Previous Contig 001363:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF014J12Sequence231001363 (13)sp|O82531|PSB1_PETHY1e-24Proteasome subunit beta type 1 (EC 3.4.25.1) (20S proteasome alpha subunit F) (2782001363 (13)sp|O82531|PSB1_PETHYe-113Proteasome subunit beta type 1 (EC 3.4.25.1) (20S proteasome alpha subunit F) (2
JMFF029M18Sequence504001363 (13)sp|O82531|PSB1_PETHY9e-77Proteasome subunit beta type 1 (EC 3.4.25.1) (20S proteasome alpha subunit F) (2687001363 (13)sp|O82531|PSB1_PETHY1e-92Proteasome subunit beta type 1 (EC 3.4.25.1) (20S proteasome alpha subunit F) (2
JMFF037I10Sequence489001363 (13)sp|O82531|PSB1_PETHY3e-73Proteasome subunit beta type 1 (EC 3.4.25.1) (20S proteasome alpha subunit F) (2
JMFF048O22Sequence363001363 (13)sp|O82531|PSB1_PETHY2e-48Proteasome subunit beta type 1 (EC 3.4.25.1) (20S proteasome alpha subunit F) (2
JMFN005H01Sequence616001363 (13)sp|O82531|PSB1_PETHY3e-97Proteasome subunit beta type 1 (EC 3.4.25.1) (20S proteasome alpha subunit F) (2
JMFN011I21Sequence633001363 (13)sp|O82531|PSB1_PETHYe-101Proteasome subunit beta type 1 (EC 3.4.25.1) (20S proteasome alpha subunit F) (2
JMFN014E15Sequence641001363 (13)sp|O82531|PSB1_PETHYe-103Proteasome subunit beta type 1 (EC 3.4.25.1) (20S proteasome alpha subunit F) (2
JMFN025M24Sequence639001363 (13)sp|O82531|PSB1_PETHYe-106Proteasome subunit beta type 1 (EC 3.4.25.1) (20S proteasome alpha subunit F) (2
JMFN030G07Sequence611001363 (13)sp|O82531|PSB1_PETHYe-109Proteasome subunit beta type 1 (EC 3.4.25.1) (20S proteasome alpha subunit F) (2
JMSF027P05Sequence709001363 (13)sp|O82531|PSB1_PETHYe-112Proteasome subunit beta type 1 (EC 3.4.25.1) (20S proteasome alpha subunit F) (2757001363 (13)sp|O82531|PSB1_PETHYe-119Proteasome subunit beta type 1 (EC 3.4.25.1) (20S proteasome alpha subunit F) (2

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF029M18- GTCTATTACCGTTTTTAGTTGGTAACAAATGCAATTCAAATTACATAATT
rJMFF014J12- ATTACCGTTTTTAGTTGGTAACAAATGCAATTCAAATTACATAATT
                      ____________________________________________________________
consensus GTCTATTACCGTTTTTAGTTGGTAACAAATGCAATTCAAATTACATAATT
 
. : . : . : . : . : . :
rJMFF029M18- CAAAACGGAAATACATAGAGTGCGATTGGAAGGAAGATTCAGTGTCTACAACCAACAAGA
rJMFF014J12- CAAAACGGAAATACATAGAGTGCGATTGGAAGGAAGATTCAGTGTCTACAACCAACAAGA
rJMSF027P05- CATAGAGTGCGATTGGAAGGAAGATTCAGTGTCTACAACCAACAAGA
                      ____________________________________________________________
consensus CAAAACGGAAATACATAGAGTGCGATTGGAAGGAAGATTCAGTGTCTACAACCAACAAGA
 
. : . : . : . : . : . :
rJMFF029M18- ACTAGTAACACAAGGTGGTGGGTGCAGGGTGATCAATCTTTCCTAAGCTCCATTTCTTCA
rJMFF014J12- ACTAGTAACACAAGGTGGTGGGTGCAGGGTGATCAATCTTTCCTAAGCTCCATTTCTTCA
rJMSF027P05- ACTAGTAACACAAGGTGGTGGGTGCAGGGTGATCAATCTTTCCTAAGCTCCATTTCTTCA
                      ____________________________________________________________
consensus ACTAGTAACACAAGGTGGTGGGTGCAGGGTGATCAATCTTTCCTAAGCTCCATTTCTTCA
 
