Previous Contig 001368:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF014J13Sequence464001368 (29)gb:AY352047_16017751e-33Catharanthus roseus 10-hydroxygeraniol oxidoreductase mRNA, complete cds.675001368 (29)gb:STU439993_17230768e-64Solanum tuberosum mRNA for alcohol NADP+ oxidoreductase (drd-1 gene).
JMFF015P04Sequence472001368 (29)gb:AY352047_16017751e-34Catharanthus roseus 10-hydroxygeraniol oxidoreductase mRNA, complete cds.763001368 (29)gb:STU439993_17230765e-73Solanum tuberosum mRNA for alcohol NADP+ oxidoreductase (drd-1 gene).
JMFF017N07Sequence559001368 (29)gb:STU439993_17230762e-64Solanum tuberosum mRNA for alcohol NADP+ oxidoreductase (drd-1 gene).716001368 (29)gb:STU439993_17230764e-70Solanum tuberosum mRNA for alcohol NADP+ oxidoreductase (drd-1 gene).
JMFF020G05Sequence521001368 (29)gb:STU439993_17230762e-55Solanum tuberosum mRNA for alcohol NADP+ oxidoreductase (drd-1 gene).750001368 (29)gb:STU439993_17230762e-70Solanum tuberosum mRNA for alcohol NADP+ oxidoreductase (drd-1 gene).
JMFF024F04Sequence501001368 (29)gb:STU439993_17230764e-54Solanum tuberosum mRNA for alcohol NADP+ oxidoreductase (drd-1 gene).790001368 (29)gb:STU439993_17230764e-79Solanum tuberosum mRNA for alcohol NADP+ oxidoreductase (drd-1 gene).
JMFF025L10Sequence601001368 (29)gb:STU439993_17230762e-72Solanum tuberosum mRNA for alcohol NADP+ oxidoreductase (drd-1 gene).761001368 (29)gb:STU439993_17230765e-73Solanum tuberosum mRNA for alcohol NADP+ oxidoreductase (drd-1 gene).
JMFF029O17Sequence534001368 (29)gb:AY352047_16017751e-30Catharanthus roseus 10-hydroxygeraniol oxidoreductase mRNA, complete cds.746001368 (29)gb:STU439993_17230762e-69Solanum tuberosum mRNA for alcohol NADP+ oxidoreductase (drd-1 gene).
JMFF030M13Sequence610001368 (29)gb:STU439993_17230769e-55Solanum tuberosum mRNA for alcohol NADP+ oxidoreductase (drd-1 gene).
JMFF034M04Sequence547001368 (29)gb:AY352047_16017754e-32Catharanthus roseus 10-hydroxygeraniol oxidoreductase mRNA, complete cds.722001368 (29)gb:STU439993_17230762e-71Solanum tuberosum mRNA for alcohol NADP+ oxidoreductase (drd-1 gene).
JMFF043K18Sequence618001368 (29)gb:STU439993_17230769e-82Solanum tuberosum mRNA for alcohol NADP+ oxidoreductase (drd-1 gene).605001368 (29)gb:STU439993_17230769e-50Solanum tuberosum mRNA for alcohol NADP+ oxidoreductase (drd-1 gene).
JMFF047I02Sequence452001368 (29)gb:AY342355_16008281e-16Camptotheca acuminata 10-hydroxygeraniol oxidoreductase mRNA, complete cds.418001368 (29)gb:STU439993_17230762e-16Solanum tuberosum mRNA for alcohol NADP+ oxidoreductase (drd-1 gene).
JMFS124E11Sequence571001368 (29)gb:STU439993_17230762e-78Solanum tuberosum mRNA for alcohol NADP+ oxidoreductase (drd-1 gene).
JMFS151A11Sequence621001368 (29)gb:STU439993_17230762e-88Solanum tuberosum mRNA for alcohol NADP+ oxidoreductase (drd-1 gene).
JMSF013P15Sequence500001368 (29)gb:STU439993_17230768e-59Solanum tuberosum mRNA for alcohol NADP+ oxidoreductase (drd-1 gene).746001368 (29)gb:STU439993_17230761e-70Solanum tuberosum mRNA for alcohol NADP+ oxidoreductase (drd-1 gene).
JMSF041E23Sequence772001368 (29)gb:STU439993_17230764e-83Solanum tuberosum mRNA for alcohol NADP+ oxidoreductase (drd-1 gene).650001368 (29)gb:STU439993_17230761e-62Solanum tuberosum mRNA for alcohol NADP+ oxidoreductase (drd-1 gene).
JMSF041L23Sequence742001368 (29)gb:STU439993_17230768e-78Solanum tuberosum mRNA for alcohol NADP+ oxidoreductase (drd-1 gene).662001368 (29)gb:AF146691_17721753e-57Lycopersicon esculentum cultivar Rio Grande ELI3 (Eli3) mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF047I02- ACCCTGGAGAGTTTTTTTTT
                      ____________________________________________________________
consensus ACCCTGGAGAGTTTTTTTTT
 
. : . : . : . : . : . :
rJMFF047I02- TTTTTTTACTCATAAGTCACAACAAGGTGATTCATAACTTTATTCTTGTCAAACTTCAAG
rJMFF043K18- AGTCACAACAA-GTGATTCATAACTTTATTCTTGTCAAACTTCAAG
rJMFF034M04- TAACTTTATTCTTGTCAAACTTCAAG
rJMFF017N07- AACTTTATTCTTGTCAAACTTCAAG
rJMSF041E23- AG
rJMFF030M13- CTTTATTCTTGTC-AACTTCAAG
rJMFF014J13- TAACTTTATTCTTGTC-AACTTCAAG
rJMFF029O17- TAACTTTATTCTTGTCAAACTTCAAG
rJMFF020G05- TAACTTTATTCTTGTC-AACTTCAAG
rJMFF025L10- ACTTTATTCTTGTCAAACTTCAAG
rJMSF013P15- AG
rJMSF041L23- AACTTCAGG
rJMFF015P04- AACTTTATTCTTGTC-AACTTCAAG
rJMFF024F04- CTTTATTCTTGTC-AACTTCAAG
                      ____________________________________________________________
consensus TTTTTTTACTCATAAGTCACAACAAGGTGATTCATAACTTTATTCTTGTCAAACTTCAAG
 
