Previous Contig 001346:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF029E14Sequence119001346 (2)693009582 (3)pir|T03812|T038125e-52hypothetical protein (clone NF22) - common tobacco>gb:NTU66269_1691881 Nicotiana
JMFF030H20Sequence119001346 (2)683009582 (3)pir|T03812|T038125e-52hypothetical protein (clone NF22) - common tobacco>gb:NTU66269_1691881 Nicotiana

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF030H20+ GAACGCCATAGCNNTAGGGANGACCAAAAGCTCTCTCTCTCTCTCTCTCTCTCTCTCTC
JMFF029E14+ GAACGCCATAGCNNTAGGGAGGACCAAAAGCTCTCTCTCTCTCTCTCTCTCTCTCTCTC
                      ____________________________________________________________
consensus GAACGCCATAGCNNTAGGGAGGACCAAAAGCTCTCTCTCTCTCTCTCTCTCTCTCTCTC
 
. : . : . : . : . : . :
JMFF030H20+ TCTCTCTGAACTTCTCTCTCTAGGAAAACGGGGACAGCGGTACACAGCAAACGGAATAGT
JMFF029E14+ TCTCTCTGAACTTCTCTCTCTAGGAAAACGGGGACAGCGGTACACAGCAAACGGAATAGT
                      ____________________________________________________________
consensus TCTCTCTGAACTTCTCTCTCTAGGAAAACGGGGACAGCGGTACACAGCAAACGGAATAGT