Previous Contig 001343:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002H15Sequence511001343 (20)gb:AY086976_15720149e-29Arabidopsis thaliana clone 30065 mRNA, complete sequence.>gb:BT004126_1637226 Ar728001343 (20)gb:AY086976_15720141e-54Arabidopsis thaliana clone 30065 mRNA, complete sequence.>gb:BT004126_1637226 Ar
JMFF011E24Sequence585001343 (20)gb:AY086976_15720142e-41Arabidopsis thaliana clone 30065 mRNA, complete sequence.>gb:BT004126_1637226 Ar734001343 (20)gb:AY086976_15720141e-50Arabidopsis thaliana clone 30065 mRNA, complete sequence.>gb:BT004126_1637226 Ar
JMFF029C20Sequence542001343 (20)gb:AY086976_15720144e-24Arabidopsis thaliana clone 30065 mRNA, complete sequence.>gb:BT004126_1637226 Ar730001343 (20)gb:AY086976_15720141e-54Arabidopsis thaliana clone 30065 mRNA, complete sequence.>gb:BT004126_1637226 Ar
JMFF035H21Sequence577001343 (20)gb:AY086976_15720141e-39Arabidopsis thaliana clone 30065 mRNA, complete sequence.>gb:BT004126_1637226 Ar660001343 (20)gb:AY086976_15720143e-44Arabidopsis thaliana clone 30065 mRNA, complete sequence.>gb:BT004126_1637226 Ar
JMFF042B07Sequence646001343 (20)gb:AY086976_15720143e-50Arabidopsis thaliana clone 30065 mRNA, complete sequence.>gb:BT004126_1637226 Ar616001343 (20)gb:AY086976_15720146e-32Arabidopsis thaliana clone 30065 mRNA, complete sequence.>gb:BT004126_1637226 Ar
JMFF042M05Sequence626001343 (20)gb:AY086976_15720142e-47Arabidopsis thaliana clone 30065 mRNA, complete sequence.>gb:BT004126_1637226 Ar610001343 (20)gb:AY086976_15720145e-36Arabidopsis thaliana clone 30065 mRNA, complete sequence.>gb:BT004126_1637226 Ar
JMFN014J06Sequence631001343 (20)gb:AY086976_15720146e-44Arabidopsis thaliana clone 30065 mRNA, complete sequence.>gb:BT004126_1637226 Ar
JMFN020K10Sequence626001343 (20)gb:AY086976_15720149e-79Arabidopsis thaliana clone 30065 mRNA, complete sequence.>gb:BT004126_1637226 Ar
JMFS053A06Sequence581001343 (20)gb:AY086976_15720143e-44Arabidopsis thaliana clone 30065 mRNA, complete sequence.>gb:BT004126_1637226 Ar
JMSF021G01Sequence694001343 (20)gb:AY086976_15720142e-56Arabidopsis thaliana clone 30065 mRNA, complete sequence.>gb:BT004126_1637226 Ar725001343 (20)gb:AY086976_15720141e-54Arabidopsis thaliana clone 30065 mRNA, complete sequence.>gb:BT004126_1637226 Ar
JMSF023O23Sequence621001343 (20)gb:AY086976_15720142e-39Arabidopsis thaliana clone 30065 mRNA, complete sequence.>gb:BT004126_1637226 Ar734023100gb:AY113893_15783042e-29Arabidopsis thaliana unknown protein (At5g10190) mRNA, complete cds.>gb:AF360162
JMSF024B03Sequence684001343 (20)gb:AY086976_15720141e-55Arabidopsis thaliana clone 30065 mRNA, complete sequence.>gb:BT004126_1637226 Ar771001343 (20)gb:AY086976_15720146e-76Arabidopsis thaliana clone 30065 mRNA, complete sequence.>gb:BT004126_1637226 Ar

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF042B07- AATCCAAGAATATCGAACAAG
                      ____________________________________________________________
consensus AATCCAAGAATATCGAACAAG
 
. : . : . : . : . : . :
rJMFF042B07- TTACCATTGAATTCATTGCAGCAATGATGATATCACTGCCATAGTTTTTTACA-TATATG
rJMFF042M05- ATTCATTGCAGCAATGATGATATCACTGCCATAGTTTTTTACATTATATG
JMSF023O23+ AGCAATGATGATATCACTGCCATAGTTTTTTACATTATATG
rJMFF035H21- AGCAATGATGATATCACTGCCATAGTTTTTTACATTATATG
rJMFF011E24- AGCAATGATGATATCACTGCCATAGTTTTTTACATTATATG
rJMFF002H15- ATGATGATATCACTGCCATAGTTTTTTACATTATATG
rJMSF021G01- GATATCACTGCCATAGTTTTTTACATTATATG
rJMFF029C20- TGATATCACTGCCATAGTTTTTTACATTATATG
                      ____________________________________________________________
consensus TTACCATTGAATTCATTGCAGCAATGATGATATCACTGCCATAGTTTTTTACATTATATG
 
