Previous Contig 001324:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF028I14Sequence508001324 (2)pir|B85078|B850781e-06probable glucosyltransferase [imported] - Arabidopsis thaliana>gb:AC006266_15339666002378 (3)gb:AP003377_18287772e-29Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJN
JMFS082D02Sequence602001324 (2)pir|B85078|B850787e-25probable glucosyltransferase [imported] - Arabidopsis thaliana>gb:AC006266_15339

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS082D02+ GGAGCCAATGGAGGTCAGGCAGCCGGCGGCCTT
                      ____________________________________________________________
consensus GGAGCCAATGGAGGTCAGGCAGCCGGCGGCCTT
 
. : . : . : . : . : . :
JMFS082D02+ GTGCGCCTTGAGAAGGAGCACCCAAGTTAGCTGCTTGGCGTTCTTGTTCCGTACTTTCTC
                      ____________________________________________________________
consensus GTGCGCCTTGAGAAGGAGCACCCAAGTTAGCTGCTTGGCGTTCTTGTTCCGTACTTTCTC
 
. : . : . : . : . : . :
JMFS082D02+ GCGGCGGTAGTTGGTGGGCATTGAGATATCATGGTCGCCGCCGGCGCCGTTGGGGATGAG
                      ____________________________________________________________
consensus GCGGCGGTAGTTGGTGGGCATTGAGATATCATGGTCGCCGCCGGCGCCGTTGGGGATGAG
 
. : . : . : . : . : . :
JMFS082D02+ AAAATCTTCCTCCGACGCCCCCTCCAGCTCCACCATTGACCAGTTGTTCGGATTCTCCAT
JMFF028I14+ CCATTGACCAGTTGTTCGGATTCTCCAT
                      ____________________________________________________________
consensus AAAATCTTCCTCCGACGCCCCCTCCAGCTCCACCATTGACCAGTTGTTCGGATTCTCCAT
 
. : . : . : . : . : . :
JMFS082D02+ TTTCACCACCACAGGGGTGCCTCTATGGCTCTCCTTAGCCCACCAACCAAAAGAGGGAGC
JMFF028I14+ TTTCACCACCACAGGGGTGCCTCTATGGCTCTCCTTAGCCCACCAACCAAAAGAGGGAGC
                      ____________________________________________________________
consensus TTTCACCACCACAGGGGTGCCTCTATGGCTCTCCTTAGCCCACCAACCAAAAGAGGGAGC
 
. : . : . : . : . : . :
JMFS082D02+ CATTACACTACTATCTCCACCTAAACTCCTTCCAAGATTGAAGCTTTCCGGCTTGGCCCT
JMFF028I14+ CATTACACTACTATCTCCACCTAAACTCCTTCCAAGATTGAAGCTTTCCGGCTTGGCCCT
                      ____________________________________________________________
consensus CATTACACTACTATCTCCACCTAAACTCCTTCCAAGATTGAAGCTTTCCGGCTTGGCCCT
 
. : . : . : . : . : . :
JMFS082D02+ CACTTTTCAGCTCAAAAATCAACACAATGCGCCACACCCAGGAAGATGAACCAGTACAAA
JMFF028I14+ CACTTTTCAGCTCAAAAATCAACACAATGCGCCACACCCAGGAAGATGAACCAGTACAAA
                      ____________________________________________________________
consensus CACTTTTCAGCTCAAAAATCAACACAATGCGCCACACCCAGGAAGATGAACCAGTACAAA
 
. : . : . : . : . : . :
JMFS082D02+ CACTACCCAAAACACACTATTCCAACTCCATATCCAAAACTCTCTCTTCTCTCTCTCCAA
JMFF028I14+ CACTACCCAAAACACACTATTCCAACTCCATATCCAAAACTCTCTCTTCTCTCTCTCCAA
                      ____________________________________________________________
consensus CACTACCCAAAACACACTATTCCAACTCCATATCCAAAACTCTCTCTTCTCTCTCTCCAA
 
. : . : . : . : . : . :
JMFS082D02+ TTCTTGAATACAAAGAGCAGCTTAATAGATGGTGGGTGGGGGTCACAGTACAAAAGATTT
JMFF028I14+ TTCTTGAATACAAAGAGCAGCTTAATAGATGGTGGGTGGGGGTCACAGTACAAAAGATTT
                      ____________________________________________________________
consensus TTCTTGAATACAAAGAGCAGCTTAATAGATGGTGGGTGGGGGTCACAGTACAAAAGATTT
 
. : . : . : . : . : . :
JMFS082D02+ AAAAAGAATGAAGGAGAACTCAAATTACAGCTTGCAAAGGCTCTCAAACACACAACACAC
JMFF028I14+ AAAAAGAATGAAGGAGAACTCAAATTACAGCTTGCAAAGGCTCTCAAACACACAACACAC
                      ____________________________________________________________
consensus AAAAAGAATGAAGGAGAACTCAAATTACAGCTTGCAAAGGCTCTCAAACACACAACACAC
 
. : . : . : . : . : . :
JMFS082D02+ AATGGGGTAGTGACTAGTGAGATACAGAG
JMFF028I14+ AATGGGGTAGTGACTAGTGAGATACAGAGGCAGGGATGGGGAGTGGGTATGTTAAGAAAG
                      ____________________________________________________________
consensus AATGGGGTAGTGACTAGTGAGATACAGAGGCAGGGATGGGGAGTGGGTATGTTAAGAAAG
 
. : . : . : . : . : . :
JMFF028I14+ AGATGGTGGGTAAGAGAGAGAGAGAGAAAAAAAAAGACTATAATGGTAACAGCTCAACAC
                      ____________________________________________________________
consensus AGATGGTGGGTAAGAGAGAGAGAGAGAAAAAAAAAGACTATAATGGTAACAGCTCAACAC