Previous Contig 001370:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004D21Sequence527001370 (9)gb:NTA344538_16913542e-24Nicotiana tabacum mRNA for nucleic acid binding protein (nbp1 gene).720011090 (7)gb:NTA344538_16913544e-64Nicotiana tabacum mRNA for nucleic acid binding protein (nbp1 gene).
JMFF023M09Sequence158001370 (9)
JMFF027E18Sequence492001370 (9)gb:NTA344538_16913541e-15Nicotiana tabacum mRNA for nucleic acid binding protein (nbp1 gene).686011090 (7)gb:NTA344538_16913545e-60Nicotiana tabacum mRNA for nucleic acid binding protein (nbp1 gene).
JMFF029P10Sequence442001370 (9)gb:NTA344538_16913543e-04Nicotiana tabacum mRNA for nucleic acid binding protein (nbp1 gene).644011090 (7)gb:NTA344538_16913541e-51Nicotiana tabacum mRNA for nucleic acid binding protein (nbp1 gene).
JMFF051I11Sequence616001370 (9)gb:NTA344538_16913541e-38Nicotiana tabacum mRNA for nucleic acid binding protein (nbp1 gene).616011090 (7)gb:NTA344538_16913541e-39Nicotiana tabacum mRNA for nucleic acid binding protein (nbp1 gene).
JMFN025J06Sequence376001370 (9)
JMSF007H18Sequence431001370 (9)gb:NTA344538_16913542e-06Nicotiana tabacum mRNA for nucleic acid binding protein (nbp1 gene).402011090 (7)gb:NTA344538_16913545e-24Nicotiana tabacum mRNA for nucleic acid binding protein (nbp1 gene).
JMSF020N06Sequence653001370 (9)gb:NTA344538_16913543e-44Nicotiana tabacum mRNA for nucleic acid binding protein (nbp1 gene).353011090 (7)gb:NTA344538_16913547e-15Nicotiana tabacum mRNA for nucleic acid binding protein (nbp1 gene).
JMSF038J22Sequence735001370 (9)gb:NTA344538_16913543e-53Nicotiana tabacum mRNA for nucleic acid binding protein (nbp1 gene).

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF038J22+ TCAAGTAGTAAGGTATCAGTAACATCAGCAGCTAGGTCTCNT
                      ____________________________________________________________
consensus TCAAGTAGTAAGGTATCAGTAACATCAGCAGCTAGGTCTCNT
 
. : . : . : . : . : . :
JMSF038J22+ ACGAATATAGAAAGATCAGAACCATTATTTAAACGCTTCTCCCCCATGCTAAATGTTGCC
JMSF020N06+ CTAAATGTTGCC
                      ____________________________________________________________
consensus ACGAATATAGAAAGATCAGAACCATTATTTAAACGCTTCTCCCCCATGCTAAATGTTGCC
 
. : . : . : . : . : . :
JMSF038J22+ CAATTCAGACGAAAGAGTTGATCTGTATTAGGCATTAAAATGCAGGTGTATGACTGAAGA
JMFF051I11+ CTGTATTAGGCATTAAAATGCAGGTGTATGACTGAAGA
JMSF020N06+ CAATTCAGACGAAAGAGTTGATCTGTATTAGGCATTAAAATGCAGGTGTATGACTGAAGA
                      ____________________________________________________________
consensus CAATTCAGACGAAAGAGTTGATCTGTATTAGGCATTAAAATGCAGGTGTATGACTGAAGA
 
. : . : . : . : . : . :
JMSF038J22+ GCTTTCTCTGCAGCAGCATGAGAATAGAATTCTACAAAACCATATCCCTCTGAGAAACCA
JMFF004D21+ TGAGAAACCA
JMFF051I11+ GCTTTCTCTGCAGCAGCATGAGAATAGAATTCTACAAAACCATATCCCTCTGAGAAACCA
JMSF020N06+ GCNTTCTCTGCAGCAGCATGAGAATAGAATTCTACAAAACCATATCCCTCTGAGAAACCA
                      ____________________________________________________________
consensus GCTTTCTCTGCAGCAGCATGAGAATAGAATTCTACAAAACCATATCCCTCTGAGAAACCA
 
