Previous Contig 001309:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002M20Sequence388001309 (6)730010319 (5)pir|T00689|T006892e-54hypothetical protein At2g44090 [imported] - Arabidopsis thaliana>gb:AC004005_153
JMFF025K03Sequence566001309 (6)760010319 (5)pir|T00689|T006893e-55hypothetical protein At2g44090 [imported] - Arabidopsis thaliana>gb:AC004005_153
JMFF028A05Sequence503001309 (6)687010319 (5)pir|T00689|T006891e-42hypothetical protein At2g44090 [imported] - Arabidopsis thaliana>gb:AC004005_153
JMFF043I05Sequence637001309 (6)633010319 (5)pir|T00689|T006894e-29hypothetical protein At2g44090 [imported] - Arabidopsis thaliana>gb:AC004005_153
JMFS028H01Sequence633001309 (6)pir|T47815|T478152e-09hypothetical protein F24G16.180 - Arabidopsis thaliana>gb:ATF24G16_1549858 Arabi
JMSF001P14Sequence276001309 (6)678010319 (5)pir|T00689|T006891e-47hypothetical protein At2g44090 [imported] - Arabidopsis thaliana>gb:AC004005_153

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS028H01+ ATCATGGAAGTCACAGCGTCCTGAAATGACCTCCCTAGCTCAATCCTGTC
                      ____________________________________________________________
consensus ATCATGGAAGTCACAGCGTCCTGAAATGACCTCCCTAGCTCAATCCTGTC
 
. : . : . : . : . : . :
JMFS028H01+ CTGTTTACTAAGCTTCTTCTCTTGCCCAGATTTCTCATTTTTACCAGGTTCAGGATCAGA
                      ____________________________________________________________
consensus CTGTTTACTAAGCTTCTTCTCTTGCCCAGATTTCTCATTTTTACCAGGTTCAGGATCAGA
 
. : . : . : . : . : . :
JMFS028H01+ ATTAGCCTGTCTGAATTTATGTTTCTTAACCCCAGAAATGCAAGGTCCTCCTGGTCCTCT
JMFF043I05+ TGGTCCTCT
                      ____________________________________________________________
consensus ATTAGCCTGTCTGAATTTATGTTTCTTAACCCCAGAAATGCAAGGTCCTCCTGGTCCTCT
 
. : . : . : . : . : . :
JMFS028H01+ AAAATCTTTCCCCACATGCGGGGTTTGTCCTGAAAAAACCACATTGCCATTGCTTCCCTC
JMFF043I05+ AAAATCTTTCCCCACATGCGGGGTTTGTCCTGAAAAAACCACATTGCCATT-CTTCCCTC
                      ____________________________________________________________
consensus AAAATCTTTCCCCACATGCGGGGTTTGTCCTGAAAAAACCACATTGCCATTGCTTCCCTC
 
. : . : . : . : . : . :
JMFS028H01+ ACCATTCTCAGAGTCGGAAACAAAATTTTGGCCACTCATACCCGAGATTCCAGTTTCCAC
JMFF043I05+ ACCATTCTCAGAGTCGGAAACAAAATTTTGGCCACTCATACCCGAGATTCCAGTTTCCAC
JMFF025K03+ ATTCTCAGAGTCGGAAACAAAATTTTGGCCACTCATACCCGAGATTCCAGTTTCCAC
                      ____________________________________________________________
consensus ACCATTCTCAGAGTCGGAAACAAAATTTTGGCCACTCATACCCGAGATTCCAGTTTCCAC
 
. : . : . : . : . : . :
JMFS028H01+ TTCCATTCCACAGCAGTGAGGCTCCCTCATATTATTATCCTCAGCAACCAAATTCAGGTC
JMFF043I05+ TTCCATTCCACAGCAGTGAGGCTCCCTCATATTATTATCCTCAGCAACCAAATTCAGGTC
JMFF025K03+ TTCCATTCCACAGCAGTGAGGCTCCCTCATATTATTATCCTCAGCAACCAAATTCAGGTC
JMFF028A05+ TCCTCAGCAACCAAATTCAGGTC
                      ____________________________________________________________
consensus TTCCATTCCACAGCAGTGAGGCTCCCTCATATTATTATCCTCAGCAACCAAATTCAGGTC
 