. : . : . : . : . : . :
rJMFF029M18- CGACGGATACCTTCGGAGTTCATTATGACTATCTCCAACCTGTCACCAGTGTATATATCC
rJMFF014J12- CGACGGATACCTTCGGAGTTCATTATGACTATCTCCAACCTGTCACCAGTGTATATATCC
JMFN030G07+ TCATTATGACTATCTCCAACCTGTCACCAGTGTATATATCC
rJMSF027P05- CGACGGATACCTTCGGAGTTCATTATGACTATCTCCAACCTGTCACCAGTGTATATATCC
JMFN025M24+ GTATATATCC
JMSF027P05+ GAGTTCATTATGACTATCTCCAACCTGTCACCAGTGTATATATCC
                      ____________________________________________________________
consensus CGACGGATACCTTCGGAGTTCATTATGACTATCTCCAACCTGTCACCAGTGTATATATCC
 
. : . : . : . : . : . :
rJMFF029M18- CTCTCAGTTGCTGATGCAAAACATGTCTCCACTAAATCGATTGCTTCATTCTCAGAAAGT
rJMFF014J12- CTCTCAGTTGCTGATGCAAAACATGTCTTCACTAAATCGATTGCTTCATTCTCAGAAAGT
JMFN030G07+ CTCTCAGTTGCTGATGCAAAACATGTCTTCACTAAATCGATTGCTTCATTCTCAGAAAGT
rJMSF027P05- CTCTCAGTTGCTGATGCAAAACATGTCTTCACTAAATCGATTGCTTCATTCTCAGAAAGT
JMFN014E15+ CAGTTGCTGATGCAAAACATGTCTTCACTAAATCGATTGCTTCATTCTCAGAAAGT
JMFN025M24+ CTCTCAGTTGCTGATGCAAAACATGTCTTCACTAAATCGATTGCTTCATTCTCAGAAAGT
JMFN011I21+ GATGCAAAACATGTCTTCACTAAATCGATGNCTTCATTCTCAGAAAGT
JMFN005H01+ TAAATCGATTGCTTCATTCTCAGAAAGT
JMSF027P05+ CTCTCAGTTGCTGATGCAAAACATGTCTTCACTAAATCGATTGCTTCATTCTCAGAAAGT
                      ____________________________________________________________
consensus CTCTCAGTTGCTGATGCAAAACATGTCTTCACTAAATCGATTGCTTCATTCTCAGAAAGT
 
. : . : . : . : . : . :
rJMFF029M18- GGAGTAACAGCATCCACGGCAGGTAACAACAGTGGGCTAGGAGACTTCAGCTGGTTATCC
rJMFF014J12- GGAGTAACAGCATCCACGGCAGGTAACAACAGTGGGCTAGGAGACTTCAGCTGGTTATCC
JMFN030G07+ GGAGTAACAGCATCCACGGCAGGTAACAACAGTGGGCTAGGAGACTTCAGCTGGTTATCC
rJMSF027P05- GGAGTAACAGCATCCACGGCAGGTAACAACAGTGGGCTAGGAGACTTCAGCTGGTTATCC
JMFN014E15+ GGAGTAACAGCATCCACGGCAGGTAACAACAGTGGGATAGGAGACTTCAGCTGGTTATCC
JMFN025M24+ GGAGTAACAGCATCCACGGCAGGTAACAACAGTGGGCTAGGAGACTTCAGCTGGTTATCC
JMFN011I21+ GGAGTAACAGCATCCACGGCAGGTAACAACAGTGGGCTAGGAGACTTCAGCTGGTTATCC
JMFN005H01+ GGAGTAACAGCATCCACGGCAGGTAACAACAGTGGGCTAGGAGACTTCAGCTGGTTATCC
JMSF027P05+ GGAGTAACAGCATCCACGGCAGGTAACAACAGTGGGCTAGGAGACTTCAGCTGGTTATCC
                      ____________________________________________________________
consensus GGAGTAACAGCATCCACGGCAGGTAACAACAGTGGGCTAGGAGACTTCAGCTGGTTATCC
 
