Previous Contig 001298:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF021A19Sequence455001298 (9)675010676 (13)gb:AC007017_15349653e-08Arabidopsis thaliana chromosome 2 clone F11F19 map g6825, complete sequence.>gb:
JMFF026J23Sequence533001298 (9)gb:AC007017_15349650.029Arabidopsis thaliana chromosome 2 clone F11F19 map g6825, complete sequence.>gb:741010676 (13)gb:AC007017_15349657e-19Arabidopsis thaliana chromosome 2 clone F11F19 map g6825, complete sequence.>gb:
JMFF027L10Sequence539001298 (9)734010676 (13)gb:AC007017_15349654e-14Arabidopsis thaliana chromosome 2 clone F11F19 map g6825, complete sequence.>gb:
JMFF041B11Sequence617001298 (9)gb:AC007017_15349650.024Arabidopsis thaliana chromosome 2 clone F11F19 map g6825, complete sequence.>gb:555010676 (13)
JMFF050G24Sequence633001298 (9)522010676 (13)
JMFS030F12Sequence568001298 (9)
JMSF006P02Sequence296001298 (9)395010676 (13)
JMSF011J13Sequence421001298 (9)765010676 (13)gb:AC007017_15349651e-20Arabidopsis thaliana chromosome 2 clone F11F19 map g6825, complete sequence.>gb:
JMSF036D13Sequence646001298 (9)gb:AC007017_15349650.045Arabidopsis thaliana chromosome 2 clone F11F19 map g6825, complete sequence.>gb:744010676 (13)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF041B11+ AAGAACACTCGATGCCACTGGTAAAGTTCTTCTTCTATGGGTTGT
                      ____________________________________________________________
consensus AAGAACACTCGATGCCACTGGTAAAGTTCTTCTTCTATGGGTTGT
 
. : . : . : . : . : . :
JMFF026J23+ CAACATTGATGTTAGCACTCTTCAAGACACCCGAGGCACGCCTTCCGGCTGGGCT
JMFF041B11+ TCCTCCAACATTGATGTTAGCACTCTTCAAGACACCCGAGGCACGCCTTCCGGCTGGGCT
JMFF050G24+ CAACATTGATGTANGCACTC-TCAAGACACCCGAGGCACGCCTTCCGGCTGGGC-
JMSF036D13+ TCCTCCAACATTGATGTTAGCACTCTTCAAGACACCCGAGGCACGCCTTCCGGCTGGGCT
                      ____________________________________________________________
consensus TCCTCCAACATTGATGTTAGCACTCTTCAAGACACCCGAGGCACGCCTTCCGGCTGGGCT
 
. : . : . : . : . : . :
JMFF026J23+ GGAATGGGGAACCGGTTTTTCTGTGGCATTTGAAAGCGACCCCCCCTTGGCACTCGGTTT
JMFF021A19+ CACTCGGTTT
JMFS030F12+ CCCCCTTGGCACTCGGTTT
JMFF041B11+ GGAATGGGGAACCGGTTTTTCTGTGGCATTTGAAAGCGACCCCCCCTTGGCACTCGGTTT
JMFF050G24+ GGAATGGGGAACCGG-TTTTCTGTGGCA-TTGAAAGCGACCCCCCCTTGGCACTCGGTTT
JMSF036D13+ GGAATGGGGAACCGGTTTTTCTGTGGCATTTGAAAGCGACCCCCCCTTGGCACTCGGTTT
                      ____________________________________________________________
consensus GGAATGGGGAACCGGTTTTTCTGTGGCATTTGAAAGCGACCCCCCCTTGGCACTCGGTTT
 
. : . : . : . : . : . :
JMFF026J23+ CTTTGGATACACATCAATGCTTTTCCTCATCACATCAGAACTAACGCCTTTTGCAGGGAA
JMFF021A19+ CTTTGGATACACATCAATGCTTTTCCTCATCACATCAGAACTAACGCCTTTTGCAGGGAA
JMFS030F12+ CTTTGGATACACATCAATGCTTTTCCTCATCACATCAGAACTAACGCCTTTTGCAGGGAA
JMFF041B11+ CTTTGGATACACATCAATGCTTTTCCTCATCACATCAGAACTAACGCCTTTTGCAGGGAA
JMFF050G24+ CTTTGGATACACATCAATGCTTTTCCTCATCACATCAGAACTAACGCCTTTTGCAGGGAA
JMSF036D13+ CTTNGGATACACATCAATGCTTTTCCTCATCACATCAGAACTAACGCCTTTTGCAGGGAA
JMFF027L10+ TTTGGATACACATCAATGCTTTTCCTCATCACATCAGAACTAACGCCTTTTGCAGGGAA
                      ____________________________________________________________
consensus CTTTGGATACACATCAATGCTTTTCCTCATCACATCAGAACTAACGCCTTTTGCAGGGAA
 
