Previous Contig 001340:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF029A16Sequence418001340 (3)gb:AP005291_18499736e-04Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ12494001340 (3)pir|T04557|T045570.005hypothetical protein T12H17.10 - Arabidopsis thaliana>gb:ATCHRIV57_1546099 Arabi
JMFN031G15Sequence558001340 (3)pir|T04557|T045572e-12hypothetical protein T12H17.10 - Arabidopsis thaliana>gb:ATCHRIV57_1546099 Arabi

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF029A16- GAGGAGGTTTACATTTTCGGGGGTG
                      ____________________________________________________________
consensus GAGGAGGTTTACATTTTCGGGGGTG
 
. : . : . : . : . : . :
rJMFF029A16- AAGATGTTTAAGAAAATATCTCTGGGANAGATTTTTTCTTTTATTTTCTTTTTGGGCTCG
                      ____________________________________________________________
consensus AAGATGTTTAAGAAAATATCTCTGGGANAGATTTTTTCTTTTATTTTCTTTTTGGGCTCG
 
. : . : . : . : . : . :
rJMFF029A16- NTGCATTTGGTTTGGCTGGNAAAGTTTTGTACAAGAAAATCTTCCACTCNCATGAAGAAA
                      ____________________________________________________________
consensus NTGCATTTGGTTTGGCTGGNAAAGTTTTGTACAAGAAAATCTTCCACTCNCATGAAGAAA
 
. : . : . : . : . : . :
rJMFF029A16- ATAAACAAGAGAAAACCGACCGGAGAGGCAGNAACTTCTTACTACCNAACNANTCCTANA
                      ____________________________________________________________
consensus ATAAACAAGAGAAAACCGACCGGAGAGGCAGNAACTTCTTACTACCNAACNANTCCTANA
 
. : . : . : . : . : . :
rJMFF029A16- ATANTCCTACGAAATTATGAANACCGTCGNCGATCCACTTCACCATTTGATTCTGTGTCT
                      ____________________________________________________________
consensus ATANTCCTACGAAATTATGAANACCGTCGNCGATCCACTTCACCATTTGATTCTGTGTCT
 
. : . : . : . : . : . :
rJMFF029A16- CCAGCTCCGCCGCCGGAAATTGCAGCCGNCACCACCGCCCGTGGCGGCNATTCTGGACTG
                      ____________________________________________________________
consensus CCAGCTCCGCCGCCGGAAATTGCAGCCGNCACCACCGCCCGTGGCGGCNATTCTGGACTG
 
. : . : . : . : . : . :
rJMFF029A16- CACATTCTCAAACTCGNATATCCGGCAAGGAATCTGNATCCCGNTGGGGTGATTGAACCC
                      ____________________________________________________________
consensus CACATTCTCAAACTCGNATATCCGGCAAGGAATCTGNATCCCGNTGGGGTGATTGAACCC
 
. : . : . : . : . : . :
rJMFF029A16- GTACACCGTCTCCGCCTCCCCAACANNTCCNCNAACAGCGGGTGGTTAAAGNAGATGACG
JMFN031G15+ AACAGCGGGTGGTTAAAGTAGATGACG
                      ____________________________________________________________
consensus GTACACCGTCTCCGCCTCCCCAACANNTCCNCNAACAGCGGGTGGTTAAAGTAGATGACG
 
. : . : . : . : . : . :
rJMFF029A16- GGCACCACCNCTCTACGCGCCGCCGCCGCGCCGTCCTNCTTCTCCCCGA
JMFN031G15+ GGCACCACCACTTTACGCGCCGCCGCCGCGCCGTCCTCCTTCTCCCCGACGTACACCGCC
                      ____________________________________________________________
consensus GGCACCACCACTTTACGCGCCGCCGCCGCGCCGTCCTCCTTCTCCCCGACGTACACCGCC
 