. : . : . : . : . : . :
JMSF038J22+ GTCTGTTTGTTTCTGATCACCTTAATGGATGCAACCT-CCCCAGTGGAGGCGAAACAGCT
JMFF027E18+ ACCTTAATGGATGCAACCTCCCCCAGTGGAGGCGAAACAGCT
JMFF004D21+ GTCTGTTTGTTTCTGATCACCTTAATGGATGCAACCT-CCCCAGTGGAGGCGAAACAGCT
JMFF051I11+ GTCTGTTTGTTTCTGATCACCTTAATGGATGCAACCT-CCCCAGTGGAGGCGAAACAGCT
JMSF020N06+ GTCTGTTTGTTTCTGATCACCTTAATGGATGCAACCT-CCCCAGTGGAGGCGAAACAGCT
                      ____________________________________________________________
consensus GTCTGTTTGTTTCTGATCACCTTAATGGATGCAACCT-CCCCAGTGGAGGCGAAACAGCT
 
. : . : . : . : . : . :
JMSF038J22+ ACGCAAATAATCCTCATCCATCCAATTGTGAAGGTCACCGATCCAGATTGTTCTGTTCTC
JMFF027E18+ ACGCAAATAATCCTCATCCATCCAATTGTGAAGGTCACCGATCCAGATTGTTCTGTTCTC
JMFN025J06+ CCGATCCAGATTGTTCTGTTCTC
JMFF004D21+ ACGCAAATAATCCTCATCCATCCAATTGTGAAGGTCACCGATCCAGATTGTTCTGTTCTC
JMFF051I11+ ACGCAAATAATCCTCATCCATCCAATTGTGAAGGTCACCGATCCAGATTGTTCTGTTCTC
JMSF007H18+ TGAAGGTCACCGATCCAGATTGTTCTGTTCTC
JMSF020N06+ ACGCAAATAATCCTCATCCATCCAATTGTGAAGGTCACCGATCCAGATTGTTCTGTTCTC
JMFF029P10+ CCGATCCAGATTGTTCTGTTCTC
                      ____________________________________________________________
consensus ACGCAAATAATCCTCATCCATCCAATTGTGAAGGTCACCGATCCAGATTGTTCTGTTCTC
 
. : . : . : . : . : . :
JMSF038J22+ GCCATTAGATCCTCCATGCTGCTGTTGCTGCTGCGGCTGCGCATGCGGCGGAGGGTGGTG
JMFF027E18+ GCCATTAGATCCTCCATGCTGCTGTTGCTGCTGCGGCTGCGCATGCGGCGGAGGGTGGTG
JMFN025J06+ GCCATTAGATCCTCCATGCTGCTGTTGCTGCTGCGGCTGCGCATGCGGCGGAGGGTGGTG
JMFF004D21+ GCCATTAGATCCTCCATGCTGCTGTTGCTGCTGCGGCTGCGCATGCGGCGGAGGGTGGTG
JMFF051I11+ GCCATTAGATCCTCCATGCTGCTGTTGCTGCTGCGGCTGCGCATGCGGCGGAGGGTGGTG
JMSF007H18+ GCCATTAGATCCTCCATGCTGCTGTTGCTGCTGCGGCTGCGCATGCGGCGGAGGGTGGTG
JMSF020N06+ GCCATTAGATCCTCCATGCTGCTGTTGCTGCTGCGGCTGCGCATGCGGCGGAGGGTGGTG
JMFF029P10+ GCCATTAGATCCTCCATGCTGCTGTTGCTGCTGCGGCTGCGCATGCGGCGGAGGGTGGTG
                      ____________________________________________________________
consensus GCCATTAGATCCTCCATGCTGCTGTTGCTGCTGCGGCTGCGCATGCGGCGGAGGGTGGTG
 