. : . : . : . : . : . :
JMFS028H01+ TTGATTCTCCACCAGGTATGTTCCCTTATCTTCTTCCATTTTGTATCGTCCAACCAAGCA
JMFF043I05+ TTGATTCTCCACCAGGTATGTTCCCTTATCTTCTTCCATTTTGTATCGTCCAACCAAGCA
JMFF025K03+ TTGATTCTCCACCAGGTATGTTCCCTTATCTTCTTCCATTTTGTATCGTCCAACCAAGCA
JMFF028A05+ TTGACTCTCCACCAGGTATGTTCCCTTATCTTCTTCCATTTTGTATCGTCCAACCAAGCA
                      ____________________________________________________________
consensus TTGATTCTCCACCAGGTATGTTCCCTTATCTTCTTCCATTTTGTATCGTCCAACCAAGCA
 
. : . : . : . : . : . :
JMFS028H01+ AGCACCCAAAGCTAGGCAAAGACAAGAAGAATCACTTCTTCCAGATAGCAGCCTTAACCA
JMFF043I05+ AGCACCCAAAGCTAGGCAAAGACAAGAAGAATCACTTCTTCCAGATAGCAGCCTTAACCA
JMFF025K03+ AGCACCCAAAGCTAGGCAAAGACAAGAAGAATCACTTCTTCCAGATAGCAGCCTTAACCA
JMFF002M20+ GCACCCAAAGCTAGGCAAAGACAAGAAGAATCACTTCTTCCAGATAGCANCCTTAACCA
JMFF028A05+ AGCACCCAAAGCTAGGCAAAGACAAGAAGAATCACTTCTTCCAGATAGCAGCCTTAACCA
                      ____________________________________________________________
consensus AGCACCCAAAGCTAGGCAAAGACAAGAAGAATCACTTCTTCCAGATAGCAGCCTTAACCA
 
. : . : . : . : . : . :
JMFS028H01+ TATTAAAGGAAAAATATAGTCCCCTAAATCCCTTAAGAATCACAACTTTCATACAAACCC
JMFF043I05+ TATTAAAGGAAAAATATAGTCCCCTAAATCCCTTAAGAATCACAACTTTCATACAAACCC
JMSF001P14+ AACCC
JMFF025K03+ TATTAAAGGAAAAATATAGTCCCCTAAATCCCTTAAGAATCACAACTTTCATACAAACCC
JMFF002M20+ TATTAAAGGAAAAATATAGTCCCCTAAATCCCTTAAGAATCACAACTTTCATACAAACCC
JMFF028A05+ TATTAAAGGAAAAATATAGTCCCCTAAATCCCTTAAGAATCACAACTTTCATACAAACCC
                      ____________________________________________________________
consensus TATTAAAGGAAAAATATAGTCCCCTAAATCCCTTAAGAATCACAACTTTCATACAAACCC
 
. : . : . : . : . : . :
JMFS028H01+ TTGAAAAGTTAACGGAAATCCACGGAGGATTTGAGATCAAACTGAAGCGTAAAAATGACC
JMFF043I05+ TTGAAAAGTTAACGGAAATCCACGGAGGATTTGAGATCAAACTGAAGCGTAAAAATGACC
JMSF001P14+ NTGAAAAGTTAACGGAAATCCACGGAGGATTTGAGATCAAACTGAAGCGTAAAAATGACC
JMFF025K03+ TTGAAAAGTTAACGGAAATCCACGGAGGATTTGAGATCAAACTGAAGCGTAAAAATGACC
JMFF002M20+ TTGAAAAGTTAACGGAAATCCACGGAGGATTTGAGATCAAACTGAAGCGTAAAAATGACC
JMFF028A05+ TTGAAAAGTTAACGGAAATCCACGGAGGATTTGAGATCAAACTGAAGCGTAAAAATGACC
                      ____________________________________________________________
consensus TTGAAAAGTTAACGGAAATCCACGGAGGATTTGAGATCAAACTGAAGCGTAAAAATGACC
 
