Previous Contig 001325:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF028I22Sequence551001325 (6)gb:AF144708_17719877e-23Pisum sativum Tha4 protein (Tha4) mRNA, complete cds; nuclear gene for chloropla591001325 (6)gb:AF144708_17719878e-23Pisum sativum Tha4 protein (Tha4) mRNA, complete cds; nuclear gene for chloropla
JMFF051G21Sequence613001325 (6)gb:AF144708_17719879e-23Pisum sativum Tha4 protein (Tha4) mRNA, complete cds; nuclear gene for chloropla642021935gb:AF144708_17719871e-22Pisum sativum Tha4 protein (Tha4) mRNA, complete cds; nuclear gene for chloropla
JMFN007O22Sequence614001325 (6)gb:AF144708_17719879e-23Pisum sativum Tha4 protein (Tha4) mRNA, complete cds; nuclear gene for chloropla
JMSF006N05Sequence319001325 (6)gb:AF144708_17719877e-15Pisum sativum Tha4 protein (Tha4) mRNA, complete cds; nuclear gene for chloropla
JMSF006N07Sequence253006620 (7)452001325 (6)gb:AF144708_17719872e-22Pisum sativum Tha4 protein (Tha4) mRNA, complete cds; nuclear gene for chloropla

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN007O22+ ATCTTA
JMFF051G21+ CCATATAAAGATCTTA
                      ____________________________________________________________
consensus CCATATAAAGATCTTA
 
. : . : . : . : . : . :
rJMFF028I22- GTCTTACCAAATACTAACTCATCCAAGAAATTCAAACACTATAACTTAGCTTAG
rJMSF006N07- AGAAATTCAAACACGATAACTTAGCTTAG
JMFN007O22+ TTAGCAGTCTTACCAAATACTAACTCATCCAAGAAATTCAAACACTATAACTTAGCTTAG
JMFF051G21+ TTAGCAGTCTTACCAAATACTAACTCATCCAAGAAATTCAAACACTATAACTTAGCTTAG
JMFF028I22+ ATAACTTAGCTTAG
                      ____________________________________________________________
consensus TTAGCAGTCTTACCAAATACTAACTCATCCAAGAAATTCAAACACTATAACTTAGCTTAG
 
. : . : . : . : . : . :
rJMFF028I22- CAATCAACAATAT-TCAGAAATCAAATGCGACG-TACAAAAACAA-ACCTAGTAGCAGTA
rJMSF006N07- CGATCAACAATATGTCAGAAATCAAATGCGACGCTACNAAANCAAGACCTAGTAGCAGTA
JMFN007O22+ CAATCAACAATAT-TCAGAAATCAAATGCGACG-TACAAAAACAA-ACCTAGTAGCAGTA
JMFF051G21+ CAATCAACAATAT-TCAGAAATCAAATGCGACG-TACAAAAACAA-ACCTAGTAGCAGTA
JMFF028I22+ CAATCAACAATAT-TCAGAAATCAAATGCGACG-TACAAAAACAA-ACCTAGTAGCAGTA
                      ____________________________________________________________
consensus CAATCAACAATAT-TCAGAAATCAAATGCGACG-TACAAAAACAA-ACCTAGTAGCAGTA
 
. : . : . : . : . : . :
rJMFF028I22- GTAGATGATTGAATGTATCGTCATAGTAGTTTAGGAAGCCTCCCTCGTCTTCTCTTCTTG
rJMSF006N07- GTAGATGATTGAATGTATCGTCATAGTAGTTTAGGAAGCCTCCCTCGTCTTCTCTTCTTG
JMFN007O22+ GTAGATGATTGAATGTATCGTCATAGTAGTTTAGGAAGCCTCCCTCGTCTTCTCTTCTTG
JMFF051G21+ GTAGATGATTGAATGTATCGTCATAGTAGTTTAGGAAGCCTCCCTCGTCTTCTCTTCTTG
JMFF028I22+ GTAGATGATTGAATGTATCGTCATAGTAGTTTAGGAAGCCTCCCTCGTCTTCTCTTCTTG
                      ____________________________________________________________
consensus GTAGATGATTGAATGTATCGTCATAGTAGTTTAGGAAGCCTCCCTCGTCTTCTCTTCTTG
 
