Previous Contig 001328:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF028M01Sequence505001328 (10)gb:BT003850_16369781e-39Arabidopsis thaliana clone RAFL15-48-D07 (R20842) putative VAMP protein SEC22 (A553001328 (10)gb:BT003850_16369784e-48Arabidopsis thaliana clone RAFL15-48-D07 (R20842) putative VAMP protein SEC22 (A
JMFF032D15Sequence560001328 (10)gb:BT003850_16369783e-46Arabidopsis thaliana clone RAFL15-48-D07 (R20842) putative VAMP protein SEC22 (A671001328 (10)gb:BT003850_16369789e-54Arabidopsis thaliana clone RAFL15-48-D07 (R20842) putative VAMP protein SEC22 (A
JMFF044O21Sequence635014990gb:AY225438_15908965e-05Capsicum annuum dehydrin-like protein (Dhn) mRNA, complete cds.589001328 (10)gb:BT003850_16369781e-41Arabidopsis thaliana clone RAFL15-48-D07 (R20842) putative VAMP protein SEC22 (A
JMFN005K05Sequence627001328 (10)gb:BT003850_16369783e-56Arabidopsis thaliana clone RAFL15-48-D07 (R20842) putative VAMP protein SEC22 (A
JMFN006J14Sequence625001328 (10)gb:BT003850_16369783e-58Arabidopsis thaliana clone RAFL15-48-D07 (R20842) putative VAMP protein SEC22 (A
JMFN013D09Sequence618001328 (10)gb:BT003850_16369786e-51Arabidopsis thaliana clone RAFL15-48-D07 (R20842) putative VAMP protein SEC22 (A
JMFN029F19Sequence648001328 (10)gb:BT003850_16369788e-60Arabidopsis thaliana clone RAFL15-48-D07 (R20842) putative VAMP protein SEC22 (A
JMFS014C05Sequence619001328 (10)gb:BT003850_16369787e-45Arabidopsis thaliana clone RAFL15-48-D07 (R20842) putative VAMP protein SEC22 (A

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF032D15- AT
                      ____________________________________________________________
consensus AT
 
. : . : . : . : . : . :
JMFN013D09+ CATTTGAAGTGTCAAACTATAATTATTCGGAA
rJMFF044O21- GTAGTAATATGTAGTATTATTATTACACATTTGAAGTGTCAAACTATAATTATTCGGAA
rJMFF032D15- TGTAGTAATATGTAGTATTATTATTACACATTTGAAGTGTCAAACTATAATTATTCGGAA
                      ____________________________________________________________
consensus TGTAGTAATATGTAGTATTATTATTACACATTTGAAGTGTCAAACTATAATTATTCGGAA
 
. : . : . : . : . : . :
rJMFF028M01- ATCCTTGATTGAAAATTTTGTATCCATCCAGTCCTTCCCTTGAGCAAAATTTACA
JMFN013D09+ ATACAATCCTTGATTGAAAATTTTGTATCCATCCAGTCCTTCCCTTGAGCAAAATTTACA
rJMFF044O21- ATACAATCCTTGATTGAAAATTTTGTATCCATCCAGTCCTTCCCTTGAGCAAAATTTACA
rJMFF032D15- ATACAATCCTTGATTGAAAATTTTGTATCCATCCAGTCCTTCCCTTGAGCAAAATTTACA
                      ____________________________________________________________
consensus ATACAATCCTTGATTGAAAATTTTGTATCCATCCAGTCCTTCCCTTGAGCAAAATTTACA
 
. : . : . : . : . : . :
rJMFF028M01- AAGTAAAATTCAGCGAAAGGACAAAATGGGAAAGAAGATACTTAACGGCGGCTGACGTAC
JMFN013D09+ AAGTAAAATTCAGCGAAAGGACAAAATGGGAAAGAAGATACTTAACGGCGGCTGACGTAC
rJMFF044O21- AAGTAAAATTCAGCGAAAGGACAAAATGGGAAAGAAGATACTTAACGGCGGCTGACGTAC
rJMFF032D15- AAGTAAAATTCAGCGAAAGGACAAAATGGGAAAGAAGATACTTAACGGCGGCTGACGTAC
                      ____________________________________________________________
consensus AAGTAAAATTCAGCGAAAGGACAAAATGGGAAAGAAGATACTTAACGGCGGCTGACGTAC
 