. : . : . : . : . : . :
JMSF038J22+ GAGGAAGTGGGGGTGGTAAGGCATGTAGTGAGGCGGGTAATGCGTCGCCGGCATCATCTG
JMFF027E18+ GAGGAAGTGGGGGTGGTAAGGCATGTAGTGAGGCGGGTAATGCGTCGCCGGCATCATCTG
JMFN025J06+ GAGGAAGTGGGGGTGGTAAGGCATGTAGTGAGGCGGGTAATGCGTCGCCGGCATCATGTG
JMFF004D21+ GAGGAAGTGGGGGTGGTAAGGCATGTAGTGAGGCGGGTAATGCGTCGCCGGCATCATCTG
JMFF051I11+ GAGGAAGTGGGGGTGGTAAGGCATGTAGTGAGGCGGGTAATGCGTCGCCGGCATCATCTG
JMSF007H18+ GAGGAAGTGGGGGTGGTAAGGCATGTAGTGAGGCGGGTAATGCGTCGCCGGCATCATCTG
JMSF020N06+ GAGGAAGTGGGGGTGGTAAGGCATGTAGTGAGGCGGGTAATGCGTCGCCGGCATCATCTG
JMFF029P10+ GAGGAAGTGGGGGTGGTAAGGCATGTAGTGAGGCGGGTAATGCGTCGCCGGCATCATCTG
                      ____________________________________________________________
consensus GAGGAAGTGGGGGTGGTAAGGCATGTAGTGAGGCGGGTAATGCGTCGCCGGCATCATCTG
 
. : . : . : . : . : . :
JMSF038J22+ ATGCTGCATTACCGTTGCCGCCGCCGGGTATTGCATAGGCACCCACGGTGGCTGTTGCTG
JMFF027E18+ ATGCTGCATTACCGTTGCCGCCGCCGGGTATTGCATAGGCACCCACGGTGGCTGTTGCTG
JMFN025J06+ ATGCTGCATTACCGTTGCCGCCGCCGGGTATTGCATAGGCACCCACGGTGGCTGTTGCTG
JMFF004D21+ ATGCTGCATTACCGTTGCCGCCGCCGGGTATTGCATAGGCACCCACGGTGGCTGTTGCTG
JMFF051I11+ ATGCTGCATTACCGTTGCCGCCGCCGGGTATTGCATAGGCACCCACGGTGGCTGTTGCTG
JMSF007H18+ ATGCTGCATTACCGTTGCCGCCGCCGGGTATTGCATAGGCACCCACGGTGGCTGTTGCTG
JMSF020N06+ ATGCTGCATTACCGTNGCCGCCGCCGGGTATTGCATAGGCACCCACGGTGGCTGTTGCTG
JMFF029P10+ ATGCTGCATTACCGTTGCCGCCGCCGGGTATTGCATAGGCACCCACGGTGGCTGTTGCTG
                      ____________________________________________________________
consensus ATGCTGCATTACCGTTGCCGCCGCCGGGTATTGCATAGGCACCCACGGTGGCTGTTGCTG
 
. : . : . : . : . : . :
JMSF038J22+ CTGCGCCGCCGCCGCCACCGGAACAACCTTCGCCCCAGCCCCCGTCGTCACCGCCTGCTT
JMFF027E18+ CTGCGCCGCCGCCGCCACCGGAACAACCTTCGCCCCAGCCCCCGTCGTCACCGCCTGCTT
JMFN025J06+ CTGCGCCGCCGCCGCCACCGGAACAACCTTCGCCCCAGCCCCCGTCGTCACCGCCTGCTT
JMFF004D21+ CTGCGCCGCCGCCGCCACCGGAACAACCTTCGCCCCAGCCCCCGTCGTCACCGCCTGCTT
JMFF051I11+ CTGCGCCGCCGCCGCCACCGGAACAACCTTCGCCCCAGCCCCCGTCGTCACCGCCTGCTT
JMSF007H18+ CTGCGCCGCCGCCGCCACCGGAACAACCTTCGCCCCAGCCCCCGTCGTCACCGCCTGCTT
JMSF020N06+ CTGCGCCGCCGCCGCCACCGGAACAACCTTCGCCCCAGCCCCCGTCGTCACCGCCTGCTT
JMFF029P10+ CTGCGCCGCCGCCGCCACCGGAACAACCTTCGCCCCAGCCCCCGTCGTCACCGCCTGCTT
                      ____________________________________________________________
consensus CTGCGCCGCCGCCGCCACCGGAACAACCTTCGCCCCAGCCCCCGTCGTCACCGCCTGCTT
 