. : . : . : . : . : . :
rJMFF029M18- AAGAAAGGCGTGATCAACGTAGAACCCGAACCTTGAGAACTGTAACCAACCCTCTCATAT
rJMFF014J12- AAGAAAGGCGTGATCAACGTAGAACCCGAACCTTGAGAACTGTAACCAACCCTCTCATAT
JMFN030G07+ AAGAAAGGCGTGATCAACGTAGAACCCGAACCTTGAGAACTGTAACCAACCCTCTCATAT
rJMSF027P05- AAGAAAGGCGTGATCAACGTAGAACCCGAACCTTGAGAACTGTAACCAACCCTCTCATAT
JMFN014E15+ AAGAAAGGCGTGATCAACGTAGAACCCGAACCTTGAGAACTGTAACCAACCCTCTCATAT
JMFN025M24+ AAGAAAGGCGTGATCAACGTAGAACCCGAACCTTGAGAACTGTAACCAACCCTCTCATAT
JMFN011I21+ AAGAAAGGCGTGATCAACGTAGAACCCGAACCTTGAGAACTGTAACCAACCCTCTCATAT
JMFN005H01+ AAGAAAGGCGTGATCAACGTAGAACCCGAACCTTGAGAACTGTAACCAACCCTCTCATAT
JMSF027P05+ AAGAAAGGCGTGATCAACGTAGAACCCGAACCTTGAGAACTGTAACCAACCCTCTCATAT
JMFF037I10+ TCATAT
JMFF029M18+ GAACTGTAACCAACCCTCTCATAT
                      ____________________________________________________________
consensus AAGAAAGGCGTGATCAACGTAGAACCCGAACCTTGAGAACTGTAACCAACCCTCTCATAT
 
. : . : . : . : . : . :
rJMFF029M18- GATCCAACAGCATCATATGTGAAAACACACCCTTTGCCTTCGCTATCAAGGCCCCCTACA
rJMFF014J12- GATCCAACAGCATCATATGTGAAAACACACCCTTTGCCTTCGCTATCAAGGCCCCCTACA
JMFN030G07+ GATCCAACAGCATCATATGTGAAAACACACCCTTTGCCTTCGCTATCAAGGCCCCCTACA
rJMSF027P05- GATCCAACAGCATCATATGTGAAAACACACCCTTTGCCTTCGCTATCAAGGCCCCCTACA
JMFN014E15+ GATCCAACAGCATCATATGTGAAAACACACCCTTTGCCTTCGCTATCAAGGCCCCCTACA
JMFN025M24+ GATCCAACAGCATCATATGTGAAAACACACCCTTTGCCTTCGCTATCAAGGCCCCCTACA
JMFN011I21+ GATCCAACAGCATCATATGTGAAAACACACCCTTTGCCTTCGCTATCAAGGCCCCCTACA
JMFN005H01+ GATCCAACAGCATCATATGTGAAAACACACCCTTTGCCTTCGCTATCAAGGACCCCTACA
JMSF027P05+ GATCCAACAGCATCATATGTGAAAACACACCCTTTGCCTTCGCTATCAAGGCCCCCTACA
JMFF037I10+ GATCCAACAGCATCATATGTGAAAACACACCCTTTGCCTTCGCTATCAAGGCCCCCTACA
JMFF029M18+ GATCCAACAGCATCATATGTGAAAACACACCCTTTGCCTTCGCTATCAAGGCCCCCTACA
                      ____________________________________________________________
consensus GATCCAACAGCATCATATGTGAAAACACACCCTTTGCCTTCGCTATCAAGGCCCCCTACA
 
. : . : . : . : . : . :
rJMFF029M18- ACATTGAAAGAGTAGTAAGGGAAAAACCGTTTGTAGTACAAGGTGTTTGAAAGTAACTGA
rJMFF014J12- ACATTGAAAGAGTAGTAAGGGAAAAACCGTTTGTAGTACAAGGTGTTTGAAAGTAACTGA
JMFN030G07+ ACATTGAAAGAGTAGTAAGGGAAAAACCGTTTGTAGTACAAGGTGTTTGAAAGTAACTGA
rJMSF027P05- ACATTGAAAGAGTAGTAAGGGAAAAACCGTTTGTAGTACAAGGTGTTTGAAAGTAACTGA
JMFN014E15+ ACATTGAAAGAGTAGTAAGGGAAAAACCGTTTGTAGTACAAGGTGTTTGAAAGTAACTGA
JMFN025M24+ ACATTGAAAGAGTAGTAAGGGAAAAACCGTTTGTAGTACAAGGTGTTTGAAAGTAACTGA
JMFN011I21+ ACATTGAAAGAGTAGTAAGGGAAAAACCGTTTGTAGTACAAGGTGTTTGAAAGTAACTGA
JMFN005H01+ ACATTGAAAGAGTAGTAAGGGAAAAACCGTTTGTAGTACAAGGTGTTTGAAAGTAACTGA
JMSF027P05+ ACATTGAAAGAGTAGTAAGGGAAAAACCGTTTGTAGTACAAGGTGTTTGAAAGTAACTGA
JMFF037I10+ ACATTGAAAGAGTAGTAAGGGAAAAACCGTTTGTAGTACAAGGTGTTTGAAAGTAACTGA
JMFF048O22+ ACTGA
JMFF029M18+ ACATTGAAAGAGTAGTAAGGGAAAAACCGTTTGTAGTACAAGGTGTTTGAAAGTAACTGA
                      ____________________________________________________________
consensus ACATTGAAAGAGTAGTAAGGGAAAAACCGTTTGTAGTACAAGGTGTTTGAAAGTAACTGA
 