. : . : . : . : . : . :
rJMFF047I02- GGGTTACAATGATACATCATATTTAATAGGGCGATTAACCTCCCTACAACAAAAGGATGT
rJMFF043K18- GGGTTACAATGATACATCATATTTAATAGGGCGATTAACCTCCCTACAACAAAAGGATGT
rJMFF034M04- GGGTTACAATGATACATCATATTTAATAGGGCGATTAACCTCCCTACAACAAAAGGATGT
rJMFF017N07- GGGTTACAATGATACATCATATTTAATAGGGCGATTAACCTCCCTACAACAAAAGGATGT
rJMSF041E23- GGGTTACAATGATACATCATATTTAATAGGGCGATTAACCTCCCTACAACAAAAGGATGT
rJMFF030M13- GGGTTACAATGATACATCATATTTAATAGGGCGATTAACCTCCCTACAACAAAAGGATGT
rJMFF014J13- GGGTTACAATGATACATCATATTTAATAGGGCGATTAACCTCCCTACAACAAAAGGATGT
rJMFF029O17- GGGTTACAATGATACATCATATTTAATAGGGCGATTAACCTCCCTACAACAAAAGGATGT
rJMFF020G05- GGGTTACAATGATACATCATATTTAATAGGGCGATTAACCTCCCTACAACAAAAGGATGT
rJMFF025L10- GGGTTACAATGATACATCATATTTAATAGGGCGATTAACCTCCCTACAACAAAAGGATGT
rJMSF013P15- GGGTTACAATGATACATCATATTTAATAGGGCGATTAACCTCCCTACAACAAAAGGATGT
rJMSF041L23- GGGTTACAATGATACATCATATTTAATAGGGCGATTAACCTCCCTACAACAAAAGGATGT
rJMFF015P04- GGGTTACAATGATACATCATATTTAATAGGGCGATTAACCTCCCTACAACAAAAGGATGT
rJMFF024F04- GGGTTACAATGATACATCATATTTAATAGGGCGATTAACCTCCCTACAACAAAAGGATGT
                      ____________________________________________________________
consensus GGGTTACAATGATACATCATATTTAATAGGGCGATTAACCTCCCTACAACAAAAGGATGT
 
. : . : . : . : . : . :
rJMFF047I02- GAACACACACAGCCACAACTCTGAGAATACAATACGCTAAACCTCTCTCTCACACTTAGT
rJMFF043K18- GAACACACACAGCCACAACTCTGAGAATACAATACGCTAAACCTCTCTCTCACACTTAGT
rJMFF034M04- GAACACACACAGCCACAACTCTGAGAATACAATACGCTAAACCTCTCTCTCACACTTAGT
rJMFF017N07- GAACACACACAGCCACAACTCTGAGAATACAATACGCTAAACCTCTCTCTCACACTTAGT
rJMSF041E23- GAACACACACAGCCACAACTCTGAGAATACAATACGCTAAACCTCTCTCTCACACTTAGT
rJMFF030M13- GAACACACACAGCCACAACTCTGAGAATACAATACGCTAAACCTCTCTCTCACACTTAGT
rJMFF014J13- GAACACACACAGCCACAACTCTGAGAATACAATACGCTAAACCTCTCTCTCACACTTAGT
rJMFF029O17- GAACACACACAGCCACAACTCTGAGAATACAATACGCTAAACCTCTCTCTCACACTTAGT
rJMFF020G05- GA--ACACAGAGCCACAACTCTGAGAATACAATACGCTAAACCTCTCTCTCACACTTAGT
rJMFF025L10- GAACACACACAGCCACAACTCTGAGAATACAATACGCTAAACCTCTCTCTCACACTTAGT
rJMSF013P15- GAACACACACAGCCACAACTCTGAGAATACAATACGCTAAACCTCTCTCTCACACTTAGT
rJMSF041L23- GAACACACACAGCCACAACTCTGAGAATACAATACGCTAAACCTCTCTCTCACACTTAGT
rJMFF015P04- GAACACACACAGCCACAACTCTGAGAATACAATACGCTAAACCTCTCTCTCACACTTAGT
rJMFF024F04- GAACACACACAGCCACAACTCTGAGAATACAATACGCTAAACCTCTCTCTCACACTTAGT
                      ____________________________________________________________
consensus GAACACACACAGCCACAACTCTGAGAATACAATACGCTAAACCTCTCTCTCACACTTAGT
 
. : . : . : . : . : . :
rJMFF047I02- TTCTAGGAAAGCTTATAAGCTTCTATTATGACTTATGAGCTAACATGAAAACCAAATGGT
rJMFF043K18- TTCTAGGAAAGCTTATAAGCTTCTATTATGACTTATGAGCTAACATGAAAACCAAATGGT
rJMFF034M04- TTCTAGGAAAGCTTATAAGCTTCTATTATGACTTATGAGCTAACATGAAAACCAAATGGT
rJMFF017N07- TTCTAGGAAAGCTTATAAGCTTCTATTATGACTTATGAGCTAACATGAAAACCAAATGGT
rJMSF041E23- TTCTAGGAAAGCTTATAAGCTTCTATTATGACTTATGAGCTAACATGAAAACCAAATGGT
rJMFF030M13- TTCTAGGAAAGCTTATAAGCTTCTATTATGACTTATGAGCTAACATGAAAACCAAATGGT
rJMFF014J13- TTCTAGGAAAGCTTATAAGCTTCTATTATGACTTATGAGCTAACATGAAAACCAAATGGT
rJMFF029O17- TTCTAGGAAAGCTTATAAGCTTCTATTATGACTTATGAGCTAACATGAAAACCAAATGGT
rJMFF020G05- TTCTAGGAAAGCTTATAAGCTTCTATTATGACTTATGAGCTAACATGAAAACCAAATGGT
rJMFF025L10- TTCTAGGAAAGCTTATAAGCTTCTATTATGACTTATGAGCTAACATGAAAACCAAATGGT
rJMSF013P15- TTCTAGGAAAGCTTATAAGCTTCTATTATGACTTATGAGCTAACATGAAAACCAAATGGT
rJMSF041L23- TTCTAGGAAAGCTTATAAGCTTCTATTATGACTTATGAGCTAACATGAAAACCAAATGGT
rJMFF015P04- TTCTAGGAAAGCTTATAAGCTTCTATTATGACTTATGAGCTAACATGAAAACCAAATGGT
rJMFF024F04- TTCTAGGAAAGCTTATAAGCTTCTATTATGACTTATGAGCTAACATGAAAACCAAATGGT
                      ____________________________________________________________
consensus TTCTAGGAAAGCTTATAAGCTTCTATTATGACTTATGAGCTAACATGAAAACCAAATGGT
 
. : . : . : . : . : . :
rJMFF047I02- GCACCTTAAGCGGCGTTTAATGTTTGTCCAATATCAATTACAAACCTATACTTAACATCG
rJMFF043K18- GCACCTTAAGCGGCGTTTAATGTTTGTCCAATATCAATTACAAACCTATACTTAACATCG
rJMFF034M04- GCACCTTAAGCGGCGTTTAATGTTTGTCCAATATCAATTACAAACCTATACTTAACATCG
rJMFF017N07- GCACCTTAAGCGGCGTTTAATGTTTGTCCAATATCAATTACAAACCTATACTTAACATCG
rJMSF041E23- GCACCTTAAGCGGCGTTTAATGTTTGTCCAATATCAATTACAAACCTATACTTAACATCG
rJMFF030M13- GCACCTTAAGCGGCGTTTAATGTTTGTCCAATATCAATTACAAACCTATACTTAACATCG
rJMFF014J13- GCACCTTAAGCGGCGTTTAATGTTTGTCCAATATCAATTACAAACCTATACTTAACATCG
rJMFF029O17- GCACCTTAAGCGGCGTTTAATGTTTGTCCAATATCAATTACAAACCTATACTTAACATCG
rJMFF020G05- GCACCTTAAGCGGCGTTTAATGTTTGTCCAATATCAATTACAAACCTATACTTAACATCG
rJMFF025L10- GCACCTTAAGCGGCGTTTAATGTTTGTCCAATATCAATTACAAACCTATACTTAACATCG
rJMSF013P15- GCACCTTAAGCGGCGTTTAATGTTTGTCCAATATCAATTACAAACCTATACTTAACATCG
rJMSF041L23- GCACCTTAAGCGGCGTTTAATGTTTGTCCAATATCAATTACAAACCTATACTTAACATCG
rJMFF015P04- GCACCTTAAGCGGCGTTTAATGTTTGTCCAATATCAATTACAAACCTATACTTAACATCG
rJMFF024F04- GCACCTTAAGCGGCGTTTAATGTTTGTCCAATATCAATTACAAACCTATACTTAACATCG
                      ____________________________________________________________
consensus GCACCTTAAGCGGCGTTTAATGTTTGTCCAATATCAATTACAAACCTATACTTAACATCG
 
