Previous Contig 001341:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF029B24Sequence545001341 (14)sp|O49884|RL30_LUPLU3e-5260S ribosomal protein L30.>gb:LLAJ3316_1685067 Lupinus luteus mRNA for ribosomal629001341 (14)sp|O49884|RL30_LUPLU4e-5260S ribosomal protein L30.>gb:LLAJ3316_1685067 Lupinus luteus mRNA for ribosomal
JMFF032O19Sequence496001341 (14)sp|O49884|RL30_LUPLU1e-4660S ribosomal protein L30.>gb:LLAJ3316_1685067 Lupinus luteus mRNA for ribosomal599001341 (14)sp|O49884|RL30_LUPLU2e-4660S ribosomal protein L30.>gb:LLAJ3316_1685067 Lupinus luteus mRNA for ribosomal
JMFN017D23Sequence556001341 (14)sp|O49884|RL30_LUPLU3e-5260S ribosomal protein L30.>gb:LLAJ3316_1685067 Lupinus luteus mRNA for ribosomal
JMFN042I20Sequence614001341 (14)sp|O49884|RL30_LUPLU4e-5260S ribosomal protein L30.>gb:LLAJ3316_1685067 Lupinus luteus mRNA for ribosomal
JMSF002K09Sequence455001341 (14)sp|O49884|RL30_LUPLU2e-5260S ribosomal protein L30.>gb:LLAJ3316_1685067 Lupinus luteus mRNA for ribosomal582001341 (14)sp|O49884|RL30_LUPLU4e-5260S ribosomal protein L30.>gb:LLAJ3316_1685067 Lupinus luteus mRNA for ribosomal
JMSF003J13Sequence407001341 (14)sp|O49884|RL30_LUPLU2e-5260S ribosomal protein L30.>gb:LLAJ3316_1685067 Lupinus luteus mRNA for ribosomal582001341 (14)sp|O49884|RL30_LUPLU4e-5260S ribosomal protein L30.>gb:LLAJ3316_1685067 Lupinus luteus mRNA for ribosomal
JMSF023J05Sequence650001341 (14)sp|O49884|RL30_LUPLU5e-5260S ribosomal protein L30.>gb:LLAJ3316_1685067 Lupinus luteus mRNA for ribosomal608001341 (14)sp|O49884|RL30_LUPLU4e-5260S ribosomal protein L30.>gb:LLAJ3316_1685067 Lupinus luteus mRNA for ribosomal
JMSF023K05Sequence650001341 (14)sp|O49884|RL30_LUPLU5e-5260S ribosomal protein L30.>gb:LLAJ3316_1685067 Lupinus luteus mRNA for ribosomal598001341 (14)sp|O49884|RL30_LUPLU4e-5260S ribosomal protein L30.>gb:LLAJ3316_1685067 Lupinus luteus mRNA for ribosomal

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN042I20+ AAACAAGAAAAACCAACTTCATT
rJMFF029B24- TTGTGGAAACAAGAAAAACCAACTTCATT
                      ____________________________________________________________
consensus TTGTGGAAACAAGAAAAACCAACTTCATT
 
. : . : . : . : . : . :
JMFN042I20+ ACATCATAGACAAAAACAAAATTCATAGATGAGACAAATCCAAAACCTACTAGGCATTCG
rJMSF023J05- CATCATAGACAAAAACAAAATTCATAGATGAGACAAATCCAAAACCTACTAGGCATTCG
rJMSF023K05- ATCATAGACAAAAACAAAATTCATAGATGAGACAAATCCAAAACCTACTAGGCATTCG
rJMFF032O19- TCATAGACAAAAACAAAATTCATAGATGAGACAAATCCAAAACCTACTAGGCATTCG
rJMSF002K09- AAATTCATAGATGAGACAAATCCAAAACCTACTAGGCATTCG
rJMSF003J13- AAATTCATAGATGAGACAAATCCAAAACCTACTAGGCATTCG
JMFN017D23+ TCATAGATGAGACAAATCCAAAACCTACTAGGCATTCG
rJMFF029B24- ACATCATAGACAAAAACAAAATTCATAGATGAGACAAATCCAAAACCTACTAGGCATTCG
JMFF029B24+ ATTCG
                      ____________________________________________________________
consensus ACATCATAGACAAAAACAAAATTCATAGATGAGACAAATCCAAAACCTACTAGGCATTCG
 
