Previous Contig 001358:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF029J01Sequence463001358 (2)pir|T07171|T071715e-29subtilisin-like proteinase (EC 3.4.21.-) 1 - tomato>gb:LES6378_1684621 Lycopersi739009594 (2)pir|T07171|T071712e-81subtilisin-like proteinase (EC 3.4.21.-) 1 - tomato>gb:LES6378_1684621 Lycopersi
JMFF040K13Sequence517001358 (2)pir|T07171|T071718e-36subtilisin-like proteinase (EC 3.4.21.-) 1 - tomato>gb:LES6378_1684621 Lycopersi728009594 (2)pir|T07171|T071714e-80subtilisin-like proteinase (EC 3.4.21.-) 1 - tomato>gb:LES6378_1684621 Lycopersi

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF040K13+ TGAAGAAAGAATGCTTTACTGTCACTCCCATCAAGTC
                      ____________________________________________________________
consensus TGAAGAAAGAATGCTTTACTGTCACTCCCATCAAGTC
 
. : . : . : . : . : . :
JMFF040K13+ CAAGAAATTTCGGTGTCCGTGTAGTATGAAGCTCATACTTCACTTCCTCCTGGACAGAAA
JMFF029J01+ CGTGTAGTATGAAGCTCATACTTCACTTCCTCCTGGACAGAAA
                      ____________________________________________________________
consensus CAAGAAATTTCGGTGTCCGTGTAGTATGAAGCTCATACTTCACTTCCTCCTGGACAGAAA
 
. : . : . : . : . : . :
JMFF040K13+ GAATTCCTGTCTGCTTTTCAAGTGCTTTGGCTTCATCCGCAGTTAGCCGTGCTGAGTAGC
JMFF029J01+ GAATTCCTGTCTGCTTTTCAAGTGCTTTGGCTTCATCCGCAGTTAGCCGTGCTGAGTAGC
                      ____________________________________________________________
consensus GAATTCCTGTCTGCTTTTCAAGTGCTTTGGCTTCATCCGCAGTTAGCCGTGCTGAGTAGC
 
. : . : . : . : . : . :
JMFF040K13+ CATGGATAACGTGGCTGTAGGAGTACAGCATGTCAGTATCTGATACTGACTTTAAGGATG
JMFF029J01+ CATGGATAACGTGGCTGTAGGAGTACAGCATGTCAGTATCTGATACTGACTTTAAGGATG
                      ____________________________________________________________
consensus CATGGATAACGTGGCTGTAGGAGTACAGCATGTCAGTATCTGATACTGACTTTAAGGATG
 
. : . : . : . : . : . :
JMFF040K13+ AGTCATACCACTGGAGATGATCATAAAAGCCAGCTGGCATGTTGGACTTGTCCATGTGAA
JMFF029J01+ AGTCATACCACTGGAGATGATCATAAAAGCCAGCTGGCATGTTGGACTTGTCCATGTGAA
                      ____________________________________________________________
consensus AGTCATACCACTGGAGATGATCATAAAAGCCAGCTGGCATGTTGGACTTGTCCATGTGAA
 
. : . : . : . : . : . :
JMFF040K13+ TGATATAAGTCTTCTTCTGGTTTTGCACTTCTCCATCCACACATGCATGAAGGAATATTA
JMFF029J01+ TGATATAAGTCTTCTTCTGGTTTTGCACTTCTCCATCCACACATGCATGAAGGAATATTA
                      ____________________________________________________________
consensus TGATATAAGTCTTCTTCTGGTTTTGCACTTCTCCATCCACACATGCATGAAGGAATATTA
 
. : . : . : . : . : . :
JMFF040K13+ GAAGCACTAATATTGGAAGAAGCCTAAGCCTCAATCTTTGCATCATCATCTTCCTATGGT
JMFF029J01+ GAAGCACTAATATTGGAAGAAGCCTAAGCCTCAATCTTTGCATCATCATCTTCCTATGGT
                      ____________________________________________________________
consensus GAAGCACTAATATTGGAAGAAGCCTAAGCCTCAATCTTTGCATCATCATCTTCCTATGGT
 
. : . : . : . : . : . :
JMFF040K13+ CTTTGAATCAGAAAAACCAGGGAGGAAACAGATTTTTGTGAGCACTGCTTTTGAGATCCT
JMFF029J01+ CTTTGAATCAGAAAAACCAGGGAGGAAACAGATTTTTGTGAGCACTGCTTTTGAGATCCT
                      ____________________________________________________________
consensus CTTTGAATCAGAAAAACCAGGGAGGAAACAGATTTTTGTGAGCACTGCTTTTGAGATCCT
 
. : . : . : . : . : . :
JMFF040K13+ AAGGAGGACTTTAATGGAAGAATGGACCCATAAAGGAGAAAGTGGCTAATTTGTGAGAAT
JMFF029J01+ AAGGAGGACTTTAATGGAAGAATGGACCCATAAAGGAGAAAGTGGCTAATTTGTGAGAAT
                      ____________________________________________________________
consensus AAGGAGGACTTTAATGGAAGAATGGACCCATAAAGGAGAAAGTGGCTAATTTGTGAGAAT