. : . : . : . : . : . :
rJMFF042B07- AGAATGGTCTTAGAAACAGGGTTTCATATATACTGTTGATGATTTTGGTACATTACTGTC
rJMFF042M05- AGAATGGTCTTAGAAACAGGGTTTCATATATACTGTTGATGATTTTGGTACATTACTGTC
JMSF023O23+ AGAATGGTCTTAGAAACAGGGTTTCATATATACTGNTGATGATTTTGGTACATTACTGTC
rJMFF035H21- AGAATGGTCTTAGAAACAGGGTTTCATATATACTGTTGATGATTTTGGTACATTACTGTC
rJMFF011E24- AGAATGGTCTTAGAAACAGGGTTTCATATATACTGTTGATGATTTTGGTACATTACTGTC
rJMFF002H15- AGAATGGTCTTAGAAACAGGGTTTCATATATACTGTTGATGATTTTGGTACATTACTGTC
rJMSF021G01- AGAATGGTCTTAGAAACAGGGTTTCATATATACTGTTGATGATTTTGGTACATTACTGTC
rJMFF029C20- AGAATGGTCTTAGAAACAGGGTTTCATATATACTGTTGATGATTTTGGTACATTACTGTC
rJMSF024B03- CATTACTGTC
                      ____________________________________________________________
consensus AGAATGGTCTTAGAAACAGGGTTTCATATATACTGTTGATGATTTTGGTACATTACTGTC
 
. : . : . : . : . : . :
rJMFF042B07- ACAAAAGCATATTTTGTTTATTGTATGTAATCTTCTCTCAACAGAAATCACTTCTGCTTA
rJMFF042M05- ACAAAAGCATATTTTGTTTATTGTATGTAATCTTCTCTCAACAGAAATCACTTCTGCTTA
JMSF023O23+ ACAAAAGCATATTTTGTTTATTGTATGTAATCTTCTCTCAACAGAAATCACTTCTGCTTA
rJMFF035H21- ACAAAAGCATATTTTGTTTATTGTATGTAATCTTCTCTCAACAGAAATCACTTCTGCTTA
rJMFF011E24- ACAAAAGCATATTTTGTTTATTGTATGTAATCTTCTCTCAACAGAAATCACTTCTGCTTA
rJMFF002H15- ACAAAAGCATATTTTGTTTATTGTATGTAATCTTCTCTCAACAGAAATCACTTCTGCTTA
rJMSF021G01- ACAAAAGCATATTTTGTTTATTGTATGTAATCTTCTCTCAACAGAAATCACTTCTGCTTA
rJMFF029C20- ACAAAAGCATATTTTGTTTATTGTATGTAATCTTCTCTCAACAGAAATCACTTCTGCTTA
rJMSF024B03- ACAAAAGCATATTTTGTTTATTGTATGTAATCTTCTCTCAACAGAAATCACTTCTGCTTA
                      ____________________________________________________________
consensus ACAAAAGCATATTTTGTTTATTGTATGTAATCTTCTCTCAACAGAAATCACTTCTGCTTA
 
. : . : . : . : . : . :
rJMFF042B07- TGTAAATCTATGCACAGCAATTAGCAACTTTCTTGAATGATGTCTCCATCTTAGTACTAA
rJMFF042M05- TGTAAATCTATGCACAGCAATTAGCAACTTTCTTGAATGATGTCTCCATCTTAGTACTAA
JMSF023O23+ TGTAAATCTATGCACAGCAATTAGCAACTTTCTTGAATGATGTCTCCATCTTAGTACTAA
rJMFF035H21- TGTAAATCTATGCACAGCAATTAGCAACTTTCTTGAATGATGTCTCCATCTTAGTACTAA
rJMFF011E24- TGTAAATCTATGCACAGCAATTAGCAACTTTCTTGAATGATGTCTCCATCTTAGTACTAA
rJMFF002H15- TGTAAATCTATGCACAGCAATTAGCAACTTTCTTGAATGATGTCTCCATCTTAGTACTAA
rJMSF021G01- TGTAAATCTATGCACAGCAATTAGCAACTTTCTTGAATGATGTCTCCATCTTAGTACTAA
rJMFF029C20- TGTAAATCTATGCACAGCAATTAGCAACTTTCTTGAATGATGTCTCCATCTTAGTACTAA
rJMSF024B03- TGTAAATCTATGCACAGCAATTAGCAACTTTCTTGAATGATGTCTCCATCTTAGTACTAA
                      ____________________________________________________________
consensus TGTAAATCTATGCACAGCAATTAGCAACTTTCTTGAATGATGTCTCCATCTTAGTACTAA
 
. : . : . : . : . : . :
rJMFF042B07- TGGAAGAACACAAAAGTAACAAGAAAAGCCTGTAGAAGTAGTAGTAGTTTACGCGACTGG
rJMFF042M05- TGGAAGAACACAAAAGTAACAAGAAAAGCCTGTAGAAGTAGTAGTAGTTTACGCGACTGG
JMSF023O23+ TGGAAGAACACAAAAGTAACAAGAAAAGCCTGTAGAAGTAGTAGTAGTTTACGCGACTGG
rJMFF035H21- TGGAAGAACACAAAAGTAACAAGAAAAGCCTGTAGAAGTAGTAGTAGTTTACGCGACTGG
rJMFF011E24- TGGAAGAACACAAAAGTAACAAGAAAAGCCTGTAGAAGTAGTAGTAGTTTACGCGACTGG
rJMFF002H15- TGGAAGAACACAAAAGTAACAAGAAAAGCCTGTAGAAGTAGTAGTAGTTTACGCGACTGG
rJMSF021G01- TGGAAGAACACAAAAGTAACAAGAAAAGCCTGTAGAAGTAGTAGTAGTTTACGCGACTGG
rJMFF029C20- TGGAAGAACACAAAAGTAACAAGAAAAGCCTGTAGAAGTAGTAGTAGTTTACGCGACTGG
rJMSF024B03- TGGAAGAACACAAAAGTAACAAGAAAAGCCTGTAGAAGTAGTAGTAGTTTACGCGACTGG
JMFN020K10+ GCCTGTAGAAGTAGTAGTAGTTTACGCGACTGG
                      ____________________________________________________________
consensus TGGAAGAACACAAAAGTAACAAGAAAAGCCTGTAGAAGTAGTAGTAGTTTACGCGACTGG
 