. : . : . : . : . : . :
JMFN042I20+ CATAAAATGGTTTGTATAAACTACACAGTACACACTAACATTGTAGAACAAAAATTAGAA
rJMSF023J05- CATAAAATGGTTTGTATAAACTACACAGTACACACTAACATTGTAGAACAAAAATTAGAA
rJMSF023K05- CATAAAATGGTTTGTATAAACTACACAGTACACACTAACATTGTAGAACAAAAATTAGAA
rJMFF032O19- CATAAAATGGTTTGTATAAACTACACAGTACACACTAACATTGTAGAACAAAAATTAGAA
rJMSF002K09- CATAAAATGGTTTGTATAAACTACACAGTACACACTAACATTGTAGAACAAAAATTAGAA
rJMSF003J13- CATAAAATGGTTTGTATAAACTACACAGTACACACTAACATTGTAGAACAAAAATTAGAA
JMFN017D23+ CATAAAATGGTTTGTATAAACTACACAGTACACACTAACATTGTAGAACAAAAATTAGAA
JMFF032O19+ AACAAAAATTAGAA
rJMFF029B24- CATAAAATGGTTTGTATAAACTACACAGTACACACTAACATTGTAGAACAAAAATTAGAA
JMFF029B24+ CATAAAATGGTTTGTATAAACTACACAGTACACACTAACATTGTAGAACAAAAATTAGAA
                      ____________________________________________________________
consensus CATAAAATGGTTTGTATAAACTACACAGTACACACTAACATTGTAGAACAAAAATTAGAA
 
. : . : . : . : . : . :
JMFN042I20+ TGACAATCTCAGTTTCTGGCGAAATTAAGAAATATCACATTAAGAGAACGGCAACCGCCC
rJMSF023J05- TGACAATCTCAGTTTCTGGCGAAATTAAGAAATATCACATTAAGAGAACGGCAACCGCCC
rJMSF023K05- TGACAATCTCAGTTTCTGGCGAAATTAAGAAATATCACATTAAGAGAACGGCAACCGCCC
rJMFF032O19- TGACAATCTCAGTTTCTGGCGAAATTAAGAAATATCACATTAAGAGAACGGCAACCGCCC
rJMSF002K09- TGACAATCTCAGTTTCTGGCGAAATTAAGAAATATCACATTAAGAGAACGGCAACCGCCC
rJMSF003J13- TGACAATCTCAGTTTCTGGCGAAATTAAGAAATATCACATTAAGAGAACGGCAACCGCCC
JMFN017D23+ TGACAATCTCAGTTTCTGGCGAAATTAAGAAATATCACATTAAGAGAACGGCAACCGCCC
JMFF032O19+ TGACAATCTCAGTTTCTGGCGAAATTAAGAAATATCACATTAAGAGAACGGCAACCGCCC
rJMFF029B24- TGACAATCTCAGTTTCTGGCGAAATTAAGAAATATCACATTAAGAGAACGGCAACCGCCC
JMSF002K09+ TAAGAAATATCACATTAAGAGAACGGCAACCGCCC
JMFF029B24+ TGACAATCTCAGTTTCTGGCGAAATTAAGAAATATCACATTAAGAGAACGGCAACCGCCC
                      ____________________________________________________________
consensus TGACAATCTCAGTTTCTGGCGAAATTAAGAAATATCACATTAAGAGAACGGCAACCGCCC
 
