTGCTAAGAGCT
JMFF030H10+ ACATGAAAGCCTGGGAGTCTTGCAGCACCTTCAGGAAAGAGATACCCTTTGCTAAGAGCT
                      ____________________________________________________________
consensus ACATGAAAGCCTGGGAGTCTTGCAGCACCTTCAGGAAAGAGATACCCTTTGCTAAGAGCT
 
. : . : . : . : . : . :
JMFS069F01+ GGGCGTTCGTATGGAGCCACTGCCTCTTTGGAAATAAGTGCTAGTTCACCAGGCTTAACT
JMFF049B08+ GGGCGTTCGTATGGAGCCACTGCCTCTTTGGAAATAAGTGCTAGTTCACCAGGCTTAACT
JMFF050L01+ GGGCGTTCGTATGTAGCCACTGCCTCTTTGGAAATAAGTGCTAGTTCACCAGGCTTAACT
JMSF052P04+ GGGCGTTCGTATGGAGCCACTGCCTCTTTGGAAATAAGTGNTAGTTCACCAGGCTTAACT
JMFF034G21+ GGGCGTTCGTATGGAGCCACTGCCTCTTTGGAAATAAGTGCTAGTTCACCAGGCTTAACT
JMFF026O19+ GGGCGTTCGTATGGAGCCACTGCCTCTTTGGAAATAAGTGCTAGTTCACCAGGCTTAACT
JMFF010J17+ GGGCGTTCGTATGGAGCCACTGCCTCTTTGGAAATAAGTGCTAGTTCACCAGGCTTAACT
JMFF023L19+ GGGCGTTCGTATGGAGCCACTGCCTCTTTGGAAATAAGTGCTAGTTCACCAGGCTTAACT
JMSF013M21+ GGGCGTTCGTATGGAGCCACTGCCTCTTTGGAAATAAGTGCTAGTTCACCAGGCTTAACT
JMFF030O09+ GGGCGTTNGTATGGAGCCACTGCCTCTTTGGAAATAAGTGCTAGTTCACCAGGCTTAACT
JMFF010H19+ GGGCGTTCGTATGGAGCCACTGCCTCTTTGGAAATAAGTGCTAGTTCACCAGGCTTAACT
JMFF038O10+ GGGCGTTCGTATGGAGCCACTGCCTCTTTGGAAATAAGTGCTAGTTCACCAGGCTTAACT
JMSF006A02+ GGGCGTTCGTATGGAGCCACTGCCTCTTTGGAAATAAGTGCTAGTTCACCAGGCTTAACT
JMSF049A13+ GGGCGTTCGTATGGAGCCACTGCCTCTTTGGAAATAAGTGCTAGTTCACCAGGCTTAACT
JMFF051J07+ GGGCGTTCGTATGGAGCCACTGCCTCTTTGGAAATAAGTGCTAGTTCACCAGGCTTAACT
JMFF045L02+ GGGCGTTCGTATGGAGCCACTGCCTCTTTGGAAATAAGTGCTAGTTCACCAGGCTTAACT
JMSF005O14+ GGGCGTTCGTATGGAGCCACTGCCTCTTTGGAAATAAGTGCTAGTTCACCAGGCTTAACT
JMFF030H10+ GGGCGTTCGTATGGAGCCACTGCCTCTTTGGAAATAAGTGCTAGTTCACCAGGCTTAACT
                      ____________________________________________________________
consensus GGGCGTTCGTATGGAGCCACTGCCTCTTTGGAAATAAGTGCTAGTTCACCAGGCTTAACT
 
. : . : . : . : . : . :
JMFS069F01+ CCCTGTTTGGAAAATTCCCTAGCAGCATAACCGGCAGCAACGCCGCCACCGAGAATCACA
JMFF049B08+ CCCTGTTTGGAAAATTCCCTAGCAGCATAACCGGCAGCAACGCCGCCACCGAGAATCACA
JMFF050L01+ CCCTGTTTGGAAAATTCCCTAGCAGCATAACCGGCAGCAACGCCGCCACCGAGAATCACA
JMSF052P04+ CCCTGTTTGGAAAATTCCCTAGCAGCATAACCGGCAGCAACGCCGCCACCGAGAATCACA
JMFF034G21+ CCCTGTTTGGAAAATTCCCTAGCAGCATAACCGGCAGCAACGCCGCCACCGAGAATCACA
JMFF026O19+ CCCTGTTTGGAAAATTCCCTAGCAGCATAACCGGCAGCAACGCCGCCACCGAGAATCACA
JMFF010J17+ CCCTGTTTGGAAAATTCCCTAGCAGCATAACCGGCAGCAACGCCGCCACCGAGAATC
JMFF023L19+ CCCTGTTTGGAAAATTCCCTAGCAGCATAACCGGCAGCAACGCCGCCACCGAGAATCACA
JMSF013M21+ CCCTGTTTGGAAAATTCCCTAGCAGCATAACCGGCAGCAACGCCGCCACCGAGAATCACA
JMFF030O09+ CCCTGTTTGGAAAATTCCCTAGCAGCATAACCGGCAGCAACGCCGCCACCGAGAATCACA
JMFF010H19+ CCCTGTTTGGAAAATTCCCTAGCAGCATAACCGGCAGCAACGCCGCCACCGAGAATCACA
JMFF038O10+ CCCTGTTTGGAAAATTCCCTAGCAGCATAACCGGCAGCAACGCCGCCACCGAGAATCACA
JMSF006A02+ CCCTGTTTGGAAAATTCCCTAGCAGCATAACCGGCAGCAACGCCGCCACCGAGAATCACA
JMSF049A13+ CCCTGTTTGGAAAATTCCCTAGCAGCATAACCGGCAGCAACGCCGCCACCGAGAATCACA
JMFF051J07+ CCCTGTTTGGAAAATTCCCTAGCAGCATAACCGGCAGCAACGCCGCCACCGAGAATCACA
JMFF045L02+ CCCTGTTTGGAAAATTCCCTAGCAGCATAACCGGCAGCAACGCCGCCACCGAGAATCACA
JMSF005O14+ CCCTGTTTGGAAAATTCCCTAGCAGCATAACCGGCAGCAACGCCGCCACCGAGAATCACA
JMFF030H10+ CCCTGTTTGGAAAATTCCCTAGCAGCATAACCGGCAGCAACGCCGCCACCGAGAATCACA
                      ____________________________________________________________
consensus CCCTGTTTGGAAAATTCCCTAGCAGCATAACCGGCAGCAACGCCGCCACCGAGAATCACA
 