. : . : . : . : . : . :
rJMFF042B07- CAGCCACAACAATCAACTAGGCTTCATAGCGGTAAGCATGATGAAGCGCCTATTCCTGAT
rJMFF042M05- CAGCCACAACAATCAACTAGGCTTCATAGCGGTAAGCATGATGAAGCGCCTATTCCTGAT
JMSF023O23+ CAGCCACAACAATCAACTAGGCTTCATAGCGGTAAGCATGATGAAGCGCCTATTCCTGAT
rJMFF035H21- CAGCCACAACAATCAACTAGGCTTCATAGCGGTAAGCATGATGAAGCGCCTATTCCTGAT
rJMFF011E24- CAGCCACAACAATCAACTAGGCTTCATAGCGGTAAGCATGATGAAGCGCCTATTCCTGAT
rJMFF002H15- CAGCCACAACAATCAACTAGGCTTCATAGCGGTAAGCATGATGAAGCGCCTATTCCTGAT
rJMSF021G01- CAGCCACAACAATCAACTAGGCTTCATAGCGGTAAGCATGATGAAGCGCCTATTCCTGAT
rJMFF029C20- CAGCCACAACAATCAACTAGGCTTCATAGCGGTAAGCATGATGAAGCGCCTATTCCTGAT
rJMSF024B03- CAGCCACAACAATCAACTAGGCTTCATAGCGGTAAGCATGATGAAGCGCCTATTCCTGAT
JMFN020K10+ CAGCCACAACAATCAACTAGGCTTCATAGCGGTAAGCATGATGAAGCGCCTATTCCTGAT
                      ____________________________________________________________
consensus CAGCCACAACAATCAACTAGGCTTCATAGCGGTAAGCATGATGAAGCGCCTATTCCTGAT
 
. : . : . : . : . : . :
rJMFF042B07- GCACTTGAAACCCACAAGCCCACACGTGGTGCAAAGATCTTCAAGTTCTTTCTCGTCCAA
rJMFF042M05- GCACTTGAAACCCACAAGCCCACACGTGGTGCAAAGATCTTCAAGTTCTTTCTCGTCCAA
JMSF023O23+ GCACTTGAAACCCACAAGCCCACACGTGGTGCAAAGATCTTCAAGTTCTTTCTCGTCCAA
rJMFF035H21- GCACTTGAAACCCACAAGCCCACACGTGGTGCAAAGATCTTCAAGTTCTTTCTCGTCCAA
rJMFF011E24- GCACTTGAAACCCACAAGCCCACACGTGGTGCAAAGATCTTCAAGTTCTTTCTCGTCCAA
rJMFF002H15- GCACTTGAAACCCACAAGCCCACACGTGGTGCAAAGATCTTCAAGTTCTTTCTCGTCCAA
rJMSF021G01- GCACTTGAAACCCACAAGCCCACACGTGGTGCAAAGATCTTCAAGTTCTTTCTCGTCCAA
rJMFF029C20- GCACTTGAAACCCACAAGCCCACACGTGGTGCAAAGATCTTCAAGTTCTTTCTCGTCCAA
rJMSF024B03- GCACTTGAAACCCACAAGCCCACACGTGGTGCAAAGATCTTCAAGTTCTTTCTCGTCCAA
JMFN020K10+ GCACTTGAAACCCACAAGCCCACACGTGGTGCAAAGATCTTCAAGTTCTTTCTCGTCCAA
                      ____________________________________________________________
consensus GCACTTGAAACCCACAAGCCCACACGTGGTGCAAAGATCTTCAAGTTCTTTCTCGTCCAA
 
. : . : . : . : . : . :
rJMFF042B07- GAATATGTGACTGCCCGATATTTGAGCGAAATTTTCGCGTAGTGGTCTTACGAATGGGGT
rJMFF042M05- GAATATGTGACTGCCCGATATTTGAGCGAAATTTTCGCGTAGTGGTCTTACGAATGGGGT
JMSF023O23+ GAATATGTGACTGCCCGATATTTGAGCGAAATTTTCGCGTAGTGGTCTTACGAATGGGGT
rJMFF035H21- GAATATGTGACTGCCCGATATTTGAGCGAAATTTTCGCGTAGTGGTCTTACGAATGGGGT
rJMFF011E24- GAATATGTGACTGCCCGATATTTGAGCGAAATTTTCGCGTAGTGGTCTTACGAATGGGGT
rJMFF002H15- GAATATGTGACTGCCCGATATTTGAGCGAAATTTTCGCGTAGTGGTCTTACGAATGGGGT
rJMSF021G01- GAATATGTGACTGCCCGATATTTGAGCGAAATTTTCGCGTAGTGGTCTTACGAATGGGGT
rJMFF029C20- GAATATGTGACTGCCCGATATTTGAGCGAAATTTTCGCGTAGTGGTCTTACGAATGGGGT
rJMSF024B03- GAATATGTGACTGCCCGATATTTGAGCGAAATTTTCGCGTAGTGGTCTTACGAATGGGGT
JMFN020K10+ GAATATGTGACTGCCCGATATTTGAGCGAAATTTTCGCGTAGTGGTCTTACGAATGGGGT
                      ____________________________________________________________
consensus GAATATGTGACTGCCCGATATTTGAGCGAAATTTTCGCGTAGTGGTCTTACGAATGGGGT
 
