Previous Contig 001385:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001N04Sequence195001385 (6)gb:ATF5E19_15507653e-04Arabidopsis thaliana DNA chromosome 5, BAC clone F5E19 (ESSA project).>gb:ATI134700010912 (6)gb:AE016959_10239631e-25Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC01
JMFF018E20Sequence567001385 (6)gb:AY172635_15867815e-43Zea mays inositol phosphate kinase mRNA, complete cds.696010912 (6)gb:ATF5E19_15507658e-24Arabidopsis thaliana DNA chromosome 5, BAC clone F5E19 (ESSA project).>gb:ATI134
JMFF023A23Sequence409001385 (6)gb:AY172635_15867819e-29Zea mays inositol phosphate kinase mRNA, complete cds.691010912 (6)gb:ATF5E19_15507652e-23Arabidopsis thaliana DNA chromosome 5, BAC clone F5E19 (ESSA project).>gb:ATI134
JMFF030F12Sequence515001385 (6)gb:AY172635_15867819e-16Zea mays inositol phosphate kinase mRNA, complete cds.632010912 (6)gb:AE016959_10239631e-18Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC01
JMFF049I05Sequence505001385 (6)gb:AY172635_15867811e-32Zea mays inositol phosphate kinase mRNA, complete cds.497010912 (6)
JMSF033H17Sequence140001385 (6)686010912 (6)gb:ATF5E19_15507651e-25Arabidopsis thaliana DNA chromosome 5, BAC clone F5E19 (ESSA project).>gb:ATI134

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF018E20+ GTTGA
                      ____________________________________________________________
consensus GTTGA
 
. : . : . : . : . : . :
JMFF049I05+ TCA
JMFF018E20+ ACACGAGCAGCATCTTGTGCGATTTGGCGCTGCCGTCCGCGACTAGCGGCTTGGCAATCA
                      ____________________________________________________________
consensus ACACGAGCAGCATCTTGTGCGATTTGGCGCTGCCGTCCGCGACTAGCGGCTTGGCAATCA
 
. : . : . : . : . : . :
JMFF049I05+ CGGGGAAC-TGAGCCCCTCGGTGGTCCATGTCCAAGGCCGACACCATTGNCGCGTCGTAG
JMFF018E20+ CGGGGAACTTGAGCCCCTCGGT-GTCCATGTCCAAGGCCGACACCATTTGCGCGTCGTAG
                      ____________________________________________________________
consensus CGGGGAACTTGAGCCCCTCGGTGGTCCATGTCCAAGGCCGACACCATTTGCGCGTCGTAG
 
. : . : . : . : . : . :
JMFF049I05+ ATCACAATCTGCTTGGGAATCCCCAGCGACGCCCCCGCCTGGCAGTCCTTCACCTCCACC
JMFF023A23+ CCGCCTGGCAGTCCTTCACCTCCACC
JMFF018E20+ ATCACAATCTGCTTGGGAATCCCCAGCGACGCCCCCGCCTGGCAGTCCTTCACCTCCACC
                      ____________________________________________________________
consensus ATCACAATCTGCTTGGGAATCCCCAGCGACGCCCCCGCCTGGCAGTCCTTCACCTCCACC
 
. : . : . : . : . : . :
JMFF049I05+ TGCGCCACGAACTGCAGCATGGAGATTCGGTTGTGCAGCCGCTCAATCGCCTCCGGGAAG
JMFF023A23+ TGCGCCACGAACTGCAGCATGGAGATTCGGTTGTGCAGCCGCTCAATCGCCTCCGGGAAG
JMFF018E20+ TGCGCCACGAACTGCAGCATGGAGATTCGGTTGTGCAGCCGCTCAATCGCCTCCGGGAAG
                      ____________________________________________________________
consensus TGCGCCACGAACTGCAGCATGGAGATTCGGTTGTGCAGCCGCTCAATCGCCTCCGGGAAG
 
. : . : . : . : . : . :
JMFF049I05+ TCGATGATTAGGGCGCTAGGGTTCCTCGCCGCGAACTCCTGCAGCTGCCGCTTCCAATCC
JMFF023A23+ TCGATGATTAGGGCGCTAGGGTTCCTCGCCGCGAACTCCTGCAGCTGCCGCTTCCAATCC
JMFF018E20+ TCGATGATTAGGGCGCTAGGGTTCCTCGCCGCGAACTCCTGCAGCTGCCGCTTCCAATCC
JMFF030F12+ TCGCCGNGAACTCNTGCAGNTGCCGCTTCCAATCC
                      ____________________________________________________________
consensus TCGATGATTAGGGCGCTAGGGTTCCTCGCCGCGAACTCCTGCAGCTGCCGCTTCCAATCC
 
. : . : . : . : . : . :
JMFF049I05+ TCCCCGTACAGCTTGTGCAGGACGCAATCGAACGGCCCCTGATCCACCAGCGCCTTCTCC
JMFF023A23+ TCCCCGTACAGCTTGTGCAGGACGCAATCGAACGGCCCCTGATCCACCAGCGCCTTCTCC
JMFF018E20+ TCCCCGTACAGCTTGTGCAGGACGCAATCGAACGGCCCCTGATCCACCAGCGCCTTCTCC
JMFF030F12+ TCCCCGTACAGCTTGTGCAGGACGCAATCGAACGGCCCNTGATCCACCAGCGCCTTCTCC
                      ____________________________________________________________
consensus TCCCCGTACAGCTTGTGCAGGACGCAATCGAACGGCCCCTGATCCACCAGCGCCTTCTCC
 
