Previous Contig 001384:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF030F11Sequence495001384 (3)pir|A84766|A847663e-06hypothetical protein At2g35230 [imported] - Arabidopsis thaliana>gb:AC004667_153654010550 (2)
JMFF045I16Sequence647001384 (3)pir|A84766|A847667e-19hypothetical protein At2g35230 [imported] - Arabidopsis thaliana>gb:AC004667_153594010550 (2)
JMFN003H14Sequence614001384 (3)pir|A84766|A847663e-21hypothetical protein At2g35230 [imported] - Arabidopsis thaliana>gb:AC004667_153

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN003H14+ GAAGTTGGGGACGGTTTATTGGCGTCAAGGGAGGGGGCTTAATCTTTTGCAACCT
JMFF045I16+ GGACGGTTTATTGGCGTCAAGGGAGGGGGCTTAATCTTTTGCAACCT
                      ____________________________________________________________
consensus GAAGTTGGGGACGGTTTATTGGCGTCAAGGGAGGGGGCTTAATCTTTTGCAACCT
 
. : . : . : . : . : . :
JMFN003H14+ AGTATTTTGCGGTTTGGGAGCATTCGGGGGTCTAGGAGCAGGCTCACGCAAAGGCGAGCC
JMFF045I16+ AGTATTTGNCGGTTTGGGAGCATTCGGGGGTCTAGGAGCAGGCTCACGCAAAGGCGAGCC
                      ____________________________________________________________
consensus AGTATTTTGCGGTTTGGGAGCATTCGGGGGTCTAGGAGCAGGCTCACGCAAAGGCGAGCC
 
. : . : . : . : . : . :
JMFN003H14+ CGTCAGCTGTTGAACTATGCTCCGGAAATCGTTCTTGTTTATATTGTAGACCTGCGGTTG
JMFF045I16+ CGTCAGCTGTTGAACTATGCTCCGGAAATCGTTCTTGTTTATATTGTAGACCTGCGGTTG
JMFF030F11+ GTAGACCTGCGGTTG
                      ____________________________________________________________
consensus CGTCAGCTGTTGAACTATGCTCCGGAAATCGTTCTTGTTTATATTGTAGACCTGCGGTTG
 
. : . : . : . : . : . :
JMFN003H14+ AGGTTGAGGCCGAGCACCCCCCGCATTAGCATTGCTGAAATTCGGTTGGTGTATCGGGCT
JMFF045I16+ AGGTTGAGGCCGAGCACCCCCCGCATTAGCATTGCTGAAATTCGGTTGGTGTATCGGGCT
JMFF030F11+ AGGTTGAGGCCGAGCACCCCCCGCATTAGCATTGCTGAAATTCGGTTGGTGTATCGGGCT
                      ____________________________________________________________
consensus AGGTTGAGGCCGAGCACCCCCCGCATTAGCATTGCTGAAATTCGGTTGGTGTATCGGGCT
 
. : . : . : . : . : . :
JMFN003H14+ CTTCTTTATATTCTTCCCCATCTTATTCACCCCCAAAGTATCTGGATGTCTACCCATCTG
JMFF045I16+ CTTCTTTATATTCTTCCCCATCTTATTCACCCCCAAAGTATCTGGATGTCTACCCATCTG
JMFF030F11+ CTTCTTTATATTCTTCCCCATCTTATTCACCCCCAAAGTATCTGGATGTCTACCCATCTG
                      ____________________________________________________________
consensus CTTCTTTATATTCTTCCCCATCTTATTCACCCCCAAAGTATCTGGATGTCTACCCATCTG
 
. : . : . : . : . : . :
JMFN003H14+ CCTATTAGAATTGTCCATTTCTCACAATCTCAAAGCCTTTCACTATGATCCAATCCAACG
JMFF045I16+ CCTATTTGAATTGTCCATTTCTCACAATCTCAAAGCCTTTCACTATGATCCAATCCAACG
JMFF030F11+ CCTATTTGAATTGTCCATTTCTCACAATCTCAAAGCCTTTCACTATGATCCAATCCAACG
                      ____________________________________________________________
consensus CCTATTTGAATTGTCCATTTCTCACAATCTCAAAGCCTTTCACTATGATCCAATCCAACG
 
. : . : . : . : . : . :
JMFN003H14+ ATTTTCGCTAAACTTCCACTTCTTCTTTTTCTCCCACTCAACTTAACTACCAATCACAAA
JMFF045I16+ ATTTTCGCTAAACTTCCACTTCTTCTTTTTCTCCCACTCAACTTAACTACCAATCACAAA
JMFF030F11+ ATTTTCGCTAAACTTCCACTTCTTCTTTTTCTCCCACTCAACTTAACTACCAATCACAAA
                      ____________________________________________________________
consensus ATTTTCGCTAAACTTCCACTTCTTCTTTTTCTCCCACTCAACTTAACTACCAATCACAAA
 
. : . : . : . : . : . :
JMFN003H14+ ACTTCAAATGCCATATAAACAGATGCAACAGCGTGATTCGCGGCTGTTGCGTCTGAATCT
JMFF045I16+ ACTTCAAATGCCATATAAACAGATGCAACAGCGTGATTCGCGGCTGTTGCGTCTGAATCT
JMFF030F11+ ACTTCAAATGCCATATAAACAGATGCAACAGCGTGATTCGCGGCTGTTGCGTCTGAATCT
                      ____________________________________________________________
consensus ACTTCAAATGCCATATAAACAGATGCAACAGCGTGATTCGCGGCTGTTGCGTCTGAATCT
 
. : . : . : . : . : . :
JMFN003H14+ CAACCTGCTCCTCCTCCTCCTTCCGCAGATTCTTTCCGGTGAGGCGGTGGCTGCTCTGAA
JMFF045I16+ CAACCTGCTCCTCCTCCTCCTTCCGCAGATTCTTTCCGGTGAGGCGGTGGCTGCTCTGAA
JMFF030F11+ CAACCTGCTCCTCCTCCTCCTTCCGCAGATTCTTTCCGGTGAGGCGGTGGCTGCTCTGAA
                      ____________________________________________________________
consensus CAACCTGCTCCTCCTCCTCCTTCCGCAGATTCTTTCCGGTGAGGCGGTGGCTGCTCTGAA
 
. : . : . : . : . : . :
JMFN003H14+ TCGAGGGAGGCGGCGATGAGCGGTGGGTCAACGATGGAACGGTGGAACGCAGATTGAAAA
JMFF045I16+ TCGAGGGAGGCGGCGATGAGCGGTGGGTCAACGATGGAACGGTGGAACGCAGATTGAAAA
JMFF030F11+ TCGAGGGAGGCGGCGATGAGCGGTGGGTCAACGATGGAACGGTGGAACGCAGATTGAAAA
                      ____________________________________________________________
consensus TCGAGGGAGGCGGCGATGAGCGGTGGGTCAACGATGGAACGGTGGAACGCAGATTGAAAA
 
. : . : . : . : . : . :
JMFN003H14+ AAGGTTGCGAGCGAGAGCG
JMFF045I16+ AAGGTTGCGAGCGAGAGCGAAAAAACGAAAAGAAAACAAAAAACCACAAAAAAATGAAAC
JMFF030F11+ AAGGTTGCGAGCGAGAGCGAAAAAACGAAAAGAAAACAAAAAACCACAAAAAAATGAAAC
                      ____________________________________________________________
consensus AAGGTTGCGAGCGAGAGCGAAAAAACGAAAAGAAAACAAAAAACCACAAAAAAATGAAAC