. : . : . : . : . : . :
rJMFF029M18- GCCATCCCTGGGCAGCTCATCTGCTTGTTGTGTTGGTGTTGATAGATCAAATGCCTGGCT
rJMFF014J12- GCCATCCCTGGGCAGCTCATCTGCTTGTTGTGTTGGTGTTGATAGATCAAATGCCTGGCT
JMFN030G07+ GCCATCCCTGGGCAGCTCATCTGCTTGTTGTGTTGGTGTTGATAGATCAAATGCCTGGCT
rJMSF027P05- GCCATCCCTGGGCAGCTCATCTGCTTGTTGTGTTGGTGTTGATAGATCAAATGCCTGGCT
JMFN014E15+ GCCATCCCTGGGCAGCTCATCTGCTTGTTGTGTTGGTGTTGATAGATCAAATGCCTGGCT
JMFN025M24+ GCCATCCCTGGGCAGCTCATCTGCTTGTTGTGTTGGTGTTGATAGATCAAATGCCTGGCT
JMFN011I21+ GCCATCCCTGGGCAGCTCATCTGCTTGTTGTGTTGGTGTTGATAGATCAAATGCCTGGCT
JMFN005H01+ GCCATCCCTGGGCAGCTCATCTGCTTGTTGTGTTGGTGTTGATAGATCAAATGCCTGGCT
JMSF027P05+ GCCATCCCTGGGCAGCTCATCTGCTTGTTGTGTTGGTGTTGATAGATCAAATGCCTGGCT
JMFF037I10+ GCCATCCCTGGGCAGCTCATCTGCTTGTTGTGTTGGTGTTGATAGATCAAATGCCTGGCT
JMFF048O22+ GCCATCCCTGGGCAGCTCATCTGCTTGTTGTGTTGGTGTTGATAGATCAAATGCCTGGCT
JMFF029M18+ GCCATCCCTGGGCAGCTCATCTGCTTGTTGTGTTGGTGTTGATAGATCAAATGCCTGGCT
                      ____________________________________________________________
consensus GCCATCCCTGGGCAGCTCATCTGCTTGTTGTGTTGGTGTTGATAGATCAAATGCCTGGCT
 
. : . : . : . : . : . :
rJMFF029M18- GCCAAAAGCTTTTGCAAAGCTCTCACATCAGCCTGAAACCCAGAAGACGCCATCACACAT
rJMFF014J12- GCCAAAAGCTTTTGCAAAGCTCTCACATCAGCCTGAAACCCAGAAGACGCCATCACACAT
JMFN030G07+ GCCAAAAGCTTTTGCAAAGCTCTCACATCAGCCTGAAACCCAGAAGACGCCATCACACAT
rJMSF027P05- GCCAAAAGCTTTTGCAAAGCTCTCACATCAGCCTGAAACCCAGAAGACGCCATCACACAT
JMFN014E15+ GCCAAAAGCTTTTGCAAAGCTCTCACATCAGCCTGAAACCCAGAAGACGCCATCACACAT
JMFN025M24+ GCCAAAAGCTTTTGCAAAGCTCTCACATCAGCCTGAAACCCAGAAGACGCCATCACACAT
JMFN011I21+ GCCAAAAGCTTTTGCAAAGCTCTCACATCAGCCTGAAACCCAGAAGACGCCATCACACAT
JMFN005H01+ GCCAAAAGCTTTTGCAAAGCTCTCACATCAGCCTGAAACCCAGAAGACGCCATCACACAT
JMSF027P05+ GCCAAAAGCTTTTGCAAAGCTCTCACATCAGCCTGAAACCCAGAAGACGCCATCACACAT
JMFF037I10+ GCCAAAAGCTTTTGCAAAGCTCTCACATCAGCCTGAAACCCAGAAGACGCCATCACACAT
JMFF048O22+ GCCAAAAGCTTTTGCAAAGCTCTCACATCAGCCTGAAACCCAGAAGACGCCATCACACAT
JMFF029M18+ GCCAAAAGCTTTTGCAAAGCTCTCACATCAGCCTGAAACCCAGAAGACGCCATCACACAT
                      ____________________________________________________________
consensus GCCAAAAGCTTTTGCAAAGCTCTCACATCAGCCTGAAACCCAGAAGACGCCATCACACAT
 