. : . : . : . : . : . :
JMFF026J23+ CGAGAGACTCTGGGTCAGGCTTGTCGTCGTCCTTTTCGCACGAGCCATTCCAGCCGAGCC
JMFF021A19+ CGAGAGACTCTGGGTCAGGCTTGTCGTCGTCCTTTTCGCACGAGCCATTCCAGCCGAGCC
JMFS030F12+ CGAGAGACTCTGGGTCAGGCTTGTCGTCGTCCTTTTCGCACGAGCCATTCCAGCCGAGCC
JMFF041B11+ CGAGAGACTCTGGGTCAGGCTTGTCGTCGTCCTTTTCGCACGAGCCATTCCAGCCGAGCC
JMFF050G24+ CGAGAGACTCTGGGTCAGGCTTGTCGTCGTCCTTTTCGCACGAGCCATTCCAGCCGAGCC
JMSF036D13+ CGAGAGACTCTGGGTCAGGCTTGTCGTCGTCCTTTTCGCACGAGCCATTCCAGCCGAGCC
JMFF027L10+ CGAGAGACTCTGGGTCAGGCTTGTCGTCGTCCTTTTCGCACGAGCCATTCCAGCCGAGCC
                      ____________________________________________________________
consensus CGAGAGACTCTGGGTCAGGCTTGTCGTCGTCCTTTTCGCACGAGCCATTCCAGCCGAGCC
 
. : . : . : . : . : . :
JMFF026J23+ TCTCGAACTCGCCTGATCCTTCTTCGGTCTACTACCCTTCGAAGAAGCAGTAGTAGAAGA
JMSF011J13+ TCTACTACCCTTCGAAGAAGCAGTAGTAGAAGA
JMFF021A19+ TCTNGAACTCGCCTGATCCTTCTTCGGTCTACTACCCTTCGAAGAAGCAGTAGTAGAAGA
JMFS030F12+ TCTCGAACTCGCCTGATCCTTCTTCGGTCTACTACCCTTCGAAGAAGCAGTAGTAGAAGA
JMFF041B11+ TCTCGAACTCGCCTGATCCTTCTTCGGTCTACTACCCTTCGAAGAAGCAGTAGTAGAAGA
JMFF050G24+ TCTCGAACTCGCCTGATCCTTCTTCGGTCTACTACCCTTCGAAGAAGCAGTAGTAGAAGA
JMSF036D13+ TCTCGAACTCGCCTGATCCTTCTTCGGTCTACTACCCTTCGAAGAAGCAGTAGTAGAAGA
JMFF027L10+ TCTCGAACTCGCCTGATCCTTCTTCGGTCTACTACCCTTCGAAGAAGCAGTAGTAGAAGA
                      ____________________________________________________________
consensus TCTCGAACTCGCCTGATCCTTCTTCGGTCTACTACCCTTCGAAGAAGCAGTAGTAGAAGA
 
. : . : . : . : . : . :
JMFF026J23+ CACTTTACTTTTCGAAACATTCCTAGAGGATTCGGTTTTCGCTACAGATACTTTGGGTGC
JMSF011J13+ CACTTTACTTTTCGAAACATTCCTAGAGGATTCGGTTTTCGCTACAGATACTTTGGGTGC
JMFF021A19+ CACTTTACTTTTCGAAACATTCCTAGAGGATTCGGTTTTCGCTACAGATACTTTGGGTGC
JMFS030F12+ CACTTTACTTTTCGAAACATTCCTAGAGGATTCGGTTTTCGCTACAGATACTTTGGGTGC
JMFF041B11+ CACTTTACTTTTCGAAACATTCCTAGAGGATTCGGTTTTCGCTACAGATACTTTGGGTGC
JMFF050G24+ CACTTTACTTTTCGAAACATTCCTAGAGGATTCGGTTTTCGCTACAGATACTTTGGGTGC
JMSF036D13+ CACTTTACTTTTCGAAACATTCCTAGAGGATTCGGTTTTCGCTACAGATACTTTGGGTGC
JMFF027L10+ CACTTTACTTTTCGAAACATTCCTAGAGGATTCGGTTTTCGCTACAGATACTTTGGGTGC
                      ____________________________________________________________
consensus CACTTTACTTTTCGAAACATTCCTAGAGGATTCGGTTTTCGCTACAGATACTTTGGGTGC
 
. : . : . : . : . : . :
JMFF026J23+ TTCATTAACCACAATCTCATCCCCAACAACTTCACTTTCACTAGCTTTCTCACCCAGAAT
JMSF011J13+ TTCATTAACCACAATCTCATCCCCAACAACTTCACTTTCACTAGCTTTCTCACCCAGAAT
JMFF021A19+ TTCATTAACCACAATCTCATCCCCAACAACTTCACTTTCACTAGCTTTCTCACCCAGAAT
JMFS030F12+ TTCATTAACCACAATCTCATCCCCAACAACTTCACTTTCACTAGCTTTCTCACCCAGAAT
JMFF041B11+ TTCATTAACCACAATCTCATCCCCAACAACTTCACTTTCACTAGCTTTCTCACCCAGAAT
JMFF050G24+ TTCATTAACCACAATCTCATCCCCAACAACTTCACTTTCACTAGCTTTCTCACCCAGAAT
JMSF036D13+ TTCATTAACCACAATCTCATCCCCAACAACTTCACTTTCACTAGCTTTCTCACCCAGAAT
JMFF027L10+ TTCATTAACCACAATCTCATCCCCAACAACTTCACTTTCACTAGCTTTCTCACCCAGAAT
                      ____________________________________________________________
consensus TTCATTAACCACAATCTCATCCCCAACAACTTCACTTTCACTAGCTTTCTCACCCAGAAT
 
