Previous Contig 001319:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF019N11Sequence583001319 (6)gb:CQ974044_14554311e-26Sequence 3 from Patent WO2004113520.592001319 (6)gb:CQ974044_14554311e-26Sequence 3 from Patent WO2004113520.
JMFF028G10Sequence582001319 (6)gb:CQ974044_14554314e-22Sequence 3 from Patent WO2004113520.
JMFN007O18Sequence524001319 (6)gb:CQ974044_14554319e-27Sequence 3 from Patent WO2004113520.
JMFN008F22Sequence587001319 (6)gb:CQ974044_14554311e-26Sequence 3 from Patent WO2004113520.
JMFN029E18Sequence505001319 (6)gb:CQ974044_14554314e-25Sequence 3 from Patent WO2004113520.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN008F22+ ATTAAATT
                      ____________________________________________________________
consensus ATTAAATT
 
. : . : . : . : . : . :
JMFN008F22+ AAATTCAGGGCTAAATCTGATATATGACACATAATTCACAGACACTGTCTTCAAATAGCA
rJMFF019N11- GGGCTAAATCTGATATATGACACATAATTCACAGACACTGTCTTCAAATAGCA
JMFN007O18+ AGCA
JMFF019N11+ TGATATATGACACATAATTCACAGACACTGTCTTCAAATAGCA
JMFF028G10+ TGATATATGACACATAATTCACAGACACTGTCTTCAAATAGCA
                      ____________________________________________________________
consensus AAATTCAGGGCTAAATCTGATATATGACACATAATTCACAGACACTGTCTTCAAATAGCA
 
. : . : . : . : . : . :
JMFN008F22+ GATCATCAAAATTTAGGGTTTTATGCATTATTTTATAGCAAAACACAGTACAACAACTAT
rJMFF019N11- GATCATCAAAATTTAGGGTTTTATGCATTATTTTATAGCAAAACACAGTACAACAACTAT
JMFN007O18+ GATCATCAAAATTTAGGGTTTTATGCATTATTTTATAGCAAAACACAGTACAACAACTAT
JMFN029E18+ GGGTTTTATGCATTATTTTATAGCAAAACACAGGACAACAACTAT
JMFF019N11+ GATCATCAAAATTTAGGGTTTTATGCATTATTTTATAGCAAAACACAGTACAACAACTAT
JMFF028G10+ GATCATCAAAATTTAGGGTTTTATGCATTATTTTATAGCAAAACACAGTACAACAACTAT
                      ____________________________________________________________
consensus GATCATCAAAATTTAGGGTTTTATGCATTATTTTATAGCAAAACACAGTACAACAACTAT
 
. : . : . : . : . : . :
JMFN008F22+ TTTGCATTTTGTATTTGATAATTACGACGGAAGTGGTGCTGCTTTACTTTGACGGAGTAG
rJMFF019N11- TTTGCATTTTGTATTTGATAATTACGACGGAAGTGGTGCTGCTTTACTTTGACGGAGTAG
JMFN007O18+ TTTGCATTTTGTATTTGATAATTACGACGGAAGTGGTGCTGCTTTACTTTGACGGAGTAG
JMFN029E18+ TTTGCATTTTGTATTCGATAATTACGACGGAAGTGGTGCTGCTTTACTTTGACGGAGTAG
JMFF019N11+ TTTGCATTTTGTATTTGATAATTACGACGGAAGTGGTGCTGCTTTACTTTGACGGAGTAG
JMFF028G10+ TTTGCATTTTGTATTTGATAATTACGACGGAAGTGGTGCTGCTTTACTTTGACGGAGTAG
                      ____________________________________________________________
consensus TTTGCATTTTGTATTTGATAATTACGACGGAAGTGGTGCTGCTTTACTTTGACGGAGTAG
 