. : . : . : . : . : . :
rJMFF029M18- TTATCTGCAAGTTTAATGATTTTGGAGTAATCGCGAG
rJMFF014J12- TTATCTGCAAGTTTAATGATTTTGGAGTAATCGCGAGTGAGAATATTGTAGCCCGTGGAC
JMFN030G07+ TTATCTGCAAGTTTAATGATTTTGGAGTAATCGCGAGTGAGAATATTGTAGCCCGTGGAC
rJMSF027P05- TTATCTGCAAGTTTAATGATTTTGGAGTAATCGCGAGTGAGAATATTGTAGCCCGTGGAC
JMFN014E15+ TTATCTGCAAGTTTAATGATTTTGGAGTAATCGCGAGTGAGAATATTGTAGCCCGTGGAC
JMFN025M24+ TTATCTGCAAGTTTAATGATTTTGGAGTAATCGCGAGTGAGAATATTGTAGCCCGTGGAC
JMFN011I21+ TTATCTGCAAGTTTAATGATTTTGGAGTAATCGCGAGTGAGAATATTGTAGCCCGTGGAC
JMFN005H01+ TTATCTGCAAGTTTAATGATTTTGGAGTAATCGCGAGTGAGAATATTGTAGCCCGTGGAC
JMSF027P05+ TTATCTGCAAGTTTAATGATTTTGGAGTAATCGCGAGTGAGAATATTGTAGCCCGTGGAC
JMFF037I10+ TTATCTGCAAGTTTAATGATTTTGGAGTAATCGCGAGTGAGAATATTGTAGCCCGTGGAC
JMFF048O22+ TTATCTGCAAGTTTAATGATTTTGGAGTAATCGCGAGTGAGAATATTGTAGCCCGTGGAC
JMFF014J12+ ATCTGCAAGTTTAATGATTTTGGAGTAATCGCGAGTGAGAATATTGTAGCCCGTGGAC
JMFF029M18+ TTATCTGCAAGTTTAATGATTTTGGAGTAATCGCGAGTGAGAATATTGTAGCCCGTGGAC
                      ____________________________________________________________
consensus TTATCTGCAAGTTTAATGATTTTGGAGTAATCGCGAGTGAGAATATTGTAGCCCGTGGAC
 
. : . : . : . : . : . :
rJMFF014J12- ATCCGAGTATCTGCCGCGATTACGCAGTAATCCGCACCTGCTACCGCCACGCATGTTCCT
JMFN030G07+ ATCCGAGTATCTGCCGCGATTACGCAGTAATCCGCACCTGCTACCGCCACGCATGTTCCT
rJMSF027P05- ATCCGAGTATCTGCCGCGATTACGCAGTAATCCGCACCTGCTACCGCCACGCATGTTCCT
JMFN014E15+ ATCCGAGTATCTGCCGCGATTACGCAGTAATCCGCACCTGCTACCGCCACGCATGTTCCT
JMFN025M24+ ATCCGAGTATCTGCCGCGATTACGCAGTAATCCGCACCTGCTACCGCCACGCATGTTCCT
JMFN011I21+ ATCCGAGTATCTGCCGCGATTACGCAGTAATCCGCACCTGCTACCGCCACGCATGTTCCT
JMFN005H01+ ATCCGAGTATCTGCCGCGATTACGCAGTAATCCGCACCTGCTACCGCCACGCATGTTCCT
JMSF027P05+ ATCCGAGTATCTGCCGCGATTACGCAGTAATCCGCACCTGCTACCGCCACGCATGTTCCT
JMFF037I10+ ATCCGAGTATCTGCCGCGATTACGCAGTAATCCGCACCTGCTACCGCCACGCATGTTCCT
JMFF048O22+ ATCCGAGTATCTGCCGCGATTACGCAGTAATCCGCACCTGCTACCGCCACGCATGTTCCT
JMFF014J12+ ATCCGAGTATCTGCCGCGATTACGCAGTAATCCGCACCTGCTACCGCCACGCATGTTCCT
JMFF029M18+ ATCCGAGTATCTGCCGCGATTACGCAGTAATCCGCACCTGCTACCGCCACGCATGTTCCT
                      ____________________________________________________________
consensus ATCCGAGTATCTGCCGCGATTACGCAGTAATCCGCACCTGCTACCGCCACGCATGTTCCT
 