. : . : . : . : . : . :
rJMFF047I02- TTCTTCTTAAGGCGGTCTATGGCAGTGTTCACATAATCCATGGGAACAACCTCAACATCC
rJMFF043K18- TTCTTCTTAAGGCGGTCTATGGCAGTGTTCACATAATCCATGGGAACAACCTCAACATCC
rJMFF034M04- TTCTTCTTAAGGCGGTCTATGGCAGTGTTCACATAATCCATGGGAACAACCTCAACATCC
rJMFF017N07- TTCTTCTTAAGGCGGTCTATGGCAGTGTTCACATAATCCATGGGAACAACCTCAACATCC
rJMSF041E23- TTCTTCTTAAGGCGGTCTATGGCAGTGTTCACATAATCCATGGGAACAACCTCAACATCC
rJMFF030M13- TTCTTCTTAAGGCGGTCTATGGCAGTGTTCACATAATCCATGGGAACAACCTCAACATCC
rJMFF014J13- TTCTTCTTAAGGCGGTCTATGGCAGTGTTCACATAATCCATGGGAACAACCTCAACATCC
rJMFF029O17- TTCTTCTTAAGGCGGTCTATGGCAGTGTTCACATAATCCATGGGAACAACCTCAACATCC
rJMFF020G05- TTCTTCTTAAGGCGGTCTATGGCAGTGTTCACATAATCCATGGGAACAACCTCAACATCC
rJMFF025L10- TTCTTCTTAAGGCGGTCTATGGCAGTGTTCACATAATCCATGGGAACAACCTCAACATCC
rJMSF013P15- TTCTTCTTAAGGCGGTCTATGGCAGTGTTCACATAATCCATGGGAACAACCTCAACATCC
rJMSF041L23- TTCTTCTTAAGGCGGTCTATGGCAGTGTTCACATAATCCATGGGAACAACCTCAACATCC
rJMFF015P04- TTCTTCTTAAGGCGGTCTATGGCAGTGTTCACATAATCCATGGGAACAACCTCAACATCC
rJMFF024F04- TTCTTCTTAAGGCGGTCTATGGCAGTGTTCACATAATCCATGGGAACAACCTCAACATCC
                      ____________________________________________________________
consensus TTCTTCTTAAGGCGGTCTATGGCAGTGTTCACATAATCCATGGGAACAACCTCAACATCC
 
. : . : . : . : . : . :
rJMFF047I02- GGCGTTATATTGTGCTTTGCAGAANAATCAAGCATTTC
rJMFF043K18- GGCGTTATATTGTGCTTTGCAGAAAAATCAAGCATTTCCTGTGTCTCCTTCAATCCTCCA
rJMFF034M04- GGCGTTATATTGTGCTTTGCAGAAAAATCAAGCATTTCCTGTGTCTCCTTCAATCCTCCA
rJMFF017N07- GGCGTTATATTGTGCTTTGCAGAAAAATCAAGCATTTCCTGTGTCTCCTTCAATCCTCCA
rJMSF041E23- GGCGTTATATTGTGCTTTGCAGAAAAATCAAGCATTTCCTGTGTCTCCTTCAATCCTCCA
rJMFF030M13- GGCGTTATATTGTGCTTTGCAGAAAAATCAAGCATTTCCTGTGTCTCCTTCAATCCTCCA
rJMFF014J13- GGCGTTATATTGTGCTTTGCAGAAAAATCAAGCATTTCCTGTGTCTCCTTCAATCCTCCA
rJMFF029O17- GGCGTTATATTGTGCTTTGCAGAAAAATCAAGCATTTCCTGTGTCTCCTTCAATCCTCCA
rJMFF020G05- GGCGTTATATTGTGCTTTGCAGAAAAATCAAGCATTTCCTGTGTCTCCTTCAATCCTCCA
rJMFF025L10- GGCGTTATATTGTGCTTTGCAGAAAAATCAAGCATTTCCTGTGTCTCCTTCAATCCTCCA
rJMSF013P15- GGCGTTATATTGTGCTTTGCAGAAAAATCAAGCATTTCCTGTGTCTCCTTCAATCCTCCA
rJMSF041L23- GGCGTTATATTGTGCTTTGCAGAAAAATCAAGCATTTCCTGTGTCTCCTTCAATCCTCCA
rJMFF015P04- GGCGTTATATTGTGCTTTGCAGAAAAATCAAGCATTTCCTGTGTCTCCTTCAATCCTCCA
rJMFF024F04- GGCGTTATATTGTGCTTTGCAGAAAAATCAAGCATTTCCTGTGTCTCCTTCAATCCTCCA
                      ____________________________________________________________
consensus GGCGTTATATTGTGCTTTGCAGAAAAATCAAGCATTTCCTGTGTCTCCTTCAATCCTCCA
 
. : . : . : . : . : . :
rJMFF043K18- ACGCTACTCCCACCCACCATCTTTCTACCTGTAATCAAGGGAGCAACTGGGAGTTCAAGT
rJMFF034M04- ACGCTACTCCCACCCACCATCTTTCTACCTGTAATCAAGGGAGCAACTGGGAGTTCAAGT
rJMFF017N07- ACGCTACTCCCACCCACCATCTTTCTACCTGTAATCAAGGGAGCAACTGGGAGTTCAAGT
rJMSF041E23- ACGCTACTCCCACCCACCATCTTTCTACCTGTAATCAAGGGAGCAACTGGGAGTTCAAGT
rJMFF030M13- ACGCTACTCCCACCCACCATCTTTCTACCTGTAATCAAGGGAGCAACTGGGAGTTCAAGT
rJMFF014J13- ACGCTACTCCCACCCACCATCTTTCTACCTGTAATCAAGGGAGCAACTGGGAGTTCAAGT
rJMFF029O17- ACGCTACTCCCACCCACCATCTTTCTACCTGTAATCAAGGGAGCAACTGGGAGTTCAAGT
rJMFF020G05- ACGCTACTCCCACCCACCATCTTTCTACCTGTAATCAAGGGAGCAACTGGGAGTTCAAGT
rJMFF025L10- ACGCTACTCCCACCCACCATCTTTCTACCTGTAATCAAGGGAGCAACTGGGAGTTCAAGT
rJMSF013P15- ACGCTACTCCCACCCACCATCTTTCTACCTGTAATCAAGGGAGCAACTGGGAGTTCAAGT
rJMSF041L23- ACGCTACTCCCACCCACCATCTTTCTACCTGTAATCAAGGGAGCAACTGGGAGTTCAAGT
rJMFF015P04- ACGCTACTCCCACCCACCATCTTTCTACCTGTAATCAAGGGAGCAACTGGGAGTTCAAGT
rJMFF024F04- ACGCTACTCCCACCCACCATCTTTCTACCTGTAATCAAGGGAGCAACTGGGAGTTCAAGT
                      ____________________________________________________________
consensus ACGCTACTCCCACCCACCATCTTTCTACCTGTAATCAAGGGAGCAACTGGGAGTTCAAGT
 