. : . : . : . : . : . :
rJMFF042B07- GAATGAATAGATGCCATCAACTATGTAGGTTGTGGCAACAAATACCCCCCCAGGCCGTAA
rJMFF042M05- GAATGAATAGATGCCATCAACTATGTAGGTTGTGGCAACAAATACCCCCCCAGGCCGTAA
JMSF023O23+ GAATGAATAGATGCCATCAACTATGTAGGTTGTGGCAACAAATACCCCCCCAGGCCGTAA
rJMFF035H21- GAATGAATAGATGCCATCAACTATGTAGGTTGTGGCAACAAATACCCCCCCAGGCCGTAA
rJMFF011E24- GAATGAATAGATGCCATCAACTATGTAGGTTGTGGCAACAAATACCCCCCCAGGCCGTAA
rJMFF002H15- GAATGAATAGATGCCATCAACTATGTAGGTTGTGGCAACAAATACCCCCCCAGGCCGTAA
rJMSF021G01- GAATGAATAGATGCCATCAACTATGTAGGTTGTGGCAACAAATACCCCCCCAGGCCGTAA
rJMFF029C20- GAATGAATAGATGCCATCAACTATGTAGGTTGTGGCAACAAATACCCCCCCAGGCCGTAA
rJMSF024B03- GAATGAATAGATGCCATCAACTATGTAGGTTGTGGCAACAAATACCCCCCCAGGCCGTAA
JMFN020K10+ GAATGAATAGATGCCATCAACTATGTAGGTTGTGGCAACAAATACCCCCCCAGGCCGTAA
                      ____________________________________________________________
consensus GAATGAATAGATGCCATCAACTATGTAGGTTGTGGCAACAAATACCCCCCCAGGCCGTAA
 
. : . : . : . : . : . :
rJMFF042B07- TACTCGACTTATCTCAGCAACCGCAGCTGATGGTGAAGGCCAACAATGCAAAGCAG
rJMFF042M05- TACTCGACTTATCTCAGCAACCGCAGCTGATGGTGAAGGCCAACAATGCANAGCAGCACC
JMSF023O23+ TACTCGACTTATCTCAGCAACCGCAGCTGATGGTGAAGGCCAACAATGCAAAGCAGCACC
rJMFF035H21- TACTCGACTTATCTCAGCAACCGCAGCTGATGGTGAAGGCCAACAATGCAAAGCAGCACC
rJMFF011E24- TACTCGACTTATCTCAGCAACCGCAGCTGATGGTGAAGGCCAACAATGCAAAGCAGCACC
rJMFF002H15- TACTCGACTTATCTCAGCAACCGCAGCTGATGGTGAAGGCCAACAATGCAAAGCAGCACC
rJMSF021G01- TACTCGACTTATCTCAGCAACCGCAGCTGATGGTGAAGGCCAACAATGCAAAGCAGCACC
rJMFF029C20- TACTCGACTTATCTCAGCAACCGCAGCTGATGGTGAAGGCCAACAATGCAAAGCAGCACC
rJMSF024B03- TACTCGACTTATCTCAGCAACCGCAGCTGATGGTGAAGGCCAACAATGCAAAGCAGCACC
JMFN020K10+ TACTCGACTTATCTCAGCAACCGCAGCTGATGGTGAAGGCCAACAATGCAAAGCAGCACC
                      ____________________________________________________________
consensus TACTCGACTTATCTCAGCAACCGCAGCTGATGGTGAAGGCCAACAATGCAAAGCAGCACC
 
. : . : . : . : . : . :
rJMFF042M05- AGCATGCACAGCATCCAC
JMSF023O23+ AGCATGCACAGCATCCACGGAGCTTGATGCAAATGGAAG
rJMFF035H21- AGCATGCACAGCATCCACGGAGCTTGATGCAAATGGAAGCCTCGAGATATCAGCTCTAAC
rJMFF011E24- AGCATGCACAGCATCCACGGAGCTTGATGCAAATGGAAGCCTCGAGATATCAGCTCTAAC
rJMFF002H15- AGCATGCACAGCATCCACGGAGCTTGATGCAAATGGAAGCCTCGAGATATCAGCTCTAAC
rJMSF021G01- AGCATGCACAGCATCCACGGAGCTTGATGCAAATGGAAGCCTCGAGATATCAGCTCTAAC
rJMFF029C20- AGCATGCACAGCATCCACGGAGCTTGATGCAAATGGAAGCCTCGAGATATCAGCTCTAAC
rJMSF024B03- AGCATGCACAGCATCCACGGAGCTTGATGCAAATGGAAGCCTCGAGATATCAGCTCTAAC
JMFN020K10+ AGCATGCACAGCATCCACGGAGCTTGATGCAAATGGAAGCCTCGAGATATCAGCTCTAAC
                      ____________________________________________________________
consensus AGCATGCACAGCATCCACGGAGCTTGATGCAAATGGAAGCCTCGAGATATCAGCTCTAAC
 