. : . : . : . : . : . :
rJMFF028M01- GTTATTACTAGACACTGACGTCACAGCTGCGGGAGAGCTGATACTTAACGGCGTTTCCGA
JMFN013D09+ GTTATTACTAGACACTGACGTCACAGCTGCGGGAGAGCTGATACTTAACGGCGTTTCCGA
rJMFF044O21- GTTATTACTAGACACTGACGTCACAGCTGCGGGAGAGCTGATACTTAACGGCGTTTCCGA
rJMFF032D15- GTTATTACTAGACACTGACGTCACAGCTGCGGGAGAGCTGATACTTAACGGCGTTTCCGA
JMFN029F19+ AACGGCGTTTCCGA
                      ____________________________________________________________
consensus GTTATTACTAGACACTGACGTCACAGCTGCGGGAGAGCTGATACTTAACGGCGTTTCCGA
 
. : . : . : . : . : . :
rJMFF028M01- CGACGATTCCGCCGTTCTTAGGGACGTTACCGAAGGGTATGTAAGCGGGGCAGGTGACGT
JMFN013D09+ CGACGATTCCGCCGTTCTTAGGGACGTTACCGAAGGGTATGTAAGCGGGGCAGGTGACGT
rJMFF044O21- CGACGATTCCGCCGTTCTTAGGGACGTTACCGAAGGGTATGTAAGCGGGGCAGGTGACGT
rJMFF032D15- CGACGATTCCGCCTTTCTTAGGGACGTTACCGAAGGGTATGTAAGCGGGGCAGGTGACGT
JMFN029F19+ CGACGATTCCGCCGTTCTTAGGGACGTTACCGAAGGGTATGTAAGCGGGGCAGGTGACGT
JMFN006J14+ AGGGACGTTACCGAAGGGTATGTAAGCGGGGCAGGTGACGT
JMFN005K05+ CCGAAGGGTATGTAAGCGGGGCAGGTGACGT
                      ____________________________________________________________
consensus CGACGATTCCGCCGTTCTTAGGGACGTTACCGAAGGGTATGTAAGCGGGGCAGGTGACGT
 
. : . : . : . : . : . :
rJMFF028M01- GGAGGTGGTAACGGCCGGAGGTGAAGGAGCCGACTCTCCACTTGACGCGGCCGTTAAGTT
JMFN013D09+ GGAGGTGGTAACGGCCGGAGGTGAAGGAGCCGACTCTCCACTTGACGCGGCCGTTAAGTT
rJMFF044O21- GGAGGTGGTAACGGCCGGAGGTGAAGGAGCCGACTCTCCACTTGACGCGGCCGTTAAGTT
rJMFF032D15- GGAGGTGGTAACGGCCGGAGGTGAAGGAGCCGACTCTCCACTTGACGCGGCCGTTAAGTT
JMFN029F19+ GGAGGTGGTAACGGCCGGAGGTGAAGGAGCCGACTCTCCACTTGACGCGGCCGTTAAGTT
JMFN006J14+ GGAGGTGGTAACGGCCGGAGGTGAAGGAGCCGACTCTCCACTTGACGCGGCCGTTAAGTT
JMFN005K05+ GGAGGTGGTAACGGCCGGAGGTGAAGGAGCCGACTCTCCACTTGACGCGGCCGTTAAGTT
JMFS014C05+ CTTGACGCGGCCGTTAAGTT
JMFF032D15+ CCACTTGACGCGGCCGTTAAGTT
                      ____________________________________________________________
consensus GGAGGTGGTAACGGCCGGAGGTGAAGGAGCCGACTCTCCACTTGACGCGGCCGTTAAGTT
 