. : . : . : . : . : . :
rJMFF043K18- GGCTTGTCTGGTACACCCACCATCACATGCTTCCCGTTTGTCTTCAATAAACTTAGCAAT
rJMFF034M04- GGCTTGTCTGGTACACCCACCATCACATGCTTCCCGTTTGTCTTCAATAAACTTAGCAAT
rJMFF017N07- GGCTTGTCTGGTACACCCACCATCACATGCTTCCCGTTTGTCTTCAATAAACTTAGCAAT
rJMSF041E23- GGCTTGTCTGGTACACCCACCATCACATGCTTCCCGTTTGTCTTCAATAAACTTAGCAAT
rJMFF030M13- GGCTTGTCTGGTACACCCACCATCACATGCTTCCCGTTTGTCTTCAATAAACTTAGCAAT
rJMFF014J13- GGCTTGTCTGGTACACCCACCATCACATGCTTCCCGTTTGTCTTCAATAAACTTAGCAAT
rJMFF029O17- GGCTTGTCTGGTACACCCACCATCACATGCTTCCCGTTTGTCTTCAATAAACTTAGCAAT
rJMFF020G05- GGCTTGTCTGGTACACCCACCATCACATGCTTCCCGTTTGTCTTCAATAAACTTAGCAAT
rJMFF025L10- GGCTTGTCTGGTACACCCACCATCACATGCTTCCCGTTTGTCTTCAATAAACTTAGCAAT
rJMSF013P15- GGCTTGTCTGGTACACCCACCATCACTTGCTTCCCGTTTGTCTTCAATAAACTTAGCAAT
rJMSF041L23- GGCTTGTCTGGTACACCCACCATCACATGCTTCCCGTTTGTCTTCAATAAACTTAGCAAT
rJMFF015P04- GGCTTGTCTGGTACACCCACCATCACATGCTTCCCGTTTGTCTTCAATAAACTTAGCAAT
rJMFF024F04- GGCTTGTCTGGTACACCCACCATCACATGCTTCCCGTTTGTCTTCAATAAACTTAGCAAT
                      ____________________________________________________________
consensus GGCTTGTCTGGTACACCCACCATCACATGCTTCCCGTTTGTCTTCAATAAACTTAGCAAT
 
. : . : . : . : . : . :
rJMFF043K18- GGCAGAACAGGATGGGAAGCAGAAACCGTGTCGAGTATACCATCCAACGTGCCCATTGCA
rJMFF034M04- GGCAGAACAGGATGGGAAGCAGAAACCGTGTCGAGTATACCATCCAACGTGCCCATTGCA
rJMFF017N07- GGCAGAACAGGATGGGAAGCAGAAACCGTGTCGAGTATACCATCCANCGTGCCCATTGCA
rJMSF041E23- GGCAGAACAGGATGGGAAGCAGAAACCGTGTCGAGTATACCATCCAACGTGCCCATTGCA
rJMFF030M13- GGCAGAACAGGATGGGAAGCAGAAACCGTGTCGAGTATACCATCCAACGTGCCCATTGCA
rJMFF014J13- GGCAGAACAGGATGGGAAGCAGAAACCGTGTCGAGTATACCATCCAACGTGCCCATTGCA
rJMFF029O17- GGCAGAACAGGATGGGAAGCAGAAACCGTGTCGAGTATACCATCCAACGTGCCCATTGCA
rJMFF020G05- GGCAGAACAGGATGGGAAGCAGAAACCGTGTCGAGTATACCATCCAACGTGCCCATTGCA
rJMFF025L10- GGCAGAACAGGATGGGAAGCAGAAACCGTGTCGAGTATACCATCCAACGTGCCCATTGCA
rJMSF013P15- GGCAGAACAGGATGGGAAGCAGAAACCGTGTCGAGTATACCATCCAACGTGCCCATTGCA
rJMSF041L23- GGCAGAACAGGATGGGAAGCAGAAACCGTGTCGAGTATACCATCCAACGTGCCCATTGCA
rJMFF015P04- GGCAGAACAGGATGGGAAGCAGAAACCGTGTCGAGTATACCATCCAACGTGCCCATTGCA
rJMFF024F04- GGCAGAACAGGATGGGAAGCAGAAACCGTGTCGAGTATACCATCCAACGTGCCCATTGCA
                      ____________________________________________________________
consensus GGCAGAACAGGATGGGAAGCAGAAACCGTGTCGAGTATACCATCCAACGTGCCCATTGCA
 
. : . : . : . : . : . :
rJMFF043K18- GCCTCCATTTGTTGGGGGTC
rJMFF034M04- GCCTCCATTTGTTGGGGGTCACGGCTAATCAAGAACGAGTCTGCA-CCCAGATGGTCAAT
rJMFF017N07- GCCTCCATTTGTTGGGGGTCACGGCTAATCAAGAACGAGTCTGCA-CCCAGATGGTCAAT
rJMSF041E23- GCCTCCATTTGTTGGGGGTCACGGCTAATCAAGAACGAGTCTGCA-CCCAGATGGTCAAT
rJMFF030M13- GCCTCCATTTGTTGGGGGTCACGGCTAATCAAGAACGAGTCTGCACCC
rJMFF014J13- GCCTCCATTTGTTGGGGGTCACGGCTAATCAAGAACGAGTCTGCA-CCCAGATGGTCAAT
rJMFF029O17- GCCTCCATTTGTTGGGGGTCACGGCTAATCAAGAACGAGTCTGCA-CCCAGATGGTCAAT
rJMFF020G05- GCCTCCATTTGTTGGGGGTCACGGCTAATCAAGAACGAGTCTGCA-CCCAGATGGTCAAT
rJMFF025L10- GCCTCCATTTGTTGGGGGTCACGGCTAATCAAGAACGAGTCTGCA-CCCAGATGGTCAAT
rJMSF013P15- GCCTCCATTTGTTGGGGGTCACGGCTAATCAAGAACGAGTCTGCA-CCCAGATGGTCAAT
rJMSF041L23- GCCTCCATTTGTTGGGGGTCACGGCTAATCAAGAACGAGTCTGCACCCCAGATGGTCAAT
rJMFF015P04- GCCTCCATTTGTTGGGGGTCACGGCTAATCAAGAACGAGTCTGCA-CCCAGATGGTCAAT
rJMFF024F04- GCCTCCATTTGTTGGGGGTCACGGCTAATCAAGAACGAGTCTGCA-CCCAGATGGTCAAT
                      ____________________________________________________________
consensus GCCTCCATTTGTTGGGGGTCACGGCTAATCAAGAACGAGTCTGCA-CCCAGATGGTCAAT
 