. : . : . : . : . : . :
JMFN042I20+ ATTGACTGCTATCTTACTGCTCGCTCGGCAAGCTCTTGATAATGTCAGAGTCCCCAGGGT
rJMSF023J05- ATTGACTGCTATCTTACTGCTCGCTCGGCAAGCTCTTGATAATGTCAGAGTCCCCAGGGT
rJMSF023K05- ATTGACTGCTATCTTACTGCTCGCTCGGCAAGCTCTTGATAATGTCAGAGTCCCCAGGGT
rJMFF032O19- ATTGACTGCTATCTTACTGCTCGCTCGGCAAGCTCTTGATAATGTCAGAGTCCCCAGGGT
rJMSF002K09- ATTGACTGCTATCTTACTGCTCGCTCGGCAAGCTCTTGATAATGTCAGAGTCCCCAGGGT
rJMSF003J13- ATTGACTGCTATCTTACTGCTCGCTCGGCAAGCTCTTGATAATGTCAGAGTCCCCAGGGT
JMFN017D23+ ATTGACTGCTATCTTACTGCTCGCTCGGCAAGCTCTTGATAATGTCAGAGTCCCCAGGGT
JMFF032O19+ ATTGACTGCTATCTTACTGCTCGCTCGGCAAGCTCTTGATAATGTCAGAGTCCCCAGGGT
rJMFF029B24- ATTGACTGCTATCTTACTGCTCGCTCGGCAAGCTCTTGATAATGTCAGAGTCCCCAGGGT
JMSF002K09+ ATTGACTGCTATCTTACTGCTCGCTCGGCAAGCTCTTGATAATGTCAGAGTCCCCAGGGT
JMSF023J05+ TCTTACTGCTCGCTCGGCAAGCTCTTGATAATGTCAGAGTCCCCAGGGT
JMSF023K05+ TCTTACTGCTCGCTCGGCAAGCTCTTGATAATGTCAGAGTCCCCAGGGT
JMSF003J13+ TTACTGCTCGCTCGGCAAGCTCTTGATAATGTCAGAGTCCCCAGGGT
JMFF029B24+ ATTGACTGCTATCTTACTGCTCGCTCGGCAAGCTCTTGATAATGTCAGAGTCCCCAGGGT
                      ____________________________________________________________
consensus ATTGACTGCTATCTTACTGCTCGCTCGGCAAGCTCTTGATAATGTCAGAGTCCCCAGGGT
 
. : . : . : . : . : . :
JMFN042I20+ CAATAATGCTGAGGCAACAGACTCTGAAGTATTTACCGCATGCAGTTCCCAAATCAACAT
rJMSF023J05- CAATAATGCTGAGGCAACAGACTCTGAAGTATTTACCGCATGCAGTTCCCAAATCAACAT
rJMSF023K05- CAATAATGCTGAGGCAACAGACTCTGAAGTATTTACCGCATGCAGTTCCCAAATCAACAT
rJMFF032O19- CAATAATGCTGAGGCAACAGACTCTGAAGTATTTACCGCATGCAGTTCCCAAATCAACAT
rJMSF002K09- CAATAATGCTGAGGCAACAGACTCTGAAGTATTTACCGCATGCAGTTCCCAAATCAACAT
rJMSF003J13- CAATAATGCTGAGGCAACAGACTCTGAAGTATTTACCGCATGCAGTTCCCAAATCAACAT
JMFN017D23+ CAATAATGCTGAGGCAACAGACTCTGAAGTATTTACCGCATGCAGTTCCCAAATCAACAT
JMFF032O19+ CAATAATGCTGAGGCAACAGACTCTGAAGTATTTACCGCATGCAGTTCCCAAATCAACAT
rJMFF029B24- CAATAATGCTGAGGCAACAGACTCTGAAGTATTTACCGCATGCAGTTCCCAAATCAACAT
JMSF002K09+ CAATAATGCTGAGGCAACAGACTCTGAAGTATTTACCGCATGCAGTTCCCAAATCAACAT
JMSF023J05+ CAATAATGCTGAGGCAACAGACTCTGAAGTATTTACCGCATGCAGTTCCCAAATCAACAT
JMSF023K05+ CAATAATGCTGAGGCAACAGACTCTGAAGTATTTACCGCATGCAGTTCCCAAATCAACAT
JMSF003J13+ CAATAATGCTGAGGCAACAGACTCTGAAGTATTTACCGCATGCAGTTCCCAAATCAACAT
JMFF029B24+ CAATAATGCTGAGGCAACAGACTCTGAAGTATTTACCGCATGCAGTTCCCAAATCAACAT
                      ____________________________________________________________
consensus CAATAATGCTGAGGCAACAGACTCTGAAGTATTTACCGCATGCAGTTCCCAAATCAACAT
 