. : . : . : . : . : . :
rJMFF028M01- TGACGGTGATCCAAACGGCGCCGGCGTCCTGGTCCTGGCGGAGGTCGGGGCCGTTGAACG
JMFN013D09+ TGACGGTGATCCAAACGGCGCCGGCGTCCTGGTCCTGGCGGAGGTCGGGGCCGTTGAACG
rJMFF044O21- TGACGGTGATCCAAACGGCGCCGGCGTCCTGGTCCTGGCGGAGGTCGGGGCCGTTGAACG
rJMFF032D15- TGACGGTGATCCAAACGGCGCCGGCGTCCTGGTCCTGGCGGAGGTCGGGGCCGTTGAACG
JMFN029F19+ TGACGGTGATCCAAACGGCGCCGGCGTCCTGGTCCTGGCGGAGGTCGGGGCCGTTGAACG
JMFN006J14+ TGACGGTGATCCAAACGGCGCCGGCGTCCTGGTCCTGGCGGAGGTCGGGGCCGTTGAACG
JMFN005K05+ TGACGGTGATCCAAACGGCGCCGGCGTCCTGGTCCTGGCGGAGGTCGGGGCCGTTGAACG
JMFS014C05+ TGACGGTGATCCAAACGGCGCCGGCGTCCTGGTCCTGGCGGAGGTCGGGGCCGTTGAACG
JMFF032D15+ TGACGGTGATCCAAACGGCGCCGGCGTCCTGGTCCTGGCGGAGGTCGGGGCCGTTGAACG
JMFF028M01+ CTGGCGGAGGTCGGGGCCGTTGAACG
                      ____________________________________________________________
consensus TGACGGTGATCCAAACGGCGCCGGCGTCCTGGTCCTGGCGGAGGTCGGGGCCGTTGAACG
 
. : . : . : . : . : . :
rJMFF028M01- GCGCAATGGGGACGTTGTTGCCGTAGATGAAGGGGGACCAGAGGTTGGTGTCCTTGTGGC
JMFN013D09+ GCGCAATGGGGACGTTGTTGCCGTAGATGAAGGGGGACCAGAGGTTGGTGTCCTTGTGGC
rJMFF044O21- GCGCAATGGGGACGTTGTTGCCGTAAATGAAGGGGGACCAGAGGTTGGTGTCCTTGTGGC
rJMFF032D15- GCGCAATGGGGACGTTGTTGCCGTAGATGAAGGGGGACCAGAGGTTGGTGTCCTTGTGGC
JMFN029F19+ GCGCAATGGGGACGTTGTTGCCGTAGATGAAGGGGGACCAGAGGTTGGTGTCCTTGTGGC
JMFN006J14+ GCGCAATGGGGACGTTGTTGCCGTAGATGAAGGGGGACCAGAGGTTGGTGTCCTTGTGGC
JMFN005K05+ GCGCAATGGGGACGTTGTTGCCGTAGATGAAGGGGGACCAGAGGTTGGTGTCCTTGTGGC
JMFS014C05+ GCGCAATGGGGACGTTGTTGCCGTAGATGAAGGGGGACCAGAGGTTGGTGTCCTTGTGGC
JMFF032D15+ GCGCAATGGGGACGTTGTTGCCGTAGATGAAGGGGGACCAGAGGTTGGTGTCCTTGTGGC
JMFF028M01+ GCGCAATGGGGACGTTGTTGCCGTAGATGAAGGGGGACCAGAGGTTGGTGTCCTTGTGGC
                      ____________________________________________________________
consensus GCGCAATGGGGACGTTGTTGCCGTAGATGAAGGGGGACCAGAGGTTGGTGTCCTTGTGGC
 
. : . : . : . : . : . :
rJMFF028M01- CCTGGTATACCGGCGGGATAACGGTGTAATAGGTGATTTGCTGGTTGTGGTAGGTGGCGA
JMFN013D09+ CCTGGTATACCGGCGGGATAACGGTGTAATAGGTGATTTGCTGGTTGTGGTAGGTGGCGA
rJMFF044O21- CCTGGTATACCGGCGGGATAACGGTGTAATAGGTGATTTGCTGGTTGTGGTAGGTGGCGA
rJMFF032D15- CCTGGTATACCGGCGGGATAACGGTGTAATAGGTGATTTGCTGGTTGTGGTAGGTGGCGA
JMFN029F19+ CCTGGTATACCGGCGGGATAACGGTGTAATAGGTGATTTGCTGGTTGTGGTAGGTGGCGA
JMFN006J14+ CCTGGTATACCGGCGGGATAACGGTGTAATAGGTGATTTGCTGGTTGTGGTAGGTGGCGA
JMFN005K05+ CCTGGTATACCGGCGGGATAACGGTGTAATAGGTGATTTGATGGTTGTGGTAGGTGGCGA
JMFS014C05+ CCTGGTATACCGGCGGGATAACGGTGTAATAGGTGATTTGCTGGTTGTGGTAGGTGGCGA
JMFF032D15+ CCTGGTATACCGGCGGGATAACGGTGTAATAGGTGATTTGCTGGTTGTGGTAGGTGGCGA
JMFF028M01+ CCTGGTATACCGGCGGGATAACGGTGTAATAGGTGATTTGCTGGTTGTGGTAGGTGGCGA
                      ____________________________________________________________
consensus CCTGGTATACCGGCGGGATAACGGTGTAATAGGTGATTTGCTGGTTGTGGTAGGTGGCGA
 