. : . : . : . : . : . :
rJMFF035H21- CAAGATTATGTTCTCATTA
rJMFF011E24- CAAGATTATGTTCTCATTAGGAAAGNTTTCCTCCTGCTTGATGAATTCATAGCACTGCTG
rJMFF002H15- CAAGATTATGTTCTCATTAGGAAAGTTTTCCTCCTGCTTGATGAATTCATAGCACTGCTG
rJMSF021G01- CAAGATTATGTTCTCATTAGGAAAGTTTTCCTCCTGCTTGATGAATTCATAGCACTGCTG
rJMFF029C20- CAAGATTATGTTCTCATTANGAAAGTTTTCCTCCTGCTTGATGAATTCATAGCACTGCTG
rJMSF024B03- CAAGATTATGTTCTCATTAGGAAAGTTTTCCTCCTGCTTGATGAATTCATAGCACTGCTG
JMFN020K10+ CAAGATTATGTTCTCATTAGGAAAGTTTTCCTCCTGCTTGATGAATTCATAGCACTGCTG
JMSF024B03+ ATTCATAGCACTGCTG
JMSF021G01+ TGCTTGATGAATTCATAGCACTGCTG
                      ____________________________________________________________
consensus CAAGATTATGTTCTCATTAGGAAAGTTTTCCTCCTGCTTGATGAATTCATAGCACTGCTG
 
. : . : . : . : . : . :
rJMFF011E24- CAACATGGGTCTCTGAAAAATCCNAAGCGAC
rJMFF002H15- CAACAT-GGTCTCTGAAAAATCCAAAGCGACA
rJMSF021G01- CAACAT-GGTCTCTGAAAAATCCNAAGCGACAAC
rJMFF029C20- CAACAT-GGTCTCTGAAAAATCCAAAGCGACAACAAGA
rJMSF024B03- CAACAT-GGTCTCTGAAAAATCCAAAGCGACAACAAGAGAAAATAGCCCACTCTTGGCAA
JMFN020K10+ CAACAT-GGTCTCTGAAAAATCCAAAGCGACAACAAGAGAAAATAGCCCACTCTTGGCAA
JMSF024B03+ CAACAT-GGTCTCTGAAAAATCCAAAGCGACANCAAGAGAAAATAGCCCACTCTTGGCAA
JMFF042B07+ TGAAAAATCCAAAACGACAACAAGAGAAAATAGCCCACTCTGNGCAA
JMFF042M05+ AAGAGAAAATAGCCCACTCTTGGCAA
JMFS053A06+ A
JMSF021G01+ CAACAT-GGTCTCTGAAAAATCCAAAGCGACAACAAGAGAAAATAGCCCACTCTTGGCAA
                      ____________________________________________________________
consensus CAACAT-GGTCTCTGAAAAATCCAAAGCGACAACAAGAGAAAATAGCCCACTCTTGGCAA
 
. : . : . : . : . : . :
rJMSF024B03- ACAGTCTTGAAAATAAACCACTTCCACAGCTAGCATCAATGATATTTCCACCCATGACCG
JMFN020K10+ ACAGTCTTGAAAATAAACCACTTCCACAGCTAGCATCAATGATATTTCCACCCATGACCG
JMSF024B03+ ACAGTCTTGAAAATAAACCACTTCCACAGCTAGCATCAATGATATTTCCACCCATGACCG
JMFF042B07+ ACAGTCTTGAAAATAAACCACTTCCACAGCTAGCATCAATGATATTTCCACCCATGACCG
JMFF042M05+ ACAGTCTTGANAATAAACCACTTCCACAGCTAGCATCAATGATATTTCCACCCATGACCG
JMFF035H21+ GCTAGCATCAATGATATTTCCACCCATGACCG
JMFF011E24+ CTTCCACAGCTAGCATCAATGATATTTCCACCCATGACCG
JMFS053A06+ ACAGTCTTGAAAATAAACCACTTCCACAGCTAGCATCAATGATATTTCCACCCATGACCG
JMSF021G01+ ACAGTCTTGAAAATAAACCACTTCCACAGCTAGCATCAATGATATTTCCACCCATGACCG
JMFN014J06+ CAGTCTTGAAAATAACCCACTTCCACAGCTAGCATCAATGATATTTCCACCCATGACCG
                      ____________________________________________________________
consensus ACAGTCTTGAAAATAAACCACTTCCACAGCTAGCATCAATGATATTTCCACCCATGACCG
 
. : . : . : . : . : . :
rJMSF024B03- GTTTAAGATANTCTTGCATCAATTCAAACTCTTTTTCTGGGC
JMFN020K10+ GTTTAAGATAATCTTGCATCAATTCAAACTCTTTTTCTGGGCCAGGAAAACCAC
JMSF024B03+ GTTTAAGATAATCTTGCATCAATTCAAACTCTTTTTCTGGGCCAGGAAAACCACCCCATA
JMFF042B07+ GTNTAAGATAATCTTGCATCAATTCAAACTCTTTTTCTGGGCCAGGAAAACCACCCCATA
JMFF042M05+ GTTTAAGATAATCTTGCATCAATTCAAACTCTTTTTCTGGGCCAGGAAAACCACCCCATA
JMFF035H21+ GTTTAAGATAATCTTGCATCAATTCAAACTCTTTTTCTGGGCCAGGAAAACCACCCCATA
JMFF011E24+ GTTTAAGATAATCTTGCATCAATTCAAACTCTTTTTCTGGGCCAGGAAAACCACCCCATA
JMFS053A06+ GTTTAAGATAATCTTGCATCAATTCAAACTCTTTTTCTGGGCCAGGAAAACCACCCCATA
JMSF021G01+ GTTTAAGATAATCTTGCATCAATTCAAACTCTTTTTCTGGGCCAGGAAAACCACCCCATA
JMFF002H15+ TGGGCCAGGAAAACCACCCCATA
JMFN014J06+ GTNTAAGATAATCTGNCATCAATTCAAACTCTTTTTCTGGGCCAGGAAAACCACCCCATA
                      ____________________________________________________________
consensus GTTTAAGATAATCTTGCATCAATTCAAACTCTTTTTCTGGGCCAGGAAAACCACCCCATA
 
