Previous Contig 001366:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF029N04Sequence568001366 (2)758013032 (3)gb:AP001297_18209627e-22Arabidopsis thaliana genomic DNA, chromosome 3, BAC clone:F14O13.
JMFF051O13Sequence611001366 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF051O13+ AGATTATGCCA
                      ____________________________________________________________
consensus AGATTATGCCA
 
. : . : . : . : . : . :
JMFF051O13+ ATTAGAAATTATCTAAAATTTCCTCATTCCTCACAGAATAATACAGACATACTGTTTACA
JMFF029N04+ GTTTACA
                      ____________________________________________________________
consensus ATTAGAAATTATCTAAAATTTCCTCATTCCTCACAGAATAATACAGACATACTGTTTACA
 
. : . : . : . : . : . :
JMFF051O13+ TATGACAAGAATCATCATGTATAATCAACCATTATATTCCCCTTCTGAAAACCAGGGAAC
JMFF029N04+ TATGACAAGAATCATCATGTATAATCAACCATTATATTCCCCTTCTGAAAACCAGGGAAC
                      ____________________________________________________________
consensus TATGACAAGAATCATCATGTATAATCAACCATTATATTCCCCTTCTGAAAACCAGGGAAC
 
. : . : . : . : . : . :
JMFF051O13+ ATTTGTTGCTTCAGCAACTAAATGAATAACGAATCCTCCCTCTAATTCATCTTCCATTAT
JMFF029N04+ ATTTGTTGCTTCAGCAACTAAATGAATAACGAATCCTCCCTNTAATTCATCTTCCATTAT
                      ____________________________________________________________
consensus ATTTGTTGCTTCAGCAACTAAATGAATAACGAATCCTCCCTCTAATTCATCTTCCATTAT
 
. : . : . : . : . : . :
JMFF051O13+ CAAAAATTTCCTCATTCCTCATTCCTCATTTGAGAATAGCTAAATAAAAAATTATCAGAT
JMFF029N04+ CAAAAATTTCCTCATTCCTCATTCCTCATTTGAGAATAGCTAAATAAAAAATTATCAGAT
                      ____________________________________________________________
consensus CAAAAATTTCCTCATTCCTCATTCCTCATTTGAGAATAGCTAAATAAAAAATTATCAGAT
 
. : . : . : . : . : . :
JMFF051O13+ TATGCCTAAATTCAATCAAATTAGGATTTAGGGCAAACATAAATCAAATTAGGATTTAGG
JMFF029N04+ TATGCCTAAATTCAATCAAATTAGGATTTAGGGCAAACATAAATCAAATTAGGATTTAGG
                      ____________________________________________________________
consensus TATGCCTAAATTCAATCAAATTAGGATTTAGGGCAAACATAAATCAAATTAGGATTTAGG
 
. : . : . : . : . : . :
JMFF051O13+ GCAAGAATTGAACATTTGAACATAAATTAAACCAGCAAATTAAAGCAAATTAAACAAACA
JMFF029N04+ GCAAGAATTGAACATTTGAACATAAATTAAACCAGCAAATTAAAGCAAATTAAACAAACA
                      ____________________________________________________________
consensus GCAAGAATTGAACATTTGAACATAAATTAAACCAGCAAATTAAAGCAAATTAAACAAACA
 
. : . : . : . : . : . :
JMFF051O13+ AAGGGTGAGAACTGAGAAGGACGGAGAACGGAGACACGGAGTTGAACCTTACCTGGCGGC
JMFF029N04+ AAGGGTGAGAACTGAGAAGGACGGAGAACGGAGACACGGAGTTGAACCTTACCTGGCGGC
                      ____________________________________________________________
consensus AAGGGTGAGAACTGAGAAGGACGGAGAACGGAGACACGGAGTTGAACCTTACCTGGCGGC
 
. : . : . : . : . : . :
JMFF051O13+ TGGCAGTTGCGACTTTGCGAGGCAACGGAGTGGTGGGCGGTGGCGCTGAAGAGGCTGAGG
JMFF029N04+ TGGCAGTTGCGACTTTGCGAGGCAACGGAGTGGTGGGCGGTGGCGCTGAAGAGGCTGAGG
                      ____________________________________________________________
consensus TGGCAGTTGCGACTTTGCGAGGCAACGGAGTGGTGGGCGGTGGCGCTGAAGAGGCTGAGG
 
. : . : . : . : . : . :
JMFF051O13+ GCAGACGGCGACGGGAGGCAGAGAGCGACGAGAAGTCCGGCAGAGACGAGAGGTGAGTGG
JMFF029N04+ GCAGACGGCGACGGGAGGCAGAGAGCGACGAGAAGTCCGGCAGAGACGAGAGGTGAGTGG
                      ____________________________________________________________
consensus GCAGACGGCGACGGGAGGCAGAGAGCGACGAGAAGTCCGGCAGAGACGAGAGGTGAGTGG
 
. : . : . : . : . : . :
JMFF051O13+ CTGAGAGAGACCGCAAACGGAAGAGAAGAGAAGAACGGTGGTGGACTGG
JMFF029N04+ CTGAGAGAGACCGCAAACGGAAGAGAAGAGAAGAACGGTGGTGGACTGGTGGCGTTTCAC
                      ____________________________________________________________
consensus CTGAGAGAGACCGCAAACGGAAGAGAAGAGAAGAACGGTGGTGGACTGGTGGCGTTTCAC