. : . : . : . : . : . :
rJMFF014J12- CCATTGTTGTCGTAAG
JMFN030G07+ CCATTGTTGTCGTAAGGAGACCAGTTAGCG
rJMSF027P05- CCATTGTTGTCGTAAGGAGACCAGTTAGCGTGCTGCTTCGTCA
JMFN014E15+ CCATTGTTGTCGTAAGGAGACCAGTTAGCGTGCTGCTTCGTCATGGCGATTAGATCGATC
JMFN025M24+ CCATTGTTGCCGTAAGGAGACCAGTTAGCGTGCTGCTTCGTCATGGCGATTAGATCGATC
JMFN011I21+ CCATTGTTGTCGTAAGGAGACCAGTTAGCGTGCTGCTTCGTCATGGCGATTAGATCGATC
JMFN005H01+ CCATTGTTGTCGTAAGGAGACCAGTTAGCGTGCTGCTTCGTCATGGCGATTAGATCGATC
JMSF027P05+ CCATTGTTGTCGTAAGGAGACCAGTTAGCGTGCTGCTTCGTCATGGCGATTAGATCGATC
JMFF037I10+ CCATTGTTGTCGTAAGGAGACCAGTTAGCGTGCTGCTTCGTCATGGCGATTAGATCGATC
JMFF048O22+ CCATTGTTGTCGTAAGGAGACCAGTTAGCGTGCTGCTTCGTCATGGCGATTAGATCGATC
JMFF014J12+ CCATTGTTGTCGTAAGGAGACCAGTTAGCGTGCTGCTTCGTCATGGCGATTAGATCGATC
JMFF029M18+ CCATTGTTGTCGTAAGGAGACCAGTTAGCGTGCTGCTTCGTCATGGCGATTAGATCGATC
                      ____________________________________________________________
consensus CCATTGTTGTCGTAAGGAGACCAGTTAGCGTGCTGCTTCGTCATGGCGATTAGATCGATC
 
. : . : . : . : . : . :
JMFN014E15+ GAGCGAGAGAGAATTTGGGGGCAGAAAGAGACGCAGGAGTTTTCG
JMFN025M24+ GAGCGAGAGAGAATTTGGGGGCAGAAAGA
JMFN011I21+ GAGCGAGAGAGAATTTGGGGGCAGAAAGAGACGCAGGAGTTTTCG
JMFN005H01+ GAGCGAGAGAGAATTTGGGGGCAGAAAGAGACGCAGGAGTTTTC
JMSF027P05+ GAGCGAGAGAGAATTTGGGGGCAGAAAGAGACGCAGGAGTTTTCGTCTTCAG
JMFF037I10+ GAGCGAGAGAGAATTTGGGGGCAGAAAGAGACGCAGGAGTTTTCGTCTTCAG
JMFF048O22+ GAGCGAGAGAGAATTTGGGGGCAGAAAGAGACGCAGGAGTTTTCGTCTTCAG
JMFF014J12+ GAGCGAGAGAGAATTTGGGGGCAGAAAGAGACGCAGGAGTTTTCGTCTTCAGC
JMFF029M18+ GAGCGAGAGAGAATTTGGGGGCAGAAAGAGACGCAGGAGTTTTCGTCTTCAGCAAGTGAG
                      ____________________________________________________________
consensus GAGCGAGAGAGAATTTGGGGGCAGAAAGAGACGCAGGAGTTTTCGTCTTCAGCAAGTGAG