. : . : . : . : . : . :
JMSF038J22+ TTGCTCCGCATCCTGATGCTTCTCCGCCTCGTGCTCGGGCTCTCGCGGCGACGGTGGTTG
JMFF027E18+ TTGCTCCGCATCCTGATGCTTCTCCGCCTCGTGCTCGGGCTCTCGCGGCGACGGTGGTTG
JMFN025J06+ TTGCTCCGCATCCTGATGCTTCTCCGCCTCGTGCTCGGGCTCTCGCGGCGACGGTGGTTG
JMFF023M09+ TGATGCTTCTCCGCNTCGTGCTCGGGCTCTCGCGGCGACGGTGGTTG
JMFF004D21+ TTGCTCCGCATCCTGATGCTTCTCCGCCTCGTGCTCGGGCTCTCGCGGCGACGGTGGTTG
JMFF051I11+ TTGCTCCGCATCCTGATGCTTCTCCGCCTCGTGCTCGGGCTCTCGCGGCGACGGTGGTTG
JMSF007H18+ TTGCTCCGCATCCTGATGCTTCTCCGCCTCGTGCTCGGGCTCTCGCGGCGACGGTGGTTG
JMSF020N06+ TTGCTCCGCATCCTGATGCTTNTCCGCCTCGTGCTCGGGCTCTCGCGGCGACGGTGGTTG
JMFF029P10+ TTGCTCCGCATCCTGATGCTTCTCCGCCTCGTGCTCGGGCTCTCGCGGCGACGGTGGTTG
                      ____________________________________________________________
consensus TTGCTCCGCATCCTGATGCTTCTCCGCCTCGTGCTCGGGCTCTCGCGGCGACGGTGGTTG
 
. : . : . : . : . : . :
JMSF038J22+ TTTATTCTCTTGCGATTCAGGACCTTTATCCGTTTGCATCTTCAAACTCGCTCTGTTTCT
JMFF027E18+ TTTATTCTCTTGCGATTCAGGACCTTTATCCGTTTGCATCTTCAAACTCGCTCTGTTTCT
JMFN025J06+ TTTATTCTCTTGCGATTCAGGACCTTTATCCGTTTGCATCTTCAAACTCGCT
JMFF023M09+ TTTATTNTNTTGCGATTCAGGACCTTTATCCGTTTGCATNTTCAAACTCGCTCTGTTTCT
JMFF004D21+ TTTATTCTCTTGCGATTCAGGACCTTTATCCGTTTGCATCTTCAAACTCGCTCTGTTTCT
JMFF051I11+ TTTATTCTCTTGCGATTCAGGACCTTTATCCGTTTGCATCTTCAAACTCGCTCTGTTTCT
JMSF007H18+ TTTATTCTCTTGCGATTCAGGACCTTTATCCGTTTGCATCTTCAAACTCGCTCTGTTTCT
JMSF020N06+ TTTATTCTCTTGCGATTCAGGACCTTTATCCGTTTGCATCTTCAAACTCGCTCTGTTTCT
JMFF029P10+ TTTATTCTCTTGCGATTCAGGACCTTTATCCG-TTGCATCTTCAAACTCGCTCTGTTTCT
                      ____________________________________________________________
consensus TTTATTCTCTTGCGATTCAGGACCTTTATCCGTTTGCATCTTCAAACTCGCTCTGTTTCT
 
. : . : . : . : . : . :
JMSF038J22+ GTTTCTCTCTCTCTCTCTCTCCCTGTAACCAAC
JMFF027E18+ GTTTCTCTCTCTCTCTCTCTCCCTATAACC
JMFF023M09+ GTTTCTCTCTCTCTCTCTCTCCCTGTAACCAACAAACT
JMFF004D21+ GTTTCTCTCTCTCTCTCTCTCCCTGTAACCAACAAACT
JMFF051I11+ GTTTCTCTCTCTCTCTCTCTCCCTGTAACCAACAAACT
JMSF007H18+ GTTTCTCTCTCTCTCTCTCTCCCTGTAACCAACAAACT
JMSF020N06+ GTTTCTCTCTCTCTCTCTCTCCCTGTAACCAACAAACT
JMFF029P10+ GTTTCTCTCTCTCTCTCTCTCCCTGTAACCAACAAACTACTGAAACCCTAGAGGAAATAT
                      ____________________________________________________________
consensus GTTTCTCTCTCTCTCTCTCTCCCTGTAACCAACAAACTACTGAAACCCTAGAGGAAATAT