. : . : . : . : . : . :
rJMFF028M01- AGGCGTCNAGGCGGTCGTAGTAGACGCCGATGCGGCGGTTGGGGTTGTGGGANGAGACGG
JMFN013D09+ AGGCGTCGAGGCGGTCGTAGTAGACGCCGATGCGGCGGTTGGGGTTGTGGGAGGAGACGG
rJMFF044O21- AGGCGTCAAGGCGGTCGTAGTA-AAGCCGATGCGGCGGTTGGGGTTGTGGG
rJMFF032D15- AGGCGTCGAGGCGGTCGTAGTAGACGCCGATGCGGCGGTTGGGGTTGTGGGAGGAGACGG
JMFN029F19+ AGGCGTCGAGGCGGTCGTAGTAGACGCCGATGCGGCGGTTGGGGTTGTGGGAGGAGACGG
JMFN006J14+ AGGCGTCGAGGCGGTCGTAGTAGACGCCGATGCGGCGGTTGGGGTTGTGGGAGGAGACGG
JMFN005K05+ AGGCGTCGAGGCGGTCGTAGTAGACGCCGATGCGGCGGTTGGGGTTGTGGGAGGAGACGG
JMFS014C05+ AGGCGTCGAGGCGGTCGTAGTAGACGCCGATGCGGCGGTTGGGGTTGTGGGAGGAGACGG
JMFF032D15+ AGGCGTCGAGGCGGTCGTAGTAGACGCCGATGCGGCGGTTGGGGTTGTGGGAGGAGACGG
JMFF028M01+ AGGCGTCGAGGCGGTCGTAGNAGACGCCGATGCGGCGGTTGGGGTTGTGGGAGGAGACGG
                      ____________________________________________________________
consensus AGGCGTCGAGGCGGTCGTAGTAGACGCCGATGCGGCGGTTGGGGTTGTGGGAGGAGACGG
 
. : . : . : . : . : . :
rJMFF028M01- TGACTTGGATGGTGGTGG
JMFN013D09+ TGACTTGGATGGTGGTGGAGAAGATGTTGGGGGCGGAGACGTTGAA
rJMFF032D15- TGACTTGGATGGTGGTGGAGAAGATGTTGGGGGCGGAGACGTTGAAGTTGTANATGGTGG
JMFN029F19+ TGACTTGGATGGTGGTGGAGAAGATGTTGGGGGCGGAGACGTTGAAGTTGTAGATGGTGG
JMFN006J14+ TGACTTGGATGGTGGTGGAGAAGATGTTGGGGGCGGAGACGTTGAAGTTGTAGATGGTGG
JMFN005K05+ TGACTTGGATGGTGGTGGAGAAGATGTTGGGGGCGGAGACGTTGAAGTTGTAGATGGTGG
JMFS014C05+ TGACTTGGATGGTGGTGGAGAAGATGTTGGGGGCGGAGACGTTGAAGTTGTAGATGGTGG
JMFF032D15+ TGACTTGGATGGTGGTGGAGAAGATGTTGGGGGCGGAGACGTTGAAGTTGTAGATGGTGG
JMFF028M01+ TGACTTGGATGGTGGTGGAGAAGATGTTGGGGGCGGAGACGTTGAAGTTGTAGATGGTGG
                      ____________________________________________________________
consensus TGACTTGGATGGTGGTGGAGAAGATGTTGGGGGCGGAGACGTTGAAGTTGTAGATGGTGG
 