. : . : . : . : . : . :
rJMFF028I22- ACTGACAGCTTTTAGTTCCTCTATAGCAGGCTCGGCTAGAGCACCAGGGTCCTTTTTCAT
rJMSF006N07- ACTGACAGCTTTTAGTTCCTCTATAGCAGGCTCGGCTAGAGCACCAGGGTCCTTTTTCAT
JMFN007O22+ ACTGACAGCTTTTAGTTCCTCTATAGCAGGCTCGGCTAGAGCACCAGGGTCCTTTTTCAT
JMFF051G21+ ACTGACAGCTTTTAGTTCCTCTATAGCAGGCTCGGCTAGAGCACCAGGGTCCTTTTTCAT
JMFF028I22+ ACTGACAGCTTTTAGTTCCTCTATAGCAGGCTCGGCTAGAGCACCAGGGTCCTTTTTCAT
                      ____________________________________________________________
consensus ACTGACAGCTTTTAGTTCCTCTATAGCAGGCTCGGCTAGAGCACCAGGGTCCTTTTTCAT
 
. : . : . : . : . : . :
rJMFF028I22- CTCCAGTTCAAATTCCTTTGCTGCCTGTTGGAAGCTCTTGAAGGTCTTGCCAATAGTGCG
rJMSF006N07- CTCCAGTTCAAATTCCTTTGCTGCCTGTTGGAAGCTCTTGAAGGTCTTGCCANTAGTGCG
JMFN007O22+ CTCCAGTTCAAATTCCTTTGCTGCCTGTTGGAAGCTCTTGAAGGTCTTGCCAATAGTGCG
JMFF051G21+ CTCCAGTTCAAATTCCTTTGCTGCCTGTTGGAAGCTCTTGAAGGTCTTGCCAATAGTGCG
JMSF006N05+ TGTTGGAAGCTCTTGAAGGTCTTGCCAATAGTGCG
JMFF028I22+ CTCCAGTTCAAATTCCTTTGCTGCCTGTTGGAAGCTCTTGAAGGTCTTGCCAATAGTGCG
                      ____________________________________________________________
consensus CTCCAGTTCAAATTCCTTTGCTGCCTGTTGGAAGCTCTTGAAGGTCTTGCCAATAGTGCG
 
. : . : . : . : . : . :
rJMFF028I22- GCCGACTTCTGGCAACTGTTTAGGGCCGAAGAGGAGGGTTGTGACGCCGGCGATGACCAC
rJMSF006N07- GCCGACTTCTGGCAACTGTTTAGGGCCGAAGAGGAGGGTTGTGACGCCGGCGATGACCAC
JMFN007O22+ GCCGACTTCTGGCAACTGTTTAGGGCCGAAGAGGAGGGTTGTGACGCCGGCGATGACCAC
JMFF051G21+ GCCGACTTCTGGCAACTGTTTAGGGCCGAAGAGGAGGGTTGTGACGCCGGCGATGACCAC
JMSF006N05+ GCCGACTTCTGGCAACTGTTTAGGGCCGAAGAGGAGGGTTGTGACGCCGGCGATGACCAC
JMFF028I22+ GCCGACTTCTGGCAACTGTTTAGGGCCGAAGAGGAGGGTTGTGACGCCGGCGATGACCAC
                      ____________________________________________________________
consensus GCCGACTTCTGGCAACTGTTTAGGGCCGAAGAGGAGGGTTGTGACGCCGGCGATGACCAC
 