. : . : . : . : . : . :
JMFN031G15+ AGGTGCCCCTTCGGTACACCCACGCCTCTCTTCGCCTCCGCCGCTTCTTGCCCGATCCGA
                      ____________________________________________________________
consensus AGGTGCCCCTTCGGTACACCCACGCCTCTCTTCGCCTCCGCCGCTTCTTGCCCGATCCGA
 
. : . : . : . : . : . :
JMFN031G15+ ACATAACCCGGACACGCCGTTTCAACAAACCCCCCAAGCTCCGCCGCAGCTTAGAAAGCG
JMFF029A16+ ATAACCCGGACACGCCGTTTCTACAAACCCCCCAAGCTCCGCCGCAGCTTAGAAAGCG
                      ____________________________________________________________
consensus ACATAACCCGGACACGCCGTTTCTACAAACCCCCCAAGCTCCGCCGCAGCTTAGAAAGCG
 
. : . : . : . : . : . :
JMFN031G15+ CTCCTCCGTCTACGGCGGAGCTGCGCGGTTCCAGCAGCCGGTAGGAGCCCCCCGGCTTCG
JMFF029A16+ CTCCTCCGTCTACGGCGGAGCTGCGCGGTTCCAGCAGCCGGTAGGAGCCCCCCGGCTTCG
                      ____________________________________________________________
consensus CTCCTCCGTCTACGGCGGAGCTGCGCGGTTCCAGCAGCCGGTAGGAGCCCCCCGGCTTCG
 
. : . : . : . : . : . :
JMFN031G15+ CCCTCCGGTGAATGACCCACGTGAAAATCCCGACCAGCTTCCGCCCAATCCTGAAACCTC
JMFF029A16+ CCCTCCGGTGAATGACCCACGTGAAAATCCCGACCAGCTTCCGCCCAATCCTGAAACCTC
                      ____________________________________________________________
consensus CCCTCCGGTGAATGACCCACGTGAAAATCCCGACCAGCTTCCGCCCAATCCTGAAACCTC
 
. : . : . : . : . : . :
JMFN031G15+ TAGCTCTTCTCATATTAATTCACACAGATCAGAAGAAGTAGAAGAAGAAAGCTTTGACAA
JMFF029A16+ TAGCTCTTCTCATATTAATTCACACAGATCAGAAGAAGTAGAAGAAGAAAGCTTTGACAA
                      ____________________________________________________________
consensus TAGCTCTTCTCATATTAATTCACACAGATCAGAAGAAGTAGAAGAAGAAAGCTTTGACAA
 
. : . : . : . : . : . :
JMFN031G15+ CAATGGCGGACACTCTCGGATCTCTCAGTATTTATAACAACAATTGTATGAATGGTCTTA
JMFF029A16+ CAATGGCGGACACTCTCGGATCTCTCAGTATTTATAACAACAATTGTATGAATGGTCTTA
                      ____________________________________________________________
consensus CAATGGCGGACACTCTCGGATCTCTCAGTATTTATAACAACAATTGTATGAATGGTCTTA
 
. : . : . : . : . : . :
JMFN031G15+ TGTAGATTGTTGATGTCTGTTGGATTTTGCAAGGGAAAGATTCTTGGAATAGGAATGTGG
JMFF029A16+ TGTAGATTGTTGATGTCTGTTGGATTTTGCAAGGGAAAGATTCTTGGAATAGGAATGTGG
                      ____________________________________________________________
consensus TGTAGATTGTTGATGTCTGTTGGATTTTGCAAGGGAAAGATTCTTGGAATAGGAATGTGG
 
. : . : . : . : . : . :
JMFN031G15+ TGTGGTTGAAAGCTTTTAGAACTTAGAA
JMFF029A16+ TGTGGTTGAAAGCTTTTAGAACTTAGAAGAGTCCAAACATGGTGGAATTGAAGATGGAAT
                      ____________________________________________________________
consensus TGTGGTTGAAAGCTTTTAGAACTTAGAAGAGTCCAAACATGGTGGAATTGAAGATGGAAT