. : . : . : . : . : . :
JMFF049I05+ GTGTCGATCTTCACCAGATCGATTCCCCTCTCCCTCGCCAGATTCACCAGCGACGTCTGT
JMFF023A23+ GTGTCGATCTTCACCAGATCGATTCCCCTCTCCCTCGCCAGATTCACCAGCGACGTCTGT
JMFF018E20+ GTGTCGATCTTCACCAGATCGATTCCCCTCTCCCTCGCCAGATTCACCAGCGACGTCTGT
JMFF001N04+ CTTCACCAGATCGATTCCCCTNTCCCTCGCCAGATTCACCAGNGACGTCTGT
JMFF030F12+ GTGTCGATCTTCACCAGATCGATTCCCCTCTCCCTCGCCAGATTCACCAGCGACGTCTGT
                      ____________________________________________________________
consensus GTGTCGATCTTCACCAGATCGATTCCCCTCTCCCTCGCCAGATTCACCAGCGACGTCTGT
 
. : . : . : . : . : . :
JMFF049I05+ ATGAAACTCGCCTGCTTCTTCGGCGCCAAGGCGTACCCCACTCCATACCTCCCCATTCTC
JMFF023A23+ ATGAAACTCGCCTGCTTCTTCGGCGCCAAGGCGTACCCCACTCCATACCTCCCCATTCTC
JMFF018E20+ ATGAAACTCGCCTGCTTCTTCGGCGCCAAGGCGTACCCCACTCCATACCTCCCCATTCTC
JMFF001N04+ ATGAAACTCGCCTGCTTCTTCGGCGCCAAGGCGTNCCCCACTCCATACCTCCCCATTCTC
JMFF030F12+ ATGAAACTCGCCTGCTTCTTCGGCGCCAAGGCGTACCCCACTCCATACCTCCCCATTCTC
                      ____________________________________________________________
consensus ATGAAACTCGCCTGCTTCTTCGGCGCCAAGGCGTACCCCACTCCATACCTCCCCATTCTC
 
. : . : . : . : . : . :
JMFF049I05+ TCCGCCATTGACACCAATCCAATCCCCTCTCCTCTCCTCTCACTCAACAACAATCTCTCA
JMFF023A23+ TCCGCCATTGACACCAATCCAATCCCCTCTCCTCTCCTCTCACTCAACAACAATCTCTCA
JMFF018E20+ TCCGCCATTGACACCAATCCAATCCCCTCTCCTCTCCTCTCACTCAACAACAATCTCTCA
JMFF001N04+ TCCGCCATTGACACCAATCCAATCCCCTCTCCTCTCCTCTCACTCAACAACAATCTCTCA
JMSF033H17+ CAATCCAATCCCNTCTCCTCTCCTCTCACTCAACAACAATCTCTCA
JMFF030F12+ TCCGCCATTGACACCAATCCAATCCCCTCTCCTCTCCTCTCATTCAACAACAATCTCTCA
                      ____________________________________________________________
consensus TCCGCCATTGACACCAATCCAATCCCCTCTCCTCTCCTCTCACTCAACAACAATCTCTCA
 
. : . : . : . : . : . :
JMFF049I05+ ACAAACAAACCCCAACCCACATT
JMFF023A23+ ACAAACAAACCCCAACCCACATT
JMFF018E20+ ACAAACAAACCCCAACCCACATT
JMFF001N04+ ACAAACAAACCCCAACCCACATT
JMSF033H17+ ACAAACAAACCCCAACCCACATTACACAATTCCAATCGCACACACTCTACTTATATTAGG
JMFF030F12+ ACAAACAAACCCCAACCCACATTACACAATTCCAATCGCACACACTCTACTTATATTAGG
                      ____________________________________________________________
consensus ACAAACAAACCCCAACCCACATTACACAATTCCAATCGCACACACTCTACTTATATTAGG
 
. : . : . : . : . : . :
JMSF033H17+ GTTTATTCAACCAAATTGACAGAATCTTCCCAGC
JMFF030F12+ GTTTATTCAACCAAATTGACAGAATCTTCCCAGCTTCAATACAAATGGATGACAGATACC
                      ____________________________________________________________
consensus GTTTATTCAACCAAATTGACAGAATCTTCCCAGCTTCAATACAAATGGATGACAGATACC
 
. : . : . : . : . : . :
JMFF030F12+ TATATGTATAGGTGGCAGTAACTTGTATCTATCTATCTCTATCTCTCTATATATATAATA
                      ____________________________________________________________
consensus TATATGTATAGGTGGCAGTAACTTGTATCTATCTATCTCTATCTCTCTATATATATAATA
 
. : . : . : . : . : . :
JMFF030F12+ TATCGATATATGTATATGTGTGTGTTTTTTTGTGTGTTTGTGTGTGTGTCAGAGATAAGC
                      ____________________________________________________________
consensus TATCGATATATGTATATGTGTGTGTTTTTTTGTGTGTTTGTGTGTGTGTCAGAGATAAGC