Previous Contig 001329:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF028M20Sequence525001329 (2)pir|F71431|F714311e-05hypothetical protein - Arabidopsis thaliana>gb:ATCHRIV44_1545450 Arabidopsis tha493001329 (2)pir|F71431|F714311e-05hypothetical protein - Arabidopsis thaliana>gb:ATCHRIV44_1545450 Arabidopsis tha

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF028M20+ GGATGTTATGTGCTTTAATATAATTCAATTGCACTGGATCATATA
JMFF028M20- GGATGTTATGTGCTTTAATATAATTCAATTGCACTGGATCATATA
                      ____________________________________________________________
consensus GGATGTTATGTGCTTTAATATAATTCAATTGCACTGGATCATATA
 
. : . : . : . : . : . :
rJMFF028M20+ TATATGTAAAAGGTGTTATTTCTGGAGCTCTGCTGTATATCAAGGAAGATTTCAAAGCTG
JMFF028M20- TATATGTAAAAGGTGTTATTTCTGGAGCTCTGCTGTATATCAAGGAAGATTTCAAAGCTG
                      ____________________________________________________________
consensus TATATGTAAAAGGTGTTATTTCTGGAGCTCTGCTGTATATCAAGGAAGATTTCAAAGCTG
 
. : . : . : . : . : . :
rJMFF028M20+ TTCAGGACTAAACATGGCTTCAGGCACTCGAATGGGATAGTAACGTAACGATTCAGTCCA
JMFF028M20- TTCAGGACTAAACATGGCTTCAGGCACTCGAATGGGATAGTAACGTAACGATTCAGTCCA
                      ____________________________________________________________
consensus TTCAGGACTAAACATGGCTTCAGGCACTCGAATGGGATAGTAACGTAACGATTCAGTCCA
 
. : . : . : . : . : . :
rJMFF028M20+ AAGTTTTGAATCATTAAAACCAACGACCGGCCCTCTAAATACTAAATACTACAAGTAGCT
JMFF028M20- AAGTTTTGAATCATTAAAACCAACGACCGGCCCTCTAAATACTAAATACTACAAGTAGCT
                      ____________________________________________________________
consensus AAGTTTTGAATCATTAAAACCAACGACCGGCCCTCTAAATACTAAATACTACAAGTAGCT
 
. : . : . : . : . : . :
rJMFF028M20+ TAGTTTCCAGTTTCCTCAGCATATCTTACATCATATGATAAATTATCAACCATGGAGGGA
JMFF028M20- TAGTTTCCAGTTTCCTCAGCATATCTTACATCATATGATAAATTATCAACCATGGAGGGA
                      ____________________________________________________________
consensus TAGTTTCCAGTTTCCTCAGCATATCTTACATCATATGATAAATTATCAACCATGGAGGGA
 
. : . : . : . : . : . :
rJMFF028M20+ GGTTGTGAAGAAGCTGGCCATGGTGCAGACAAAACAAAATTCACAGAATGTTGGCAGACA
JMFF028M20- GGTTGTGAAGAAGCTGGCCATGGTGCAGACAAAACAAAATTCACAGAATGTTGGCAGACA
                      ____________________________________________________________
consensus GGTTGTGAAGAAGCTGGCCATGGTGCAGACAAAACAAAATTCACAGAATGTTGGCAGACA
 
. : . : . : . : . : . :
rJMFF028M20+ ACTCGTAAAACACCTTACATCATACGCCTTGCCATCTCTGCTGCCATGCGCCTTACGCGT
JMFF028M20- ACTCGTAAAACACCTTACATCATACGCCTTGCCATCTCTGCTGCCATGCGCCTTACGCGT
                      ____________________________________________________________
consensus ACTCGTAAAACACCTTACATCATACGCCTTGCCATCTCTGCTGCCATGCGCCTTACGCGT
 
. : . : . : . : . : . :
rJMFF028M20+ GCGTTGCACGAAATAGATTTGTTATAATCTTTAAGAATATTTTGATCAATATACAAATAT
JMFF028M20- GCGTTGCACGAAATAGATTTGTTATAATCTTTAAGAATATTTTGATCAATATACAAATAT
                      ____________________________________________________________
consensus GCGTTGCACGAAATAGATTTGTTATAATCTTTAAGAATATTTTGATCAATATACAAATAT
 
. : . : . : . : . : . :
rJMFF028M20+ AAATTATAACAATGAATATTATATAGTG
JMFF028M20- AAATTATAACAATGAATATTATATAGTGCAATGGATGAAATGATTTGTATAAAAAAAAAA
                      ____________________________________________________________
consensus AAATTATAACAATGAATATTATATAGTGCAATGGATGAAATGATTTGTATAAAAAAAAAA