. : . : . : . : . : . :
JMFF026J23+ TCCCTCTTTCTCCTCCACACCCACATTTTCATTCTCAATAACAGGATCCATTTCCTCTTT
JMSF011J13+ TCCCTCTTTCTCCTCCACACCCACATTTTCATTCTCAATAACAGGATCCATTTCCTCTTT
JMSF006P02+ CTCCACACCCACANTTTCATTCTCAATAACAAGATCCATTTCCTCTTT
JMFF021A19+ TCCCTCTTTCTCCTCCACACCCACATTTTCATTCTCAATAACAGGATCCATTTCCTCTTT
JMFS030F12+ T-CCTCTTTCTCCTCCACACCCACATTTTCATTCTCAATAACAGGATCCATTTCCTCTTT
JMFF041B11+ TCCCTCTTTCTCCTCCACACCCACATTTTCATTCTCAATAACAGGATCCATTTCCTCTTT
JMFF050G24+ TCCCTCTTTCTCCTCCACACCCACATTTTCATTCTCAATAACAGGATCCATTTCCTCTTT
JMSF036D13+ TCCCTCTTTCTCCTCCACACCCACATTTTCATTCTCAATAACAGGATCCATTTCCTCTTT
JMFF027L10+ TCCCTCTTTCTCCTCCACACCCACATTTTCATTCTCAATAACAGGATCCATTTCCTCTTT
                      ____________________________________________________________
consensus TCCCTCTTTCTCCTCCACACCCACATTTTCATTCTCAATAACAGGATCCATTTCCTCTTT
 
. : . : . : . : . : . :
JMFF026J23+ CACCACAGCCATGATTTCTGAGACCATCTAGGACAATTATCTTGTGCGTAAGC
JMSF011J13+ CACCACAGCCATGATTTCTGAGGCCATCTAGGACAATTATCT
JMSF006P02+ CACCACAGCCATGATTTCTGAGGCCATCTAGGACAATTATCT
JMFF021A19+ CACCACAGCCATGATTTCTGAGGCCATCTAGGACAATTATCTTGTGCGTAAGCAAGAGTG
JMFS030F12+ CACCACAGCCATGATTTCTGAGGCCATCTAGGACAATTATCT
JMFF041B11+ CACCACAGCCATGATTTCTGAGGCCATCTAGGACAATTATCTTGTGCGTAAGCAAGAGTG
JMFF050G24+ CACCACAGCCATGATTTCTGAGGCCATCTAGGACAATTATCTTGTGCGTAAGCAAGAGTG
JMSF036D13+ CACCACAGCCATGATTTCTGAGGCCATCTAGGACAATTATCTTGTGCGTAAGCAAGAGTG
JMFF027L10+ CACCACAGCCATGATTTCTGAGGCCATCTAGGACAATTATCTTGTGCGTAAGCAAGAGTG
                      ____________________________________________________________
consensus CACCACAGCCATGATTTCTGAGGCCATCTAGGACAATTATCTTGTGCGTAAGCAAGAGTG
 
. : . : . : . : . : . :
JMFF021A19+ AGAATTACTATGGCTTCGGAATTTC
JMFF041B11+ AGAATTACTATGGCTTCGGAATTTCAAATTCT
JMFF050G24+ AGAATTACTATGGCTTCGGAATTTCAAATTCTACTTTGCAATGAAAAGTCGGTTAGATAT
JMSF036D13+ AGAATTACTATGGCTTCGGAATTTCAAATTCTACTTTGCAATGAAAAGTCGGTTAGATAT
JMFF027L10+ AGAATTACTATGGCTTCGGAATTTCAAATTCTACTTTGCAATGAAAAGTCGGTTAGATAT
                      ____________________________________________________________
consensus AGAATTACTATGGCTTCGGAATTTCAAATTCTACTTTGCAATGAAAAGTCGGTTAGATAT
 
. : . : . : . : . : . :
JMFF050G24+ ACTGAAACCAGGGGGGGAAGAGAGTAAGAGAGACGGTTCGAC
JMSF036D13+ ACTGAAACCAGGGGGGGAAGAGAGTAAGAGAGACGGTTCGAC
JMFF027L10+ ACTGAAACCAGGGGGGGAAGAGAGTAAGAGAGACGGTTCGACGAAGAATGTTAAAACAAC
                      ____________________________________________________________
consensus ACTGAAACCAGGGGGGGAAGAGAGTAAGAGAGACGGTTCGACGAAGAATGTTAAAACAAC