. : . : . : . : . : . :
rJMFF034M04- AGCCTCTTGCTTCTTACTAGCAGAGGTGCTGATGACTGTGACCTTCATTCCAAAGGCCTT
rJMFF017N07- AGCCTCTTGCTTCTTACTAGCAGAGGTGCTGATGACTGTGACCTTCATTCCAAAGGCCTT
rJMSF041E23- AGCCTCTTGCTTCTTACTAGCAGAGGTGCTGATGACTGTGACC
rJMFF014J13- AGCCTCTTGCTTCTTACTAGCAGAGGTGCTGATGACTGTGACCTTCATTCC
rJMFF029O17- AGCCTCTTGCTTCTTACTAGCAGAGGTGCTGATGACTGTGACCTTCATTCCAAAGGCCTT
rJMFF020G05- AGCCTCTTGCTTCTTACTAGCAGAGGTGCTGATGACTGTGACCTTCATTCCAAAGGCCTT
rJMFF025L10- AGCCTCTTGCTTCTTACTAGCAGAGGTGCTGATGACTGTGACCTTCATTCCAAAGGCCTT
rJMSF013P15- AGCCTCTTGCTTCTTACTAGCAGAGGTGCTGATGACTGTGACCTTCATTCCAAAGGCCTT
rJMSF041L23- AGCCTCTGGCTCCTTACTAGCAGAGGTGCTGATGACTGTGACCTTCATTCCAA
rJMFF015P04- AGCCTCTTGCTTCTTACTAGCAGAGGTGCTGATGACTGTGACCTTCATTCCAAAGGCCTT
rJMFF024F04- AGCCTCTTGCTTCTTACTAGCAGAGGTGCTGATGACTGTGACCTTCATTCCAAAGGCCTT
                      ____________________________________________________________
consensus AGCCTCTTGCTTCTTACTAGCAGAGGTGCTGATGACTGTGACCTTCATTCCAAAGGCCTT
 
. : . : . : . : . : . :
rJMFF034M04- CCCGAACTTAACCGCCAAGTGACCCAGCCCTCCAA
rJMFF017N07- CCCGAACTTAACCGCCAAGTGACCCAGCCCTC
rJMFF029O17- CCCGAACTTAACCGCCAAGTGACCCAGCCCTCCNAGACCCACAACGCCAATGCTCATCCC
rJMFF020G05- CCCGAACTTAACCGCCNAGTGACCCAGCCCTCCAAGACCCACAACGCCAATGCTCATCCC
rJMFF025L10- CCCGAACTTAACCGCCAAGTGACCCAGCCCTCCAAGACCCACAACGCCAATGCTCATCCC
rJMSF013P15- CCCGAACTTAACCGCCAAGTGACCCAGCCCTCCAAGACCCACAACGCCNATGCTCATCCC
rJMFF015P04- CCCGAACTTAACCGCCAAGTGACCCAGCCCTCCAAGACCCACAACGCCAATGCTCATCCC
rJMFF024F04- CCCGAACTTAACCGCCAAGTGACCCAGCCCTCCAAGACCCACAACGCCAATGCTCATCCC
JMFS151A11+ AGTGACCCAGCCCTCCAAGACCCACAACGCCAATGCTCATCCC
JMFF043K18+ TCATCCC
JMSF041E23+ ACAACGCCAATGCTCATCCC
                      ____________________________________________________________
consensus CCCGAACTTAACCGCCAAGTGACCCAGCCCTCCAAGACCCACAACGCCAATGCTCATCCC
 
. : . : . : . : . : . :
rJMFF020G05- TGGCTTGT
rJMFF025L10- TGGCTTGTCAAGTCCGTA
rJMSF013P15- TGGCTGGTC-AGTCCGTAGT
rJMFF015P04- TGGCTTGTCAAGTCCGTAGT
rJMFF024F04- TGGCTTGTCNAGTCCGTAGTATTTCAAGGGACTGTAAGTGGTGACTCCG
JMFS151A11+ TGGCTTGTCAAGTCCGTAGTATTTCAAGGGACTGTAAGTGGTGACTCCGGCGCAAAGCAG
JMFS124E11+ TCAAGTCCGTAGTATTTCAAGGGACTGTAAGTGGTGACTCCGGCGCAAAGCAG
JMFF043K18+ TGGCTTGTCAAGTCCGTAGTATTTCAAGGGACTGTAAGTGGTGACTCCGGCGCAAAGCAG
JMFF025L10+ CAAGTCCGTAGTATTTCAAGGGACTGTAAGTGGTGACTCCGGCGCAAAGCAG
JMFF017N07+ CGCAAAGCAG
JMSF041E23+ TGGCTTGTCAAGTCCGTAGTATTTCAAGGGACTGTAAGTGGTGACTCCGGCGCAAAGCAG
JMSF041L23+ AGTCCGTAGTATTTCAAGGGACTGTAAGTGGTGACTCCGGCGCAAAGCAG
                      ____________________________________________________________
consensus TGGCTTGTCAAGTCCGTAGTATTTCAAGGGACTGTAAGTGGTGACTCCGGCGCAAAGCAG
 
. : . : . : . : . : . :
JMFS151A11+ CGGAGCAGCCTCCATGGGCAGGTTTTCCGGCCAACGGACGACGAAGCGCTCATCGGCAAC
JMFS124E11+ CGGAGCAGCCTCCATGGGCAGGTTTTCCGGCCAACGGACGACGAAGCGCTCATCGGCAAC
JMSF013P15+ TCGGCAAC
JMFF043K18+ CGGAGCAGCCTCCATGGGCAGGTTTTCCGGCCAACGGACGACGAAGCGCTCATCGGCAAC
JMFF025L10+ CGGAGCAGCCTCCATGGGCAGGTTTTCCGGCCAACGGACGACGAAGCGCTCATCGGCAAC
JMFF024F04+ CTCATCGGCAAC
JMFF017N07+ CGGAGCAGCCTCCATGGGCAGGTTTTCCGGCCAACGGACGACGAAGCGCTCATCGGCAAC
JMSF041E23+ CGGAGCAGCCTCCATGGGCAGGTTTTCCGGCCAACGGACGACGAAGCGCTCATCGGCAAC
JMSF041L23+ CGGAGCAGCCTCCATGGGCAGGTTTTCCGGCCAACGGACGACGAAGCGCTCATCGGCAAC
                      ____________________________________________________________
consensus CGGAGCAGCCTCCATGGGCAGGTTTTCCGGCCAACGGACGACGAAGCGCTCATCGGCAAC
 
. : . : . : . : . : . :
JMFS151A11+ CATGATGTCGGAGTAACCACCATATGTCACGGTGCCGTTAGTCTTGCCGTTGGCAGTTGT
JMFS124E11+ CATGATGTCGGAGTAACCACCATATGTCACGGTGCCGTTAGTCTTGCCGTTGGCAGTTGT
JMSF013P15+ CATGATGTCGGAGTAACCACCATATGTCACGGTGCCGTTAGTCTTGCCGTTGGCAGTTGT
JMFF043K18+ CATGATGTCGGAGTAACCACCATATGTCACGGTGCCGTTAGTCTTGCCGTTGGCAGTTGT
JMFF025L10+ CATGATGTCGGAGTAACCACCATATGTCACGGTGCCGTTAGTCTTGCCGTTGGCAGTTGT
JMFF024F04+ CATGATGTCGGAGTAACCACCATATGTCACGGTGCCGTTAGTCTTGCCGTTGGCAGTTGT
JMFF017N07+ CATGATGTCGGAGTAACCACCATATGTCACGGTGCCGTTAGTCTTGCCGTTGGCAGTTGT
JMFF020G05+ AACCACCATATGTCACGGTGCCGTTAGTCTTGCCGTTGGCAGTTGT
JMSF041E23+ CATGATGTCGGAGTAACCACCATATGTCACGGTGCCGTTAGTCTTGCCGTTGGCAGTTGT
JMSF041L23+ CATGATGTCGGAGTAACCACCATATGTCACGGTGCCGTTAGTCTTGCCGTTGGCAGTTGT
                      ____________________________________________________________
consensus CATGATGTCGGAGTAACCACCATATGTCACGGTGCCGTTAGTCTTGCCGTTGGCAGTTGT
 
