Previous Contig 001382:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF030D10Sequence531001382 (2)gb:OSJN00077_16944407e-14Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0041A02, complete seque356021323gb:OSJN00077_16944405e-06Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0041A02, complete seque
JMFF031K20Sequence606001382 (2)gb:OSJN00077_16944404e-26Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0041A02, complete seque

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF031K20+ CTCTATAG
                      ____________________________________________________________
consensus CTCTATAG
 
. : . : . : . : . : . :
JMFF031K20+ TAGAGTTTAGTGACCGGATCAGGTTTTTCAACATCTCCCGCGAATGACCCACCATCACAA
                      ____________________________________________________________
consensus TAGAGTTTAGTGACCGGATCAGGTTTTTCAACATCTCCCGCGAATGACCCACCATCACAA
 
. : . : . : . : . : . :
JMFF031K20+ TACCGAATAATAACTCGATT-CCACTTATAAAATTTAGTAAAGGTTGCATTTATACC-GA
JMFF030D10+ ATAACTCGATTCCCACTTATAAAATTTAGTAAAGGTTGCATTTATACCGGA
                      ____________________________________________________________
consensus TACCGAATAATAACTCGATTCCCACTTATAAAATTTAGTAAAGGTTGCATTTATACCGGA
 
. : . : . : . : . : . :
JMFF031K20+ ATATGCCTTTAAATACGAAAGGTGCCATGTTGAAAGTAGAACCCAATTCACGTTTCATAC
JMFF030D10+ ATATGCCTTTAAATACGAAAGGTGCCATGTTGAAAGTAGAACCCAATTCACGTTTCATAC
                      ____________________________________________________________
consensus ATATGCCTTTAAATACGAAAGGTGCCATGTTGAAAGTAGAACCCAATTCACGTTTCATAC
 
. : . : . : . : . : . :
JMFF031K20+ GACTCGAACAACTCTCAACAGAGAGGTCATGAGTAGAATATGTGTCATTACTAGTACACC
JMFF030D10+ GACTCGAACAACTCTCAACAGAGAGGTCATGAGTAGAATATGTGTCATTACTAGTACACC
                      ____________________________________________________________
consensus GACTCGAACAACTCTCAACAGAGAGGTCATGAGTAGAATATGTGTCATTACTAGTACACC
 
. : . : . : . : . : . :
JMFF031K20+ ACCCTCCTCCTGCAAGGTAAATGAGCCAATTGCTCGCGTCTTCATCTTTCCCAGGAGAGA
JMFF030D10+ ACCCTCCTCCTGCAAGGTAAATGAGCCAATTGCTCGCGTCTTCATCTTTCCCAGGAGAGA
                      ____________________________________________________________
consensus ACCCTCCTCCTGCAAGGTAAATGAGCCAATTGCTCGCGTCTTCATCTTTCCCAGGAGAGA
 
. : . : . : . : . : . :
JMFF031K20+ AATGATAGGCGGGGGGACTCCCATCCAAACAAACAGCTCCTTTCTCATCGGCACCCGGGA
JMFF030D10+ AATGATAGGCGGGGGGACTCCCATCCAAACAAACAGCTCCTTTCTCATCGGCACCCGGGA
                      ____________________________________________________________
consensus AATGATAGGCGGGGGGACTCCCATCCAAACAAACAGCTCCTTTCTCATCGGCACCCGGGA
 
. : . : . : . : . : . :
JMFF031K20+ TAATAGTTTTGGGAATAAGAAGATCGAGATCCTGAATAATAGGTGTGGGAATAGGATTGG
JMFF030D10+ TAATAGTTTTGGGAATAAGAAGATCGAGATCCTGAATAATAGGTGTGGGAATAGGATTGG
                      ____________________________________________________________
consensus TAATAGTTTTGGGAATAAGAAGATCGAGATCCTGAATAATAGGTGTGGGAATAGGATTGG
 
. : . : . : . : . : . :
JMFF031K20+ AGTTTACATATTGCACACTTATAACCAAAGAAAAAATCAGCAAACATATCCAATCATTTG
JMFF030D10+ AGTTTACATATTGCACACTTATAACCAAAGAAAAAATCAGCAAACATATCCAATCATTTG
                      ____________________________________________________________
consensus AGTTTACATATTGCACACTTATAACCAAAGAAAAAATCAGCAAACATATCCAATCATTTG
 
. : . : . : . : . : . :
JMFF031K20+ ACCTTGGTGAGACAGCCATTCTCAAAGACTCAGGATTATTGGCTTCCAAGGTTAGGAGAT
JMFF030D10+ ACCTTGGTGAGACAGCCATTCTCAAAGACTCAGGATTATTGGCTTCCAAGGTTAGGAGAT
                      ____________________________________________________________
consensus ACCTTGGTGAGACAGCCATTCTCAAAGACTCAGGATTATTGGCTTCCAAGGTTAGGAGAT
 
. : . : . : . : . : . :
JMFF031K20+ CAAGTCCCCCCTCAACCTCGAATGAAACAAAGACAAAGTTAAATGATTATTTTGTGATCT
JMFF030D10+ CAAGTCCCCCCTCAACCTCGAATGAAACAAAGACAAAGTTAAATGATTATTTTGTGATCT
                      ____________________________________________________________
consensus CAAGTCCCCCCTCAACCTCGAATGAAACAAAGACAAAGTTAAATGATTATTTTGTGATCT