. : . : . : . : . : . :
JMFS069F01+ TACTTGAATGATTTCTCCGCCATAGCTCCGATTCAACGAACAGATATTGGTCGCTCCTTA
JMFF049B08+ TACTTGAATGATTTCTCCGCCATAGCTCCGATTCAACGAACAGATATTGGTCGCTCCTTA
JMFF050L01+ TACTTGAATGATTTCTCCGCCATAGCTCCGATTCAACGAACAGATATTGGTCGCTCCTTA
JMSF052P04+ TACTTGAATGATTTCTCCGCCATAGCTCCGATTCAACGAACAGATATTGGTCGCTCCTTA
JMFF034G21+ TACTTGAATGATTTCTCCGCCATAGCTCCGATTCAACGAACAGATATTGGTCGCTCCTTA
JMFF026O19+ TACTTGAATGATTTCTCCGCCATAGCTCCGATTCAACGAACAGATATTGGTCGCTCCTTA
JMFF023L19+ TACTTGAATGATTTCTCCGCCATAGCTCCGATTCAACGAACAGATATTGGTCGCTCCTTA
JMSF013M21+ TACTTGAATGATTTCTCCGCCATAGCTCCGATTCAAC
JMFF030O09+ TACTTGAATGATTTCTCCGCCATAGCTCCGATTCAACGAACAGATATTGGTCGCTCCTTA
JMFF010H19+ TACTTGAATGATTTCTCCGCCATAGCTCCGATTCAACGAACAGATATTGGTCGCTCCTTA
JMFF038O10+ TACTTGAATGATTTCTCCGCCATAGCTCCGATTCAACGAACAGATATTGGTCGCTCCTTA
JMSF006A02+ TACTTGAATGATTTCTCCGCCATAGCTCCGATTCAACGAACAGATATTGGTCGCTCCTTA
JMSF049A13+ TACTTGAATGATTTCTCCGCCATAGCTCCGATTCAACGAACAGATATTGGTCGCTCCTTA
JMFF051J07+ TACTTGAATGATTTCTCCGCCATAGCTCCGATTCAACGAACAGATATTGGTCGCTCCTTA
JMFF045L02+ TACTTGAATGATTTCTCCGCCATAGCTCCGATTCAACGAACAGATATTGGTCGCTCCTTA
JMSF005O14+ TACTTGAATGATTTCTCCGCCATAGCTCCGATTCAACGAACAGATATTGGTCGCTCCTTA
JMFF030H10+ TACTTGAATGATTTCTCCGCCATAGCTCCGATTCAACGAACAGATATTGGTCGCTCCTTA
                      ____________________________________________________________
consensus TACTTGAATGATTTCTCCGCCATAGCTCCGATTCAACGAACAGATATTGGTCGCTCCTTA
 
. : . : . : . : . : . :
JMFS069F01+ GC
JMFF049B08+ GCTCGATTATAGTAGAAATGGGAATCCGTACGGACAAACTTGAGACAAT
JMFF050L01+ GCTCGATTATAGTAGAAATGGGAATCCGTACGGACAAACTTGAGACAAT
JMSF052P04+ GCTCGATTATAGTAGAAATGGGAATCCGTACGGACAAACTTGAGA
JMFF034G21+ GCTCGATTATAGTAGAAATGGGAATCCGTACGGACAAACTTGAGAC
JMFF026O19+ GCTCGATTATAGTAGAAATGGGAATCCGTACGGACAAACT
JMFF023L19+ GCTCGATTATAGTAGAAATGGGAATCCGTACGGACAAACT
JMFF030O09+ GCTCGATTATAGTAGAAATGGGAATCCGTACGGACAAACTTGAGAC
JMFF010H19+ GCTCGATTATAGTAGAAATGGGAATCCGTACGGACAAACTTGAGAC
JMFF038O10+ GCTCGATTATAGTAGAAATGGGAATCCGTACGGACAAACTTGAGAC
JMSF006A02+ GCTCGATTATAGTAGAAATGGGAATCCGTACGGACAAACTTGAGAC
JMSF049A13+ GCTCGATTATAGTAGAAATGGGAATCCGTACGGACAAACTTGAGACAAT
JMFF051J07+ GCTCGATTATAGTAGAAATGGGAATCCGTACGGACAAACTTGAGACAAT
JMFF045L02+ GCTCGATTATAGTAGAAATGGGAATCCGTACGGACAAACTTGAGACAATTTGATGAGAAC
JMSF005O14+ GCTCGATTATAGTAGAAATGGGAATCCGTACGGACAAACTTGAGACAA
JMFF030H10+ GCTCGATTATAGTAGAAATGGGAATCCGTACGGACAAACTTGAGACAATTTGATGAGAAC
                      ____________________________________________________________
consensus GCTCGATTATAGTAGAAATGGGAATCCGTACGGACAAACTTGAGACAATTTGATGAGAAC