. : . : . : . : . : . :
JMFN042I20+ TGTTTCCGTTGTAGTGGTGAACGCCAACCTTCGCCAACATGGCATAGTACTCTATCTCAG
rJMSF023J05- TGTTTCCGTTGTAGTGGTGAACGCCAACCTTCGCCAACATGGCATAGTACTCTATCTCAG
rJMSF023K05- TGTTTCCGTTGTAGTGGTGAACGCCAACCTTCGCCAACATGGCATAGTACTCTATCTCAG
rJMFF032O19- TGTTTCCGTTGTAGTGGTGAACGCCAACCTTCGCCAACATGGCATAGTA--CTATCTCAG
rJMSF002K09- TGTTTCCGTTGTAGTGGTGAACGCCAACCTTCGCCAACATGGCATAGTACTCTATCTCAG
rJMSF003J13- TGTTTCCGTTGTAGTGGTGAACGCCAACCTTCGCCAACATGGCATAGTACTCTATCTCAG
JMFN017D23+ TGTTTCCGTTGTAGTGGTGAACGCCAACCTTCGCCAACATGGCATAGTACTCTATCTCAG
JMFF032O19+ TGTTTCCGTTGTAGTGGTGAACGCCAACCTTCGCCAACATGGCATAGTA--CTATCTCAG
rJMFF029B24- TGTTTCCGTTGTAGTGGTGAACGCCAACCTTCGCCAACATGGCATAGTACTCTATCTCAG
JMSF002K09+ TGTTTCCGTTGTAGTGGTGAACGCCAACCTTCGCCAACATGGCATAGTACTCTATCTCAG
JMSF023J05+ TGTTTCCGTTGTAGTGGTGAACGCCAACCTTCGCCAACATGGCATAGTACTCTATCTCAG
JMSF023K05+ TGTTTCCGTTGTAGTGGTGAACGCCAACCTTCGCCAACATGGCATAGTACTCTATCTCAG
JMSF003J13+ TGTTTCCGTTGTAGTGGTGAACGCCAACCTTCGCCAACATGGCATAGTACTCTATCTCAG
JMFF029B24+ TGTTTCCGTTGTAGTGGTGAACGCCAACCTTCGCCAACATGGCATAGTACTCTATCTCAG
                      ____________________________________________________________
consensus TGTTTCCGTTGTAGTGGTGAACGCCAACCTTCGCCAACATGGCATAGTACTCTATCTCAG
 
. : . : . : . : . : . :
JMFN042I20+ ACTTCCTAAGAGGAGGGCAGTTGTTGGAAATTATAATTAATTTCCCTTTCGAGCTTCTGA
rJMSF023J05- ACTTCCTAAGAGGAGGGCAGTTGTTGGAAATTATAATTAATTTCCCTTTCGAGCTTCTGA
rJMSF023K05- ACTTCCTAAGAGGAGGGCAGTTGTTGGAAATTATAATTAATTTCCCTTTCGAGCTTCTGA
rJMFF032O19- ACTTCCTAAGAGGAGGGCAGTTGTTGGAAATTATAATTAATTTCCCTTTCGAGCTTCTGA
rJMSF002K09- ACTTCCTAAGAGGAGGGCAGTTGTTGGAAATTATAATTAATTTCCCTTTCGAGCTTCTGA
rJMSF003J13- ACTTCCTAAGAGGAGGGCAGTTGTTGGAAATTATAATTAATTTCCCTTTCGAGCTTCTGA
JMFN017D23+ ACTTCCTAAGAGGAGGGCAGTTGTTGGAAATTATAATTAATTTCCCTTTCGAGCTTCTGA
JMFF032O19+ ACTTCCTAAGAGGAGGGCAGTTGTTGGAAATTATAATTAATTTCCCTTTCGAGCTTCTGA
rJMFF029B24- ACTTCCTAAGAGGAGGGCAGTTGTTGGAAATTATAATTAATTTCCCTTTCGAGCTTCTGA
JMSF002K09+ ACTTCCTAAGAGGAGGGCAGTTGTTGGAAATTATAATTAATTTCCCTTTCGAGCTTCTGA
JMSF023J05+ ACTTCCTAAGAGGAGGGCAGTTGTTGGAAATTATAATTAATTTCCCTTTCGAGCTTCTGA
JMSF023K05+ ACTTCCTAAGAGGAGGGCAGTTGTTGGAAATTATAATTAATTTCCCTTTCGAGCTTCTGA
JMSF003J13+ ACTTCCTAAGAGGAGGGCAGTTGTTGGAAATTATAATTAATTTCCCTTTCGAGCTTCTGA
JMFF029B24+ ACTTCCTAAGAGGAGGGCAGTTGTTGGAAATTATAATTAATTTCCCTTTCGAGCTTCTGA
                      ____________________________________________________________
consensus ACTTCCTAAGAGGAGGGCAGTTGTTGGAAATTATAATTAATTTCCCTTTCGAGCTTCTGA
 