. : . : . : . : . : . :
JMFS028H01+ TGGATTCCTCAAAAAGAAGGGAATTGAAGGATCAAAGAAGAAC
JMFF043I05+ TGGATTCCTCAAAAAGAAGGGAATTGAAGGATCAAAGAAGAACAAAAATCCCAGCAGCAA
JMSF001P14+ TGGATTCCTCAAAAAGAAGGGAATTGAAGGATCAAAGAAGAACAAAAATCCCAGCAGCAA
JMFF025K03+ TGGATTCCTCAAAAAGAAGGGAATTGAAGGATCAAAGAAGAACAAAAATCCCAGCAGCAA
JMFF002M20+ TGGATTCCTCAAAAAGAAGGGAATTGAAGGATCAAAGAAGAACAAAAATCCCAGCAGCAA
JMFF028A05+ TGGATTCCTCAAAAAGAAGGGAATTGAAGGATCAAAGAAGAACAAAAATCCCAGCAGCAA
                      ____________________________________________________________
consensus TGGATTCCTCAAAAAGAAGGGAATTGAAGGATCAAAGAAGAACAAAAATCCCAGCAGCAA
 
. : . : . : . : . : . :
JMFF043I05+ GGGAAAAAGGGCTCAGATGAGAAGCACCACCACCGGAACCACCGGCATCTTCATCATCAG
JMSF001P14+ GGGAAAAAGGGCTCAGATGAGAAGCACCACCACCGGAACCACCGGCATCTTCATCATCAG
JMFF025K03+ GGGAAAAAGGGCTCAGATGAGAAGCACCACCACCGGAACCACCGGCATCTTCATCATCAG
JMFF002M20+ GGGAAAAAGGGCTCAGATGAGAAGCACCACCACCGGAACCACCGGCATCTTCATCATCAG
JMFF028A05+ GGGAAAAAGGGCTCAGATGAGAAGCACCACCACCGGAACCACCGGCATCTTCATCATCAG
                      ____________________________________________________________
consensus GGGAAAAAGGGCTCAGATGAGAAGCACCACCACCGGAACCACCGGCATCTTCATCATCAG
 
. : . : . : . : . : . :
JMFF043I05+ AACCCTAAGGAAGCCCCTTTCCGACTACCAAACAATCGAATCCACAGTTGAACCTTTCTG
JMSF001P14+ AACCCTAAGGAAGCCCCTTTCCGACTACCAAACAATCGAATCCACAGTTGAACCTTTCTG
JMFF025K03+ AACCCTAAGGAAGCCCCTTTCCGACTACCAAACAATCGAATCCACAGTTGAACCTTTCTG
JMFF002M20+ AACCCTAAGGAAGCCCCTTTCCGACTACCAAACAATCGAATCCACAGTTGAACCTTTCTG
JMFF028A05+ AACCCTAAGGAAGCCCCTTTCCGACTACCAAACAATCGAATCCACAGTTGAAACCGGAAG
                      ____________________________________________________________
consensus AACCCTAAGGAAGCCCCTTTCCGACTACCAAACAATCGAATCCACAGTTGAACCTTTCTG
 
. : . : . : . : . : . :
JMFF043I05+ ATTCATTGGTGAGAGA-GAGAGGCTGT
JMSF001P14+ ATTCATTGGTGAGAGA-GAGAGGCTGT
JMFF025K03+ ATTCATTGGTGAGAGA-GAGAGGCTGT
JMFF002M20+ ANTCATTGGTGAGAGA-GAGAGGCTGT
JMFF028A05+ AAAACCCAACGAAAAATGTAACGAAGTAGAGAAAATAACAGAAAAAGCAGTGCAGAATAT
                      ____________________________________________________________
consensus ATTCATTGGTGAGAGA-GAGAGGCTGTAGAGAAAATAACAGAAAAAGCAGTGCAGAATAT