. : . : . : . : . : . :
JMFN008F22+ CGGGTGCAAAGGAGAGCAACTCCTTAGATTTGGCCCAGGGCTTGACAACCACTACGGCGT
rJMFF019N11- CGGGTGCAAAGGAGAGCAACTCCTTAGATTTGGCCCAGGGCTTGACAACCACTACGGCGT
JMFN007O18+ CGGGTGCAAAGGAGAGCAACTCCTTAGATTTGGCCCAGGGCTTGACAACCACTACGGCGT
JMFN029E18+ CGGGTGCAAAGGAGAGCAACTCCTTAGATTTGGCCCAGGGCTTGACAACCACTACGGCGT
JMFF019N11+ CGGGTGCAAAGGAGAGCAACTCCTTAGATTTGGCCCAGGGCTTGACAACCACTACGGCGT
JMFF028G10+ CGGGTGCAAAGGAGAGCAACTCCTTAGATTTGGCCCAGGGCTTGAC-ACCACTACGGCGT
                      ____________________________________________________________
consensus CGGGTGCAAAGGAGAGCAACTCCTTAGATTTGGCCCAGGGCTTGACAACCACTACGGCGT
 
. : . : . : . : . : . :
JMFN008F22+ CGAAAGTGTTGGCTTCTCCGCCGGCGGTGGAGGCGGAGATGCGGAGGTAGTACTTGATTC
rJMFF019N11- CGAAAGTGTTGGCTTCTCCGCCGGCGGTGGAGGCGGAGATGCGGAGGTAGTACTTGATTC
JMFN007O18+ CGAAAGTGTTGGCTTCTCCGCCGGCGGTGGAGGCGGAGATGCGGAGGTAGTACTTGATTC
JMFN029E18+ CGAAAGTGTTGGCTTCTCCGCCGGCGGTGGAGGCGGAGATGCGGAGGTAGTACTTGATTC
JMFF019N11+ CGAAAGTGTTGGCTTCTCCGCCGGCGGTGGAGGCGGAGATGCGGAGGTAGTACTTGATTC
JMFF028G10+ CGAAAGTGTTGGCTTCTCCGCCGGCGGTGGAGGCGGAGATGCGGAGGTAGTACTTGATTC
                      ____________________________________________________________
consensus CGAAAGTGTTGGCTTCTCCGCCGGCGGTGGAGGCGGAGATGCGGAGGTAGTACTTGATTC
 
. : . : . : . : . : . :
JMFN008F22+ CGTTCACCACCTGCTTCTCCGCCTTCACCACCTCCGAGAAGCTCAACAACTTCCCGGTAC
rJMFF019N11- CGTTCACCACCTGCTTCTCCGCCTTCACCACCTCCGAGAAGCTCAACAACTTCCCGGTAC
JMFN007O18+ CGTTCACCACCTGCTTCTCCGCCTTCACCACCTCCGAGAAGCTCAACAACTTCCCGGTAC
JMFN029E18+ CGTTCACCACCTGCTTCTCCGCCTTCACCACCTCCGAGAAGCTCAACAACTTCCCGGTAC
JMFF019N11+ CGTTCACCACCTGCTTCTCCGCCTTCACCACCTCCGAGAAGCTCAACAACTTCCCGGTAC
JMFF028G10+ CGTTCACCACCTGCTTCTCCGCCTTCACCACCTCCGAGAAGCTCAACAACTTCCCGGTAC
                      ____________________________________________________________
consensus CGTTCACCACCTGCTTCTCCGCCTTCACCACCTCCGAGAAGCTCAACAACTTCCCGGTAC
 
. : . : . : . : . : . :
JMFN008F22+ CCTGCTTTTTCTGCTTGAGGCCACTGTTATACTCCTCCACACAGTACTTCCCCAGCTGTT
rJMFF019N11- CCTGCTTTTTCTGCTTGAGGCCACTGTTATACTCCTCCACACAGTACTTCCCCAGCTGTT
JMFN007O18+ CCTGCTTTTTCTGCTTGAGGCCACTGTTATACTCCTCCACACAGTACTTCCCCAGCTGTT
JMFN029E18+ CCTGCTTTTTCTGCTTGAGGCCACTGTTATACTCCTCCACACAGTACTTCCCCAGCTGTT
JMFF019N11+ CCTGCTTTTTCTGCTTGAGGCCACTGTTATACTCCTCCACACAGTACTTCCCCAGCTGTT
JMFF028G10+ CCTGCTTTTTCTGCTTGAGGCCACTGTTATACTCCTCCACACAGTACTTCCCCAGCTGTT
                      ____________________________________________________________
consensus CCTGCTTTTTCTGCTTGAGGCCACTGTTATACTCCTCCACACAGTACTTCCCCAGCTGTT
 