. : . : . : . : . : . :
rJMFF032D15- CGTCCTGGA
JMFN029F19+ CGTCCTGGAGGATGAAGCGAGGCTTCTTGGGCTGGAGAACCGCCCAGACGATGAGGATGG
JMFN006J14+ CGTCCTGGAGGATGAAGCGAGGCTTCTTGGGCTGGAGAACCGCCCAGACGATGAGGATGG
JMFN005K05+ CGTCCTGGAGGATGAAGCGAGGCTTCTTGGGCTGGAGAACCGCCCAGACGATGAGGATGG
JMFS014C05+ CGTCCTGGAGGATGAAGCGAGGCTTCTTGGGCTGGAGAACCGCCCAGACGATGAGGATGG
JMFF032D15+ CGTCCTGGAGGATGAAGCGAGGCTTCTTGGGCTGGAGAACCGCCCAGACGATGAGGATGG
JMFF028M01+ CGTCCTGGAGGATGAAGCGAGGCTTCTTGGGCTGGAGAACCGCCCAGACGATGAGGATGG
                      ____________________________________________________________
consensus CGTCCTGGAGGATGAAGCGAGGCTTCTTGGGCTGGAGAACCGCCCAGACGATGAGGATGG
 
. : . : . : . : . : . :
JMFN029F19+ TGAGGAGGATGAGGAAGAGGAGGATAAGGATGCAGCCGCAGAGTTGCCGGACGGCCTTCT
JMFN006J14+ TGAGGAGGATGAGGAAGAGGAGGATAAGGATGCAGCCGCAGAGTTGCCGGACGGCCTTCT
JMFN005K05+ TGAGGAGGATGAGGAAGAGGAGGATAAGGATGCAGCCGCAGAGTTGCCGGACGGCCTTCT
JMFS014C05+ TGAGGAGGATGAGGAAGAGGAGGATAAGGATGCAGCCGCAGAGTTGCCGGACGGCCTTCT
JMFF032D15+ TGAGGAGGATGAGGAAGAGGAGGATAAGGATGCAGCCGCAGAGTTGCCGGACGGCCTTCT
JMFF028M01+ TGAGGAGGATGAGGAAGAGGAGGATAAGGATGCAGCCGCAGAGTTGCCGGACGGCCTTCT
                      ____________________________________________________________
consensus TGAGGAGGATGAGGAAGAGGAGGATAAGGATGCAGCCGCAGAGTTGCCGGACGGCCTTCT
 
. : . : . : . : . : . :
JMFN029F19+ GCTTCCGGTCTTTGTGGATGCTGCACTCCTTCCCGGACATTTTTTTTATTTTTCCGGCGG
JMFN006J14+ GCTTCCGGTCTTTGTGGATGCTGCACTCCTTCCCGGACATTTTTTTTATTTTTCCGGCGG
JMFN005K05+ GCTTCCGGTCTTTGTGGATGCTGCACTCCTTCCCGGACATTTTTTTTATTTTTCCGGCGG
JMFS014C05+ GCTTCCGGTCTTTGTGGATGCTGCACTCCTTCCCGGACATTTTTTTTATT
JMFF032D15+ GCTTCCGGTCTTTGTGGATGCTGCACTCCTTCCCGGACATTTTTTTTATTTTTCCGGCGG
JMFF028M01+ GCTTCCGGTCTTTGTGGATGCTGCACTCCTTCCCGGACATTTTTTTTATTTTTCCGGCGG
                      ____________________________________________________________
consensus GCTTCCGGTCTTTGTGGATGCTGCACTCCTTCCCGGACATTTTTTTTATTTTTCCGGCGG
 
. : . : . : . : . : . :
JMFN029F19+ GTTTTGGTTTTCCGGTNGGCCTTGGGAGGTAAAG
JMFN006J14+ GTTTTGGTTTTCCGGT-GGCCTTGGGAGGTAAAGGTATGTGGGAG
JMFN005K05+ GTTTTGGTTTTCCGGT-GGCCTTGGGAGGTAAAGGTATGTGGGAGAATGGGAAAGGA
JMFF032D15+ GTTTTGGTTTTCCGGT-GGCCTTGGGAGGTAAAGGTATGTGGGAGAATGGGAAAGGA
JMFF028M01+ GTTTTGGTTTTCCGGT-GGCCTTGGGAGGTAAAGGTATGTGGGAGAATGGGAAAGGATAT
                      ____________________________________________________________
consensus GTTTTGGTTTTCCGGT-GGCCTTGGGAGGTAAAGGTATGTGGGAGAATGGGAAAGGATAT