. : . : . : . : . : . :
JMFS151A11+ TACGTTTTTGGGGCAATAATTTTCTAGATCGTTTTCGCAGTTTTGGCATTTGCAGCAGGA
JMFS124E11+ TACGTTTTTGGGGCAATAATTTTCTAGATCGTTTTCGCAGTTTTGGCATTTGCAGCAGGA
JMSF013P15+ TACGTTTTTGGGGCAATAATTTTCTAGATCGTTTTCGCAGTTTTGGCATTTGCAGCAGGA
JMFF043K18+ TACGTTTTTGGGGCAATAATTTTCTAGATCGTTTTCGCAGTTTTGGCATTTGCAGCAGGA
JMFF025L10+ TACGTTTTTGGGGCAATAATTTTCTAGATCGTTTTCGCAGTTTTGGCATTTGCAGCAGGA
JMFF024F04+ TACGTTTTTGGGGCAATAATTTTCTAGATCGTTTTCGCAGTTTTGGCATTTGCAGCAGGA
JMFF017N07+ TACGTTTTTGGGGCAATAATTTTCTAGATCGTTTTCGCAGTTTTGGCATTTGCAGCAGGA
JMFF020G05+ TACGTTTTTGGGGCAATAATTTTCTAGATCGTTTTCGCAGTTTTGGCATTTGCAGCAGGA
JMSF041E23+ TACGTTTTTGGGGCAATAATTTTCTAGATCGTTTTCGCAGTTTTGGCATTTGCAGCAGGA
JMSF041L23+ TACGTTTTTGGGGCAATAATTTTCTAGATCGTTTTCGCAGTTTTGGCATTTGAAGCAGGA
                      ____________________________________________________________
consensus TACGTTTTTGGGGCAATAATTTTCTAGATCGTTTTCGCAGTTTTGGCATTTGCAGCAGGA
 
. : . : . : . : . : . :
JMFS151A11+ GCCTACGATATAGCCAACTCCTACTTTGTCCCCAACCTTAAATTTCTCGACCTTACTCCC
JMFS124E11+ GCCTACGATATAGCCAACTCCTACTTTGTCCCCAACCTTAAATTTCTCGACCTTACTCCC
JMSF013P15+ GCCTACGATATAGCCAACTCCTACTTTGTCCCCAACCTTAAATTTCTCGACCTTACTCCC
JMFF043K18+ GCCTACGATATAGCCAACTCCTACTTTGTCCCCAACCTTAAATTTCTCGACCTTACTCCC
JMFF025L10+ GCCTACGATATAGCCAACTCCTACTTTGTCCCCAACCTTAAATTTCTCGACCTTACTCCC
JMFF024F04+ GCCTACGATATAGCCAACTCCTACTTTGTCCCCAACCTTAAATTTCTCGACCTTACTCCC
JMFF017N07+ GCCTACGATATAGCCAACTCCTACTTTGTCCCCAACCTTAAATTTCTCGACCTTACTCCC
JMFF020G05+ GCCTACGATATAGCCAACTCCTACTTTGTCCCCAACCTTAAATTTCTCGACCTTACTCCC
JMSF041E23+ GCCTACGATATAGCCAACTCCTACTTTGTCCCCAACCTTAAATTTCTCGACCTTACTCCC
JMSF041L23+ GCCTACGATATAGCCAACTCCTACTTTGTCCCCAACCTTAAATTTCTCGACCTTACTCCC
JMFF015P04+ TTCTCGACCTTACTCCC
JMFF014J13+ CTTACTCCC
JMFF034M04+ TACTCCC
                      ____________________________________________________________
consensus GCCTACGATATAGCCAACTCCTACTTTGTCCCCAACCTTAAATTTCTCGACCTTACTCCC
 
. : . : . : . : . : . :
JMFS151A11+ AACCTCAGTCACCACCCCATTAATTTCGTGTCCAGGTACAATTGGATAAGTGGTGTTTCC
JMFS124E11+ AACCTCAGTCACCACCCCATTAATTTCGTGTCCAGGTACAATTGGATAAGTGGTGTTTCC
JMSF013P15+ AACCTCAGTCACCACCCCATTAATTTCGTGTCCAGGTACAATTGGATAAGTGGTGTTTCC
JMFF043K18+ AACCTCAGTCACCACCCCATTAATTTCGTGTCCAGGTACAATTGGATAAGTGGTGTTTCC
JMFF025L10+ AACCTCAGTCACCACCCCATTAATTTCGTGTCCAGGTACAATTGGATAAGTGGTGTTTCC
JMFF024F04+ AACCTCAGTCACCACCCCATTAATTTCGTGTCCAGGTACAATTGGATAAGTGGTGTTTCC
JMFF017N07+ AACCTCAGTCACCACCCCATTAATTTCGTGTCCAGGTACAATTGGATAAGTGGTGTTTCC
JMFF020G05+ AACCTCAGTCACCACCCCATTAATTTCGTGTCCAGGTACAATTGGATAAGTGGTGTTTCC
JMSF041E23+ AACCTCAGTCACCACCCCATTAATTTCGTGTCCAGGTACAATTGGATAAGTGGTGTTTCC
JMSF041L23+ AACCTCAGTCACCACCCCATTAATTTCGTGTCCAGGTACAATTGGATAAGTGGTGTTTCC
JMFF015P04+ AACCTCAGTCACCACCCCATTAATTTCGTGTCCAGGTACAATTGGATAAGTGGTGTTTCC
JMFF014J13+ AACCTCAGTCACCACCCCATTAATTTCGTGTCCAGGTACAATTGGATAAGTGGTGTTTCC
JMFF034M04+ AACNTCAGTCACCACCCCATTAATTTCGTGTCCAGGTACAATTGGATAAGTGGTGTTTCC
JMFF029O17+ AGTCACCACCCCATTAATTTCGTGTCCAGGTACAATTGGATAAGTGGTGTTTCC
                      ____________________________________________________________
consensus AACCTCAGTCACCACCCCATTAATTTCGTGTCCAGGTACAATTGGATAAGTGGTGTTTCC
 