. : . : . : . : . : . :
JMFN042I20+ GGGACTTGAGGACGGTCTTGTATCCCAAAGTGTACTTCCCACTCTTCATGACCAGAGCCA
rJMSF023J05- GGGACTTGAGGACGGTCTTGTATCCCAAAGTGTACTTCCCACTCTTCATGACCAGAGCCA
rJMSF023K05- GGGACTTGAGGACGGTCTTGTATCCCAAAGTGTACTTCCCACTCTTCATGACCAGAGCCA
rJMFF032O19- GGGACTTGAGGACGGTCTTGTATCCCAAAGTGTACTTCCCACTCTTCATGACCAGAGCCA
rJMSF002K09- GGGACTTGAGGACGGTCTTGTATCCCAAAGTGTACTTCCCACTCTTCATGACCAGAGCCA
rJMSF003J13- GGGACTTGAGGACGGTCTTGTATCCCAAAGTGTACTTCCCACTCTTCATGACCAGAGCCA
JMFN017D23+ GGGACTTGAGGACGGTCTTGTATCCCAAAGTGTACTTCCCACTCTTCATGACCAGAGCCA
JMFF032O19+ GGGACTTGAGGACGGTCTTGTATCCCAAAGTGTACTTCCCACTCTTCATGACCAGAGCCA
rJMFF029B24- GGGACTTGAGGACGGTCTTGTATCCCAAAGTGTACTTCCCACTCTTCATGACCAGAGCCA
JMSF002K09+ GGGACTTGAGGACGGTCTTGTATCCCAAAGTGTACTTCCCACTCTTCATGACCAGAGCCA
JMSF023J05+ GGGACTTGAGGACGGTCTTGTATCCCAAAGTGTACTTCCCACTCTTCATGACCAGAGCCA
JMSF023K05+ GGGACTTGAGGACGGTCTTGTATCCCAAAGTGTACTTCCCACTCTTCATGACCAGAGCCA
JMSF003J13+ GGGACTTGAGGACGGTCTTGTATCCCAAAGTGTACTTCCCACTCTTCATGACCAGAGCCA
JMFF029B24+ GGGACTTGAGGACGGTCTTGTATCCCAAAGTGTACTTCCCACTCTTCATGACCAGAGCCA
                      ____________________________________________________________
consensus GGGACTTGAGGACGGTCTTGTATCCCAAAGTGTACTTCCCACTCTTCATGACCAGAGCCA
 