. : . : . : . : . : . :
JMSF024B03+ GAGAAAAGCTTTGTCGCCAACCCCTCTCGTAAAGAAAGGACACCAAAGGAAGCCTGAAAA
JMFF042B07+ GAGAAAAGCTTTGTCGCCAACCCCTCTCGTAAAGAAAGGACACCAAAGGAAGCCTGAAAA
JMFF042M05+ GAGAAAAGCTTTGTCGCCAACCCCTCTCGTAAAGAAAGGACACCAAAGGAAGCCTGAAAA
JMFF035H21+ GAGAAAAGCTTTGTCGCCAACCCCTCTCGTAAAGAAAGGACACCAAAGGAAGCCTGAAAA
JMFF011E24+ GAGAAAAGCTTTGTCGCCAACCCCTCTCGTAAAGAAAGGACACCAAAGGAAGCCTGAAAA
JMFS053A06+ GAGAAAAGCTTGNTCGCCAACCCCTCTCGTAAAGAAAGGACACCAAAGGAAGCCTGAAAA
JMSF021G01+ GAGAAAAGCTTTGTCGCCAACCCCTCTCGTAAAGAAAGGACACCAAAGGAAGCCTGAAAA
JMFF002H15+ GAGAAAAGCTTTGTCGCCAACCCCTCTCGTAAAGAAAGGACACCAAAGGAAGCCTGAAAA
JMFN014J06+ GAGAAAAGCTTTGTCGCCAACCCCTCTCGTAAAGAAAGGACACCAAAGGAAGCCTGAAAA
JMFF029C20+ GAGAAAAGCTTTGTCGCCAACCCCTCTCGTAAAGAAAGGACACCAAAGGAAGCCTGAAAA
                      ____________________________________________________________
consensus GAGAAAAGCTTTGTCGCCAACCCCTCTCGTAAAGAAAGGACACCAAAGGAAGCCTGAAAA
 
. : . : . : . : . : . :
JMSF024B03+ GCTCAGTAGAAGCTGCCAGGGCTTCTCCATAAGCCTTGCCACCACCAGCAATTGTCAAGT
JMFF042B07+ GCTCAGTAGAAGCTGCCAGGGCTTCTCCATAAGCCTTGCCACCACCAGCAATTGTCAAGT
JMFF042M05+ GCTCAGTAGAAGCTGCCAGGGCTTCTCCATAAGCCTTGCCACCACCAGCAATTGTCAAGT
JMFF035H21+ GCTCAGTAGAAGCTGCCAGGGCTTCTCCATAAGCCTTGCCACCACCAGCAATTGTCAAGT
JMFF011E24+ GCTCAGTAGAAGCTGCCAGGGCTTCTCCATAAGCCTTGCCACCACCAGCAATTGTCAAGT
JMFS053A06+ GCTCAGTAGAAGCTGCCAGGGCTTCTCCATAAGCCTTGCCACCACCAGCAATTGTCAAGT
JMSF021G01+ GCTCAGTAGAAGCTGCCAGGGCTTCTCCATAAGCCTTGCCACCACCAGCAATTGTCAAGT
JMFF002H15+ GCTCAGTAGAAGCTGCCAGGGCTTCTCCATAAGCCTTGCCACCACCAGCAATTGTCAAGT
JMFN014J06+ GCTCAGTAGAAGCTGCCAGGGCTTCTCCATAAGCCTTGCCACCACCAGCAATTGTCAAGT
JMFF029C20+ GCTCAGTAGAAGCTGCCAGGGCTTCTCCATAAGCCTTGCCACCACCAGCAATTGTCAAGT
                      ____________________________________________________________
consensus GCTCAGTAGAAGCTGCCAGGGCTTCTCCATAAGCCTTGCCACCACCAGCAATTGTCAAGT
 
