Previous Contig 001327:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF028J03Sequence548001327 (2)gb:AF545812_18105621e-08Zea mays global transcription factor group C 102 (gtc102) mRNA, complete cds.702021294gb:OSJN00208_16967201e-18Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0062H02, complete seque
JMFS164G08Sequence593001327 (2)gb:AF545812_18105623e-27Zea mays global transcription factor group C 102 (gtc102) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS164G08+ CCAAAAACCATAATCGTTTCTGGGAACTCATACCCAAGCAACCAAATGT
                      ____________________________________________________________
consensus CCAAAAACCATAATCGTTTCTGGGAACTCATACCCAAGCAACCAAATGT
 
. : . : . : . : . : . :
JMFS164G08+ TCATGGCTGAGGATTTCAAGTACCTCAAATCCTCAGAAGGCGGAGGTGTTGCTATGGCAA
JMFF028J03+ TATGGCAA
                      ____________________________________________________________
consensus TCATGGCTGAGGATTTCAAGTACCTCAAATCCTCAGAAGGCGGAGGTGTTGCTATGGCAA
 
. : . : . : . : . : . :
JMFS164G08+ GAACATCAGAAGAACCCCAAATATCATCTCTATGTTCCTTCCAATGTGCATATAGGGCCT
JMFF028J03+ GAACATCAGAAGAACCCCAAATATCATCTCTATGTTCCTTCCAATGTGCATATAGGGCCT
                      ____________________________________________________________
consensus GAACATCAGAAGAACCCCAAATATCATCTCTATGTTCCTTCCAATGTGCATATAGGGCCT
 
. : . : . : . : . : . :
JMFS164G08+ GCAGTCTCCTGCTAAAGGTATTCAAATCAATTTTATAGGCACCTCCAGCAGATGCATGCC
JMFF028J03+ GCAGTCTCCTGCTAAAGGTATTCAAATCAATTTTATAGGCACCTCCAGCAGATGCATGCC
                      ____________________________________________________________
consensus GCAGTCTCCTGCTAAAGGTATTCAAATCAATTTTATAGGCACCTCCAGCAGATGCATGCC
 
. : . : . : . : . : . :
JMFS164G08+ CATTAGCAGGACCATTTCCATTCCACTGTTCTGCCATGACTAATATTTAATTCAACTAAT
JMFF028J03+ CATTAGCAGGACCATTTCCATTCCACTGTTCTGCCATGANTAATATTTAATTCAACTAAT
                      ____________________________________________________________
consensus CATTAGCAGGACCATTTCCATTCCACTGTTCTGCCATGACTAATATTTAATTCAACTAAT
 
. : . : . : . : . : . :
JMFS164G08+ CAGTTGCTCCCCGACTGAAACCCCGATATCAAGAAGCCAATTGAGGTCAAAGCTCGATAT
JMFF028J03+ CAGTTGCTCCCCGACTGAAACCCCGATATCAAGAAGCCAATTGAGGTCAAAGCTCGATAT
                      ____________________________________________________________
consensus CAGTTGCTCCCCGACTGAAACCCCGATATCAAGAAGCCAATTGAGGTCAAAGCTCGATAT
 
. : . : . : . : . : . :
JMFS164G08+ GGGCTCCAGTCCTCACTTCCTCGCGGCGGTCTATGTCGGTTAGGGTTTCGAGAGAGTTCG
JMFF028J03+ GGGCTCCAGTCCTCACTTCCTCGCGGCGGTCTATGTCGGTTAGGGTTTCGAGAGAGTTCG
                      ____________________________________________________________
consensus GGGCTCCAGTCCTCACTTCCTCGCGGCGGTCTATGTCGGTTAGGGTTTCGAGAGAGTTCG
 
. : . : . : . : . : . :
JMFS164G08+ GAAGAACAGAAAACGTTCCCAAGCAAGTCTTTGGTATCGATCAACCCACATATATCTCCA
JMFF028J03+ GAAGAACAGAAAACGTTCCCAAGCAAGTCTCTGGTATCGATCAACCCACATATATCTCCA
                      ____________________________________________________________
consensus GAAGAACAGAAAACGTTCCCAAGCAAGTCTTTGGTATCGATCAACCCACATATATCTCCA
 
. : . : . : . : . : . :
JMFS164G08+ GTGAATTTACCAGCTTGGGAGGAAACACGGAAGTAGAGCTGCGCAGAACAATCGAAGAAG
JMFF028J03+ GTGAATTTACCAGCTTGGGAGGAAACACGGAAGTAGAGCTGCGCAGAACAATCGAAGAAG
                      ____________________________________________________________
consensus GTGAATTTACCAGCTTGGGAGGAAACACGGAAGTAGAGCTGCGCAGAACAATCGAAGAAG
 
. : . : . : . : . : . :
JMFS164G08+ CTCTTCAACAATCGAAGAACAAAAAGGAGAAATATGCTAAGAAAGAGTAATCCAGAGAGA
JMFF028J03+ CTCTTCAACAATCGAAGAACAAAAAGGAGAAATATGCTAAGAAAGAGTAATCCAGAGAGA
                      ____________________________________________________________
consensus CTCTTCAACAATCGAAGAACAAAAAGGAGAAATATGCTAAGAAAGAGTAATCCAGAGAGA
 
. : . : . : . : . : . :
JMFS164G08+ GAGA
JMFF028J03+ GAGAGAGAGAAGCAGAGAGCGCCTCTGCGGTGAGAGAATGGGAGCGAATAAATATAATTT
                      ____________________________________________________________
consensus GAGAGAGAGAAGCAGAGAGCGCCTCTGCGGTGAGAGAATGGGAGCGAATAAATATAATTT