. : . : . : . : . : . :
JMFN042I20+ GCCTATTGTTAATGCTCTCATGAGTCTTCTTGGTCTTCTTGGCGGCAACCATGGCTGTGC
rJMSF023J05- GCCTATTGTTAATGCTCTCATGAGTCTTCTTGGTCTTCTTGGCGGCAACCATGGCTGTGC
rJMSF023K05- GCCTATTGTTAATGCTCTCATGAGTCTTCTTGGTCTTCTTGGCGGCAACCATGGCTGTGC
rJMFF032O19- GCCTATTGTTAATGCTCTCATGAGTCTTCTTGGTCTTCTTGGCGGCAACCATGGCTGTGC
rJMSF002K09- GCCTATTGTTAATGCTCTCATGAGTCTTCTTGGTCTTCTTGGCGGCAACCATGGCTGTGC
rJMSF003J13- GCCTATTGTTAATGCTCTCATGAGTCTTCTTGGTCTTCTTGGCGGCAACCATGGCTGTGC
JMFN017D23+ GCCTATTGTTAATGCTCTCATGAGTCTTCTTGGTCTTCTTGGCGGCAACCATGGCTGTGC
JMFF032O19+ GCCTATTGTTAATGCTCTCATGAGTCTTCTTGGTCTTCTTGGCGGCAACCATGGCTGTGC
rJMFF029B24- GCCTATTGTTAATGCTCTCATGAGTCTTCTTGGTCTTCTTGGCGGCAACCATGGCTGTGC
JMSF002K09+ GCCTATTGTTAATGCTCTCATGAGTCTTCTTGGTCTTCTTGGCGGCAACCATGGCTGTGC
JMSF023J05+ GCCTATTGTTAATGCTCTCATGAGTCTTCTTGGTCTTCTTGGCGGCAACCATGGCTGTGC
JMSF023K05+ GCCTATTGTTAATGCTCTCATGAGTCTTCTTGGTCTTCTTGGCGGCAACCATGGCTGTGC
JMSF003J13+ GCCTATTGTTAATGCTCTCATGAGTCTTCTTGGTCTTCTTGGCGGCAACCATGGCTGTGC
JMFF029B24+ GCCTATTGTTAATGCTCTCATGAGTCTTCTTGGTCTTCTTGGCGGCAACCATGGCTGTGC
                      ____________________________________________________________
consensus GCCTATTGTTAATGCTCTCATGAGTCTTCTTGGTCTTCTTGGCGGCAACCATGGCTGTGC
 
. : . : . : . : . : . :
JMFN042I20+ TTTAGCTCGGAGGGCCGGAGTCAGATGCGATTCGAAGCGGAAGCGTCTAA
rJMSF023J05- TTTAGCTCGGAGGGCCGGAGTCAGATGCGATTCGAAGCGGAAGCGTCTAAGGCAGCGGCC
rJMSF023K05- TTTAGCTCGGAGGGCCGGAGTCAGATGCGATTCGAAGCGGAAGCGTCTAAGGCAGCGGCC
rJMFF032O19- TTTAGCTCGGAGGGCCGGAGTCAGATGCGATTCGAAGCGGAAGCGTCTAAGGCAGCGGC
rJMSF002K09- TTTAGCTCGGAGGGCCGGAGTCAGATGCGATTCGAAGCGGAAGCGTCTAAGGCAGCGGCC
rJMSF003J13- TTTAGCTCGGAGGGCCGGAGTCAGATGCGATTCGAAGCGGAAGCGTCTAAGGCAGCGGCC
JMFN017D23+ TTTAGCTCGGAGGGCCGGAGTCAGATGCGATTCGAAGC
JMFF032O19+ TTTAGCTCGGAGGGCCGGAGTCAGATGCGATTCGAAGCGGAAGCGTCTAAGGCAGCGGC
rJMFF029B24- TTTAGCTCGGAGGGCCGGAGTCAGATGCGATTCGAAGCGGAAGCGTCTAAGGCAGCGGCC
JMSF002K09+ TTTAGCTCGGAGGGCCGGAGTCAGATGCGATTCGAAGCGGAAGCGTCTAAGGCAGCGGCC
JMSF023J05+ TTTAGCTCGGAGGGCCGGAGTCAGATGCGATTCGAAGCGGAAGCGTCTAAGGCAGCGGCC
JMSF023K05+ TTTAGCTCGGAGGGCCGGAGTCAGATGCGATTCGAAGCGGAAGCGTCTAAGGCAGCGGCC
JMSF003J13+ TTTAGCTCGGAGGGCCGGAGTCAGATGCGATTCGAAGCGGAAGCGTCTAAGGCAGCGGCC
JMFF029B24+ TTTAGCTCGGAGGGCCGGAGTCAGATGCGATTCGAAGCGGAAGCGTCTAAGGCAGCGGCC
                      ____________________________________________________________
consensus TTTAGCTCGGAGGGCCGGAGTCAGATGCGATTCGAAGCGGAAGCGTCTAAGGCAGCGGCC