. : . : . : . : . : . :
JMSF024B03+ CAACATGTGTCTCGTTGCCAGAGTACTTCTTCCGGCAGGTGCTGCATTCTAAGTTAGACT
JMFF042B07+ CAACATGTGTCTCGTTGCCAGAGTACTTCTTCCGGCAGGTGCTGCATTCTAAGTTAGACT
JMFF042M05+ CAACATGTGTCTCGTTGCCAGAGTACTTCTTCCGGCAGGTGCTGCATTCTAAGTTAGACT
JMFF035H21+ CAACATGTGTCTCGTTGCCAGAGTACTTCTTCCGGCAGGTGCTGCATTCTAAGTTAGACT
JMFF011E24+ CAACATGTGTCTCGTTGCCAGAGTACTTCTTCCGGCAGGTGCTGCATTCTAAGTTAGACT
JMFS053A06+ CAACATGTGTCTCGTTGCCAGAGTACTTCTTCCGGCAGGTGCTGCATTCTAAGTTAGACT
JMSF021G01+ CAACATGTGTCTCGTTGCCAGAGTACTTCTTCCGGCAGGTGCTGCATTCTAAGTTAGACT
JMFF002H15+ CAACATGTGTCTCGTTGCCAGAGTACTTCTTCCGGCAGGTGCTGCATTCTAAGTTAGACT
JMFN014J06+ CAACATGTGTCTCGTTGCCAGAGTACTTCTTCCGGCAGGTGCTGCATTCTAAGTTAGACT
JMFF029C20+ CAACATGTGTCTCGTTGCCAGAGTACTTCTTCCGGCAGGTGCTGCATTCTAAGTTAGACT
                      ____________________________________________________________
consensus CAACATGTGTCTCGTTGCCAGAGTACTTCTTCCGGCAGGTGCTGCATTCTAAGTTAGACT
 
. : . : . : . : . : . :
JMSF024B03+ GAGCCATAGAACTCAAGGATAACCCCGGATCACCATTCCAAGTAAAGGCATCGTAGCAAA
JMFF042B07+ GAGCCATAGAACTCAAGGATAACCCCGGATCACCATTCCAAGTAAAGGCATCGTAGCAAA
JMFF042M05+ GAGCCATAGAACTCAAGGATAACCCCGGATCACCATTCCAAGTAAAGGCATCGTAGCAAA
JMFF035H21+ GAGCCATAGAACTCAAGGATAACCCCGGATTACCATTCCAAGTAAAGGCATCGTAGCAAA
JMFF011E24+ GAGCCATAGAACTCAAGGATAACCCCGGATTACCATTCCAAGTAAAGGCATCGTAGCAAA
JMFS053A06+ GAGCCATAGAACTCAAGGATAACCCCGGATCACCATTCCAAGTAAAGGCATCGTAGCAAA
JMSF021G01+ GAGCCATAGAACTCAAGGATAACCCCGGATCACCATTCCAAGTAAAGGCATCGTAGCAAA
JMFF002H15+ GAGCCATAGAACTCAAGGATAACCCCGGATCACCATTCCAAGTAAAGGCATCGTAGCAAA
JMFN014J06+ GAGCCATAGAACTCAAGGATAACCCCGGATCACCATTCCAAGTAAAGGCATCGTAGCAAA
JMFF029C20+ GAGCCATAGAACTCAAGGATAACCCCGGATCACCATTCCAAGTAAAGGCATCGTAGCAAA
                      ____________________________________________________________
consensus GAGCCATAGAACTCAAGGATAACCCCGGATCACCATTCCAAGTAAAGGCATCGTAGCAAA
 
. : . : . : . : . : . :
JMSF024B03+ TGGGACATGCTAAAAGGTTTGTCCGTATTTCCACCTTCTTTTCATCTATAAGACGAACAG
JMFF042B07+ TGGGACATGCTAAAAGGTTTGTCCGTATTTCCACCTTCTTTTCATCTATAAGACGAACAG
JMFF042M05+ TGGGACATGCTAAAAGGTTTGTCCGTATTTCCACCTTCTTTTCATCTATAAGACGAACAG
JMFF035H21+ TGGGACATGCTAAAAGGTTTGTCCGTATTTCCACCTTCTTTTCATCTATAAGACGAACAG
JMFF011E24+ TGGGACATGCTAAAAGGTTTGTCCGTATTTCCACCTTCTTTTCATCTATAAGACGAACAG
JMFS053A06+ TGGGACATGCTAAAAGGTTTGTCCGTATTTCCACCTTCTTTTCATCTATAAGACGAACAG
JMSF021G01+ TGGGACATGCTAAAAGGTTTGTCCGTATTTCCACCTTCTTTTCATCTATAAGACGAACAG
JMFF002H15+ TGGGACATGCTAAAAGGTTTGTCCGTATTTCCACCTTCTTTTCATCTATAAGACGAACAG
JMFN014J06+ TGGGACATGCTAAAAGGTTTGTCCGTATTTCCACCTTCTTTTCATCTATAAGACGAACAG
JMFF029C20+ TGGGACATGCTAAAAGGTTTGTCCGTATTTCCACCTTCTTTTCATCTATAAGACGAACAG
                      ____________________________________________________________
consensus TGGGACATGCTAAAAGGTTTGTCCGTATTTCCACCTTCTTTTCATCTATAAGACGAACAG
 