. : . : . : . : . : . :
JMFS151A11+ CCAGTCATTCTTGATCTGGTGAAGATCGGAGTGGCAGATGCCACAATACAGAACTTTGAA
JMFS124E11+ CCAGTCATTCTTGATCTGGTGAAGATCGGAGTGGCAGATGCCACAATACAGAACTTTGAA
JMSF013P15+ CCAGTCATTCTTGATCTGGTGAAGATCGGAGTGGCAGATGCCACAATACAGAACTTTGAA
JMFF043K18+ CCAGTCATTCTTGATCTGGTGAAGATCGGAGTGGCAGATGCCACAATACAGAACTTTGAA
JMFF025L10+ CCAGTCATTCTTGATCTGGTGAAGATCGGAGTGGCAGATGCCACA--ACAGAACTTTGAA
JMFF024F04+ CCAGTCATTCTTGATCTGGTGAAGATCGGAGTGGCAGATGCCACA--ACAGAACTTTGAA
JMFF017N07+ CCAGTCATTCTTGATCTGGTGAAGATCGGAGTGGCAGATGCCACA--ACAGAACTTTGAA
JMFF020G05+ CCAGTCATTCTTGATCTGGTGAAGATCGGAGTGGCAGATGCCACAATACAGAACTTTGAA
JMSF041E23+ CCAGTCATTCTTGATCTGGTGAAGATCGGAGTGGCAGATGCCACAATACAGAACTTTGAA
JMSF041L23+ CCAGTCATTCTTGATCTGGTGAAGATCGGAGTGGCAGATGCCACAATACAGAACTTTGAA
JMFF015P04+ CCAGTCATTCTTGATCTGGTGAAGATCGGAGTGGCAGATGCCACAATACAGAACTTTGAA
JMFF014J13+ CCAGTCATTCTTGATCTGGTGAAGATCGGAGTGGCAGATGCCACAATACAGAACTTTGAA
JMFF034M04+ CCAGTCATTCTTGATCTGGTGAAGATCGGAGTGGCAGATGCCACAATACAGAACTTTGAA
JMFF047I02+ GAGTGGCAGATGCCACAATACAGAACTTTGAA
JMFF029O17+ CCAGTCATTCTTGATCTGGTGAAGATCGGAGTGGCAGATGCCACAATACAGAACTTTGAA
                      ____________________________________________________________
consensus CCAGTCATTCTTGATCTGGTGAAGATCGGAGTGGCAGATGCCACAATACAGAACTTTGAA
 
. : . : . : . : . : . :
JMFS151A11+ CTGCACATCTTTTTCGCCCGTTTCTCGTCTGGAAAACTTGAAAGGAGAGAGAAGGCCAGA
JMFS124E11+ CTGCACATCTTTTTCGCCCGTTTCTCGTCTGGAAAACTTGAAAGGAGAGAGAAGGCCAGA
JMSF013P15+ CTGCACATCTTTTTCGCCCGTTTCTCGTCTGGAAAACTTGAAAGGAGAGAGAAGGCCAGA
JMFF043K18+ CTGCACATCTTTTTCGCCCGTTTCTCGTCTGGAAAACTTGAAAGGAGAGAGAAGGCCAGA
JMFF025L10+ CTGCACATCTTTTTCGCCCGTTTCTCGTCTGGAAAACTTGAAAGGAGAGAGAAGGCCAGA
JMFF024F04+ CTGCACATCTTTTTCGCCCGTTTCTCGTCTGGAAAACTTGAAAGGAGAGAGAAGGCCAGA
JMFF017N07+ CTGCACATCTTTTTCGCCCGTTTCTCGTCTGGAAAACTTGAAAGGAGAGAGAAGGCCAGA
JMFF020G05+ CTGCACATCTTTTTCGCCCGTTTCTCGTCTGGAAAACTTGAAAGGAGAGAGAAGGCCAGA
JMSF041E23+ CTGCACATCTTTTTCGCCCGTTTCTCGTCTGGAAAACTTAAAAGGAGAGAGAAGGCCAGA
JMSF041L23+ CTGCACATCTTTTTCGCCCGTTTCTCGTCTGGAAAACTTGAAAGGAGAGAGAAGGCCAGA
JMFF015P04+ CTGCACATCTTTTTCGCCCGTTTCTCGTCTGGAAAACTTGAAAGGAGAGAGAAGGCCAGA
JMFF014J13+ CTGCACATCTTTTTCGCCCGTTTCTCGTCTGGAAAACTTGAAAGGAGAGAGAAGGCCAGA
JMFF034M04+ CTGCACATCTTTTTCGCCCGTTTCTCGTCTGGAAAACTTGAAAGGAGAGAGAAGGCCAGA
JMFF047I02+ CTGCACATCTTTTTCGCCCGTTTCTCGTCTGGAAAACTTGAAAGGAGAGAGAAGGCCAGA
JMFF029O17+ CTGCACATCTTTTTCGCCCGTTTCTCGTCTGGAAAACTTGAAAGGAGAGAGAAGGCCAGA
                      ____________________________________________________________
consensus CTGCACATCTTTTTCGCCCGTTTCTCGTCTGGAAAACTTGAAAGGAGAGAGAAGGCCAGA
 
. : . : . : . : . : . :
JMFS151A11+ GGTGTCAGTAGCTGCCCATCCAAAGGCCTTCACTGGGAACTCTTCCTCGTACGATTTAGG
JMFS124E11+ GGTGTCAGTAGCTGCCCATCCAAAGGCCTTCACTGGGAACTCTTCCTCGTACGATTTAGG
JMSF013P15+ GGTGTCAGTAGCTGCCCATCCAAAGGCCTTCACTGGGAACTCTTCCTCGTACGATTTAGG
JMFF043K18+ GGTGTCAGTAGCTGCCCATCCAAAGGCCTTCACTGGGAACTCTTCCTCGTACGATTTAGG
JMFF025L10+ GGTGTCAGTAGCTGCCCATCCAAAGGCCTTCACTGGGAACTCTTCCTCGTACGATTTAGG
JMFF024F04+ GGTGTCAGTAGCTGCCCATCCAAAGGCCTTCACTGGGAACTCTTCCTCGTACGATTTAGG
JMFF017N07+ GGTGTCAGTAGCTGCCCATCCAAAGGCCTTCACTGGGAACTCTTCCTCGTACGATTTAGG
JMFF020G05+ GGTGTCAGTAGCTGCCCATCCAAAGGCCTTCACTGGGAACTCTTCCTCGTACGATTTAGG
JMSF041E23+ GGTGTCAGTAGCTGCCCATCCAAAGGCCTTCACTGGGAACTCTTCCTCGTACGATTTAGG
JMSF041L23+ GGTGTCAGTAGCTGCCCATCCAAAGGCCTTCACTGGGAACTCTTCCTCGTACGATTTAGG
JMFF015P04+ GGTGTCAGTAGCTGCCCATCCAAAGGCCTTCACTGGGAACTCTTCCTCGTACGATTTAGG
JMFF014J13+ GGTGTCAGTAGCTGCCCATCCAAAGGCCTTCACTGGGAACTCTTCCTCGTACGATTTAGG
JMFF034M04+ GGTGTCAGTAGCTGCCCATCCAAAGGCCTTCACTGGGAACTCTTCCTCGTACGATTTAGG
JMFF047I02+ GGTGTCAGTAGCTGCCCATCCAAAGGCCTTCACTGGGAACTCTTCCTCGTACGATTTAGG
JMFF029O17+ GGTGTCAGTAGCTGCCCATCCAAAGGCCTTCACTGGGAACTCTTCCTCGTACGATTTAGG
                      ____________________________________________________________
consensus GGTGTCAGTAGCTGCCCATCCAAAGGCCTTCACTGGGAACTCTTCCTCGTACGATTTAGG
 
