Previous Contig 001315:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF028D11Sequence448001315 (2)gb:AF219972_17782222e-04Mesembryanthemum crystallinum CDPK substrate protein 1 (csp1) mRNA, complete cds620012702 (2)gb:AB017693_15136787e-31Nicotiana tabacum WERBP-1 mRNA, complete cds.
JMSF030C21Sequence679001315 (2)gb:AF219972_17782222e-09Mesembryanthemum crystallinum CDPK substrate protein 1 (csp1) mRNA, complete cds681012702 (2)gb:AB017693_15136782e-32Nicotiana tabacum WERBP-1 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF030C21+ GCTGACCACTGTGTGTAGGGGTATTTATTGGGTAATCAAGAAAATCAGTTAATGA
                      ____________________________________________________________
consensus GCTGACCACTGTGTGTAGGGGTATTTATTGGGTAATCAAGAAAATCAGTTAATGA
 
. : . : . : . : . : . :
JMSF030C21+ ATCCGTAGACCATGGGCCAATATTTTGCTTAGAGTAATGACTCGATGCTGTGGATTGAAG
                      ____________________________________________________________
consensus ATCCGTAGACCATGGGCCAATATTTTGCTTAGAGTAATGACTCGATGCTGTGGATTGAAG
 
. : . : . : . : . : . :
JMSF030C21+ AACTCCAGAATCAGGCAACAACATGGATGACTCGTTATTTGTTGACTGGGAAATAAAAGG
                      ____________________________________________________________
consensus AACTCCAGAATCAGGCAACAACATGGATGACTCGTTATTTGTTGACTGGGAAATAAAAGG
 
. : . : . : . : . : . :
JMSF030C21+ AGGTTGTCTCGAATGGTTCTCTAGTGGTGAAGCAGATGAAAAATGAAGATCACTGGAAAA
                      ____________________________________________________________
consensus AGGTTGTCTCGAATGGTTCTCTAGTGGTGAAGCAGATGAAAAATGAAGATCACTGGAAAA
 
. : . : . : . : . : . :
JMSF030C21+ TCCAGAAGATGAAGAAAACATAAGACCAGCAACCTCACTATTTGATGACAATGGAGCAAC
JMFF028D11+ ACCAGCAACCTCACTATTTGATGACAATGGAGCAAC
                      ____________________________________________________________
consensus TCCAGAAGATGAAGAAAACATAAGACCAGCAACCTCACTATTTGATGACAATGGAGCAAC
 
. : . : . : . : . : . :
JMSF030C21+ AGCTGGAGGACATTGCATAGTTTCCCTTTCCAAGGAAATCTGCTGCGAGTCGGGCAACTT
JMFF028D11+ AGCTGGAGGACATTGCATAGTTTCCCTTTCCAAGGAAATCTGCTGCGAGTCGGGCAACTT
                      ____________________________________________________________
consensus AGCTGGAGGACATTGCATAGTTTCCCTTTCCAAGGAAATCTGCTGCGAGTCGGGCAACTT
 
. : . : . : . : . : . :
JMSF030C21+ GGGATATTTCCCTTCGAGATTTGTAGGAAGGACTGGTAAAGAAGAAGAAAGAGCCCCAGA
JMFF028D11+ GGGATATTTCCCTTCGAGATTTGTAGGAAGGACTGGTAAAGAAGAAGAAAGAGCCCCAGA
                      ____________________________________________________________
consensus GGGATATTTCCCTTCGAGATTTGTAGGAAGGACTGGTAAAGAAGAAGAAAGAGCCCCAGA
 
. : . : . : . : . : . :
JMSF030C21+ TGCACCAAAGTTATTTAGTTGCCTAGACCCCACTCTTTGGATGGATAAAGCTGGTCGTGC
JMFF028D11+ TGCACCAAAGTTATTTAGTTGCCTAGACCCCACTCTTTGGATGGATAAAGCTGGTCGTGC
                      ____________________________________________________________
consensus TGCACCAAAGTTATTTAGTTGCCTAGACCCCACTCTTTGGATGGATAAAGCTGGTCGTGC
 
. : . : . : . : . : . :
JMSF030C21+ CTCCATTACTGCTTTTTCGTGTAGATAGTTAATTATCTGCCTGAATCAGTATCCTCTTAA
JMFF028D11+ CTCCATTACTGCTTTTTCGTGTAGATAGTTAATTATCTGCCTGAATCAGTATCCTCTTAA
                      ____________________________________________________________
consensus CTCCATTACTGCTTTTTCGTGTAGATAGTTAATTATCTGCCTGAATCAGTATCCTCTTAA
 
. : . : . : . : . : . :
JMSF030C21+ CTTCAGTCAACTAAGATGAAGCTCAATACCTACACGGAACAACAACGTAGGACACACATG
JMFF028D11+ CTTCAGTCAACTAAGATGAAGCTCAATAC--------AACAACAACGTAGGACACACATG
                      ____________________________________________________________
consensus CTTCAGTCAACTAAGATGAAGCTCAATACCTACACGGAACAACAACGTAGGACACACATG
 
. : . : . : . : . : . :
JMSF030C21+ TCGACTCAAATTGCACGTGCGGTGGTTCCGTCGCCGGCGCGGCCGAGAGAATTGAACGGT
JMFF028D11+ TCGACTCAAATTGCACGTGCGGTGGTTCCGTCGCCGGCGCGGCCGAGAGAATTGAACGGT
                      ____________________________________________________________
consensus TCGACTCAAATTGCACGTGCGGTGGTTCCGTCGCCGGCGCGGCCGAGAGAATTGAACGGT
 
. : . : . : . : . : . :
JMSF030C21+ GCCGGTCGTCTCGCCCTCTTGTC
JMFF028D11+ GCCGGTCGTCTCGCCCTCTTGTCGCCTGCTTTTATTTGGGTTTGGCTTCTAAATAATTCT
                      ____________________________________________________________
consensus GCCGGTCGTCTCGCCCTCTTGTCGCCTGCTTTTATTTGGGTTTGGCTTCTAAATAATTCT