. : . : . : . : . : . :
JMSF024B03+ GCTTGTCTTCGACGAAGGTAGTTGATAAGGCGCGAATTTTAACCGCGAAAAGTCGATTGG
JMFF042B07+ GCTTGTCTTCGACGAAGGTAGTTGATAAGGCGCGAATTTTAACCGCGAAAAGTCGATTGG
JMFF042M05+ GCTTGTCTTCGACGAAGGTAGTTGATAAGGCGCGAATTTTAACCGCGAAAAGTCGATTGG
JMFF035H21+ GCTTGTCTTCGACGAAGGTAGTTGATAAGGCGCGAATTTTAACCGCGAAAAGTCGATTGG
JMFF011E24+ GCTTGTCTTCGACGAAGGTAGTTGATAAGGCGCGAATTTTAACCGCGAAAAGTCGATTGG
JMFS053A06+ GCTTGTCTTCGACGAAGGTAGTTGATAAGGCGCGAATTTTAACCGCGAAAAGTCGATTGG
JMSF021G01+ GCTTGTCTTCGACGAAGGTAGTTGATAAGGCGCGAATTTTAACCGCGAAAAGTCGATTGG
JMFF002H15+ GCTTGTCTTCGACGAAGGTAGTTGATAAGGCGCGAATTTTAACCGCGAAAAGTCGATTGG
JMFN014J06+ GCTTGTCTTCGACGAAGGTAGTTGATAAGGCGCGAATTTTAACCGCGAAAAGTCGATTGG
JMFF029C20+ GCTTGTCTTCGACGAAGGTAGTTGATAAGGCGCGAATCTTAACCGCGAAAAGTCGATTGG
                      ____________________________________________________________
consensus GCTTGTCTTCGACGAAGGTAGTTGATAAGGCGCGAATTTTAACCGCGAAAAGTCGATTGG
 
. : . : . : . : . : . :
JMSF024B03+ CTTTGGGAGTGAGCGGAGAGAAGCTGAATTTCGAGTTGTAACCAAGTTTTCTCGTTACCA
JMFF042B07+ CTTTGGGAGTGAGCGGAGAGAAGCTGAATTTCGAGTTGTAACCAAGTTTTCTCGTTACCA
JMFF042M05+ CTTTGGGAGTGAGCGGAGAGAAGCTGAATTTCGAGTTGTAACCAAGTTTTCTCGTTACCA
JMFF035H21+ CTTTGGGAGTGAGCGGAGAGAAGCTGAATTTCGAGTTGTAACCAAGTTTTCTCGTTACCA
JMFF011E24+ CTTTGGGAGTGAGCGGAGAGAAGCTGAATTTCGAGTTGTAACCAAGTTTTCTCGTTACCA
JMFS053A06+ CTTTGGGAGTGAGCGGAGAGAAGCTGAATTTCGAGTTGTAACCAAGTTTTCTCGTTACCA
JMSF021G01+ CTTTGGGAGTGAGCGGAGAGAAGCTGAATTTCGAGTTGTAACCAAGTTTTCTCGTTACCA
JMFF002H15+ CTTTGGGAGTGAGCGGAGAGAAGCTGAATTTCGAGTTGTAACCAAGTTTTCTCGTTACCA
JMFN014J06+ CTTTGGGAGTGAGCGGAGAGAAGCTGAATTTCGAGTTGTAACCAAGTTTTCTCGTTACCA
JMFF029C20+ CTTTGGGAGTGAGCGGAGAGAAGCTGAATTTCGAGTTGTAACCAAGTTTTCTCGTTACCA
                      ____________________________________________________________
consensus CTTTGGGAGTGAGCGGAGAGAAGCTGAATTTCGAGTTGTAACCAAGTTTTCTCGTTACCA
 
. : . : . : . : . : . :
JMSF024B03+ GCACAGCGGATACGTAGCCCAAACCGGCCGTCGCCATTGTCGTTAGCTCTCCCGGAGCAA
JMFF042B07+ GCACAGCGGATACGTAGCCCAAACCGGCCGTCGCCATTGTCGTTAGCTCTCCCGGAGC
JMFF042M05+ GCACAGCGGATACGTAGCCCAAACCGGCCGTCGCCATTGTCGTTAGCTCTCCCGGAGCAA
JMFF035H21+ GCACAGCGGATACGTAGCCCAAA-CGGCCGTCGCCATTGTCGTTAGCTCTCCCGGAGCAA
JMFF011E24+ GCACAGCGGATACGTAGCCCAAA-CGGCCGTCGCCATTGTCGTTAGCTCTCCCGGAGCAA
JMFS053A06+ GCACAGCGGATACGTAGCCCAAACCGGCCGTCGCCATTGT
JMSF021G01+ GCACAGCGGATACGTAGCCCAAACCGGCCGTCGCCATTGTCGTTAGCTCTCCCGGAGCAA
JMFF002H15+ GCACAGCGGATACGTAGCCCAAACCGGCCGTCGCCATTGTCGTTAGCTCTCCCGGAGCAA
JMFN014J06+ GCACAGCGGATACGTAGCCCAAACCGGCCGTCGCCATTGTCGTTAGCTCTCCCGGAGCAA
JMFF029C20+ GCACAGCGGATACGTAGCCCAAACCGGCCGTCGCCATTGTCGTTAGCTCTCCCGGAGCAA
                      ____________________________________________________________
consensus GCACAGCGGATACGTAGCCCAAACCGGCCGTCGCCATTGTCGTTAGCTCTCCCGGAGCAA
 
. : . : . : . : . : . :
JMSF024B03+ AGCTTCAC
JMFF035H21+ AGCTTC
JMFF011E24+ AGCTTC
JMSF021G01+ AGCTTCAC
JMFF002H15+ AGCTTCAC
JMFN014J06+ AGCTTCACGGTT-GATTCAGTTTTCGATGGG
JMFF029C20+ AGCTTCACGGTTCGATTCAGTTTTCGATGGGGGGAATATATACGCGGACGCGTTTGAGCT
                      ____________________________________________________________
consensus AGCTTCACGGTTCGATTCAGTTTTCGATGGGGGGAATATATACGCGGACGCGTTTGAGCT