. : . : . : . : . : . :
JMFN008F22+ GAATCTCCTTGTTGGTCTTCACATCCTCGATCTCTGTTCTCCCGCCTACCTTCCTTCCTA
rJMFF019N11- GAATCTCCTTGTTGGTCTTCACATCCTCGATCTCTGTTCTCCCGCCTACCTTCCTTCCTA
JMFN007O18+ GAATCTCCTTGTTGGTCTTCACATCCTCGATCTCTGTTCTCCCGCCTACCTTCCTTCCTA
JMFN029E18+ GAATCTCCTTGTTGGTCTTCACATCCTCGATCTCTGTTCTCCCGCCTACCTTCCTTCCTA
JMFF019N11+ GAATCTCCTTGTTGGTCTTCACATCCTCGATCTCTGTTCTCCCGCCTACCTTCCTTCCTA
JMFF028G10+ GAATCTCCTTGTTGGTCTTCACATCCTCGATCTCTGTTCTCCCGCCTACCTTCCTTCCTA
                      ____________________________________________________________
consensus GAATCTCCTTGTTGGTCTTCACATCCTCGATCTCTGTTCTCCCGCCTACCTTCCTTCCTA
 
. : . : . : . : . : . :
JMFN008F22+ GGGCGTTCACTTGGGCGCACCACAAGGCTATGGCCAGAAGGGAAAGGAGAAGGAAGAGGT
rJMFF019N11- GGGCGTTCACTTGGGCGCACCACAAGGCTATGGCCAGAAGGGAAAGGAGAAGGAAGAGGT
JMFN007O18+ GGGCGTTCACTTGGGCGCACCACAAGGCTATGGCCAGAAGGGAAAGGAGAAGGAAGAGGT
JMFN029E18+ GGGCGTTCACTTGGGCGCACCACAAGGCTATGGCCAGAAGGGAAAGAAGAAGGAAGAGGT
JMFF019N11+ GGGCGTTCACTTGGGCGCACCACAAGGCTATGGCCAGAAGGGAAAGGAGAAGGAAGAGGT
JMFF028G10+ GGGCGTTCACTTGGGCGCACCACAAGGCTATGGCCAGAAGGGAAAGGAGAAGGAAGAGGT
                      ____________________________________________________________
consensus GGGCGTTCACTTGGGCGCACCACAAGGCTATGGCCAGAAGGGAAAGGAGAAGGAAGAGGT
 
. : . : . : . : . : . :
JMFN008F22+ TGAGTGTAGTTTTCGCCATTTTAGTTGAGAGAGAGAAAA
rJMFF019N11- TGAGTGTAGTTTTCGCCATTTTAGTTGAGAGAGAGAAAAGTGGTGGTATCTTTGGATGT
JMFN007O18+ TGAGTGTAGTTTTCGCCATTTTAGTTGAGAGAGAGAAAAG
JMFN029E18+ TGAGTGTAGTTTTCGCCATTTTAGTTGAGAGAGAGAAAAG
JMFF019N11+ TGAGTGTAGTTTTCGCCATTTTAGTTGAGAGAGAGAAAAGTGGTGGTATCTTTGGATGT
JMFF028G10+ TGAGTGTAGTTTTCGCCATTTTAGTTGAGAGAGAGAAAAGTGGTGGTATCTTTGGATGTC
                      ____________________________________________________________
consensus TGAGTGTAGTTTTCGCCATTTTAGTTGAGAGAGAGAAAAGTGGTGGTATCTTTGGATGTC