. : . : . : . : . : . :
rJMFF028I22- AAGCTCCGGCACCCCAAGCCCGAACAAGCAATTGCAAGAAAAGCGCTTTGTAGGAGCGGA
rJMSF006N07- AAGCTCCGGCACCCCAAGCCCGAACNAGCAATTGCAAGAAAAGCGCTTTGTAGGAGCGGA
JMFN007O22+ AAGCTCCGGCACCCCAAGCCCGAACAAGCAATTGCAA
JMFF051G21+ AAGCTCCGGCACCCCAAGCCCGAACAAGCAATTGCAAGAAAAGCGCTTTGTAGGAGCGGA
JMSF006N05+ AAGCTCCGGCACCCCAAGCCCGAACAAGCAATTGCAAGAAAAGCGCTTTGTAGGAGCGGA
JMFF028I22+ AAGCTCCGGCACCCCAAGCCCGAACAAGCAATTGCAAGAAAAGCGCTTTGTAGGAGCGGA
                      ____________________________________________________________
consensus AAGCTCCGGCACCCCAAGCCCGAACAAGCAATTGCAAGAAAAGCGCTTTGTAGGAGCGGA
 
. : . : . : . : . : . :
rJMFF028I22- TCTGGGACGGGTAACCAGCTTGAGCCCGGCCCGGTTGCTGCTCAAGGACAATGAGCTAGA
rJMSF006N07- TCTGGGACGGGTAACCAGCTTGAGCCCGGCCCGGTTGCTGCTCAAGGACAATGAGCTAGA
JMFF051G21+ TCTGGGACGGGTAACCAGCTTGAGCCCGGCCCGGTTGCTGCTCAAGGACAATGAGCTAGA
JMSF006N05+ TCTGGGACGGGTAACCAGCTTGAGCCCGGCCCGGTTGCTGCTCAAGGACAATGAGCTAGA
JMFF028I22+ TCTGGGACGGGTAACCAGCTTGAGCCCGGCCCGGTTGCTGCTCAAGGACAATGAGCTAGA
                      ____________________________________________________________
consensus TCTGGGACGGGTAACCAGCTTGAGCCCGGCCCGGTTGCTGCTCAAGGACAATGAGCTAGA
 
. : . : . : . : . : . :
rJMFF028I22- GAAAGATAAAGAAGTAGTTGAAGAAGGAGAAGTGGGTTTTGATCGGGCGAGAGAGAGGGA
rJMSF006N07- GAA
JMFF051G21+ GAAAGATAAAGAAGTAGTTGAAGAAGGAGAAGTGGGTTTTGATCGGGCGAGAGAGAGGGA
JMSF006N05+ GAAAGATAAAGAAGTAGTTGAAGAAGGAGAAGTGGGTTTTGATCGGGCGAGAGAGAGGGA
JMFF028I22+ GAAAGATAAAGAAGTAGTTGAAGAAGGAGAAGTGGGTTTTGATCGGGCGAGAGAGAGGGA
                      ____________________________________________________________
consensus GAAAGATAAAGAAGTAGTTGAAGAAGGAGAAGTGGGTTTTGATCGGGCGAGAGAGAGGGA
 
. : . : . : . : . : . :
rJMFF028I22- GAGAGTGGTTGCTGGTGAAGAGTTGGTTGCCATTTTCGGATTTGAAGAAAATGTAGTTAC
JMFF051G21+ GAGAGTGGTTGCTGGTGAAGAGTTGGTTGCCATTTTCGGATTTGAAGAAAATGTAGTTAC
JMSF006N05+ GAGAGTGGTTGCTGGTGAAGAGTTGGTTGCCATTTTCGGATTT
JMFF028I22+ GAGAGTGGTTGCTGGTGAAGAGTTGGTTGCCATTTTCGGATTTGAAGAAAATGTAGTTAC
                      ____________________________________________________________
consensus GAGAGTGGTTGCTGGTGAAGAGTTGGTTGCCATTTTCGGATTTGAAGAAAATGTAGTTAC