. : . : . : . : . : . :
JMFS151A11+ TGCTGCCATTTTAGTTGCTTCAGACAAGGATGATTTGA
JMFS124E11+ TGCTGCCATTTTAGTTGCTTCAGACAAGGATGATTTGA
JMSF013P15+ TGCTGCCATTTTAGTTGCTTCAGACAAGGATGATTTGATGAGAGTGGTCGGAGAAGAAGA
JMFF043K18+ TGCTGCCATTTTAGTTGCTTCAGACAAGGATGATTTGATGAGAGTGGTCGGAGAAGAAGA
JMFF025L10+ TGCTGCCATTTTAGTTGCTTCAGACAAGGATGATTTGATGAGAGTGGTCGGAGAAGAAGA
JMFF024F04+ TGCTGCCATTTTAGTTGCTTCAGACAAGGATGATTTGATGAGAGTGGTCGGAGAAGAAGA
JMFF017N07+ TGCTGCCATTTTAGTTGCTTCAGACAAGGATGATTTGATGAGAGTGGTCGGAGAAGAAGA
JMFF020G05+ TGCTGCCATTTTAGTTGCTTCAGACAAGGATGATTTGATGAGAGTGGTCGGAGAAGAAGA
JMSF041E23+ TGCTGCCATTTTAGTTGCTTCAGACAAGGATGATTTGATGAGAGTGGTCGGAGAAGAAGA
JMSF041L23+ TGCTGCCATTTTAGTTGCTTCAGACAAGGATGATTTGATGAGAGTGGTCGGAGAAGAAGA
JMFF015P04+ TGCTGCCATTTTAGTTGCTTCAGACAAGGATGATTTGATGAGAGTGGTCGGAGAAGAAGA
JMFF014J13+ TGCTGCCATTTTAGTTGCTTCAGACAAGGATGATTTGATGAGAGTGGTCGGAGAAGAAGA
JMFF034M04+ TGCTGCCATTTTAGTTGCTTCAGACAAGGATGATTTGATGAGAGTGGTCGGAGAAGAAGA
JMFF047I02+ TGCTGCCATTTTAGTTGCTTCAGACAAGGATGATTTGATGAGAGTGGTCGGAGAAGAAGA
JMFF029O17+ TGCTGCCATTTTAGTTGCTTCAGACAAGGATGATTTGATGAGAGTGGTCGGAGAAGAAGA
                      ____________________________________________________________
consensus TGCTGCCATTTTAGTTGCTTCAGACAAGGATGATTTGATGAGAGTGGTCGGAGAAGAAGA
 
. : . : . : . : . : . :
JMSF013P15+ GATGAGAATA
JMFF043K18+ GATGAGAATAT
JMFF025L10+ GATGAGAATAT
JMFF024F04+ GATGAGAATAT
JMFF017N07+ GATGAGAATAT
JMFF020G05+ GATGAGAATATGAGATCTTAATGGTAAAGCAGGAACGCATATATTGGTATGAAAG
JMSF041E23+ GATGAGAATATGAGATCTTAATGGTAAAGCAGGAACGCATATATTGGTATGAAAGAGTAA
JMSF041L23+ GATGAGAATATGAGATCTTAATGGTAAAGCAGGAACGCATATATTGGTATGAAAGAGTAA
JMFF015P04+ GATGAGAATATGAGATCTTAATGGTAAAGCAGGAACGCATATATTGGTATGAAAGAGTAA
JMFF014J13+ GATGAGAATATGAGATCTTAATGGTAAAGCAGGAACGCATATATTGGTATGAAAGAGTAA
JMFF034M04+ GATGAGAATATGAGATCTTAATGGTAAAGCAGGAACGCATATATTGGTATGAAAGAGTAA
JMFF047I02+ GATGAGAATATGAGATCTTAATGGTAAAGCAGGAACGCATATATTGGTATGAAAGAGTAA
JMFF029O17+ GATGAGAATATGAGATCTTAATGGTAAAGCAGGAACGCATATATTGGTATGAAAGAGTAA
                      ____________________________________________________________
consensus GATGAGAATATGAGATCTTAATGGTAAAGCAGGAACGCATATATTGGTATGAAAGAGTAA
 
. : . : . : . : . : . :
JMSF041E23+ AGGGCCTTGAAGAAAATGTGCAAGTGGCATTATTATTGGCATATCAGATATTATCACCTT
JMSF041L23+ AGGGCCTTGAAGAAAATGTGCAAGTGGCATTATTATTGGCATATCAGATATTATCACCTT
JMFF015P04+ AGGGCCTTGAAGAAAATGTGCAAGTGGCATTATTATTGGCATATCAGATATTATCACCTT
JMFF014J13+ AGGGCCTTGAAGAAAATGTGCAAGTGGCATTATTATTGGCATATCAGATATTATCACCTT
JMFF034M04+ AGGGCCTTGAAGAAAATGTGCAAGTGGCATTATTATTGGCATATCAGATATTATCACCTT
JMFF047I02+ AGGGCCTTGAAGAAAATGTGCAAGTGGCATTATTATTGGCATATCAGATATTATCACCTT
JMFF029O17+ AGGGCCTTGAAGAAAATGTGCAAGTGGCATTATTATTGGCATATCAGATATTATCACCTT
                      ____________________________________________________________
consensus AGGGCCTTGAAGAAAATGTGCAAGTGGCATTATTATTGGCATATCAGATATTATCACCTT
 
. : . : . : . : . : . :
JMSF041E23+ GTGGTTATCCTGATATTTGTCATCCGCACA
JMSF041L23+ GTGGTTATCCTGATATTTGTCATCCGCACAT
JMFF015P04+ GTGGTTATCCTGATATTTGTCATCCGCACATAC
JMFF014J13+ GTGGTTATCCTGATATTTGTCATCCGCACATAC
JMFF034M04+ GTGGTTATCCTGATATTTGTCATCCGCACATACAAAAATAATTGAGCTTTGGTTTATCTT
JMFF047I02+ GTGGTTATCCTGATATTTGTCATCCGCACATACAAAAATAATTGAGCTTTGGTTTATCTT
JMFF029O17+ GTGGTTATCCTGATATTTGTCATCCGCACATACAAAAATAATTGAGCTTTGGTTTATCTT
                      ____________________________________________________________
consensus GTGGTTATCCTGATATTTGTCATCCGCACATACAAAAATAATTGAGCTTTGGTTTATCTT
 
. : . : . : . : . : . :
JMFF034M04+ ATATACTATCTCACTTGTTATGAAACGTGAATAACGCTATGATATACTATAAGATATAAT
JMFF047I02+ ATATACTATCTCACTTGTTATGAAACGTGAATAACGCTATGATATACTATAAGATATAAT
JMFF029O17+ ATATACTATCTCACTTGTTATGAAACGTGAATAACGCTATGATATACTATAAGATATAAT
                      ____________________________________________________________
consensus ATATACTATCTCACTTGTTATGAAACGTGAATAACGCTATGATATACTATAAGATATAAT