Previous Contig 001297:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006M10Sequence568001297 (4)gb:HAN242915_16814423e-13Helianthus annuus mRNA for Acyl-ACP thioesterase (fatB gene), strain CAS-5.822008460 (2)gb:AF213479_17777021e-48Iris tectorum acyl-ACP thioesterase (FatB1) mRNA, complete cds.
JMFF027K15Sequence571001297 (4)pir|T12583|T125839e-14oleoyl-[acyl-carrier-protein] hydrolase (EC 3.1.2.14) - common sunflower>gb:AF03717001297 (4)pir|T12583|T125831e-81oleoyl-[acyl-carrier-protein] hydrolase (EC 3.1.2.14) - common sunflower>gb:AF03
JMFF030E23Sequence518001297 (4)pir|T12583|T125835e-18oleoyl-[acyl-carrier-protein] hydrolase (EC 3.1.2.14) - common sunflower>gb:AF03701008460 (2)gb:AF213479_17777021e-48Iris tectorum acyl-ACP thioesterase (FatB1) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF027K15- TTCAGTGCAAGA
                      ____________________________________________________________
consensus TTCAGTGCAAGA
 
. : . : . : . : . : . :
rJMFF027K15- GATATGTATGGTTCATTCGGTATTTGGGTATAGGCATAGAACTGCTAATATCTATAAAGG
                      ____________________________________________________________
consensus GATATGTATGGTTCATTCGGTATTTGGGTATAGGCATAGAACTGCTAATATCTATAAAGG
 
. : . : . : . : . : . :
rJMFF027K15- ACAAAAAGATCTTCTGGATGCTTATACCTGGAAGCTCTCATTAAAGTGTCCCCAGTATAA
                      ____________________________________________________________
consensus ACAAAAAGATCTTCTGGATGCTTATACCTGGAAGCTCTCATTAAAGTGTCCCCAGTATAA
 
. : . : . : . : . : . :
rJMFF027K15- AAATCACGGAGAAGCCAATCACGTCGCATACCATTCTTTCCTGATGCAGCTACCCACGTA
                      ____________________________________________________________
consensus AAATCACGGAGAAGCCAATCACGTCGCATACCATTCTTTCCTGATGCAGCTACCCACGTA
 
. : . : . : . : . : . :
rJMFF027K15- TCTACTTCAACAAGATCACCCCAAGCAGGGTAACGATCCACAATAACCTGCATTTTACTG
                      ____________________________________________________________
consensus TCTACTTCAACAAGATCACCCCAAGCAGGGTAACGATCCACAATAACCTGCATTTTACTG
 
. : . : . : . : . : . :
rJMFF027K15- ACTACCCAAATCAAATTTTTCTTGCACATTTCCTGAGTTGAGCCAAACCCGTCACCCATG
                      ____________________________________________________________
consensus ACTACCCAAATCAAATTTTTCTTGCACATTTCCTGAGTTGAGCCAAACCCGTCACCCATG
 
. : . : . : . : . : . :
rJMFF027K15- ATTCCCACCGTCTTCACATGGTTCAGCGCAGTTTCCTGTAAATGATTCATCATTGTTTCT
                      ____________________________________________________________
consensus ATTCCCACCGTCTTCACATGGTTCAGCGCAGTTTCCTGTAAATGATTCATCATTGTTTCT
 
. : . : . : . : . : . :
rJMFF027K15- ATTGATGCAGTTCTATCAGCTCCTATTTCATAAGACCTGATACTAAAATTTTGACGAAAA
                      ____________________________________________________________
consensus ATTGATGCAGTTCTATCAGCTCCTATTTCATAAGACCTGATACTAAAATTTTGACGAAAA
 
. : . : . : . : . : . :
rJMFF027K15- ACAAAACTATCTTCAACAATTCTTCCCAAACCAAATGGATCAATGAGCATGTCAGGGCGC
                      ____________________________________________________________
consensus ACAAAACTATCTTCAACAATTCTTCCCAAACCAAATGGATCAATGAGCATGTCAGGGCGC
 
. : . : . : . : . : . :
rJMFF027K15- TTCGGCTTCCAATCTAGCATCATCCACTGCTTCTCAGCGGCCAAGAAAATAGTTGTTATG
                      ____________________________________________________________
consensus TTCGGCTTCCAATCTAGCATCATCCACTGCTTCTCAGCGGCCAAGAAAATAGTTGTTATG
 
. : . : . : . : . : . :
rJMFF027K15- GCTGCAAGAAGCATGCTCCAATCCGGCAGCTGATTGATAAATGTCTTTGAGGGATGTGAA
JMFF006M10+ TGATTGATAAATGTCTTTGAGGGATGTGAA
JMFF027K15+ TGATTGATAAATGTCTTTGAGGGATGTGAA
                      ____________________________________________________________
consensus GCTGCAAGAAGCATGCTCCAATCCGGCAGCTGATTGATAAATGTCTTTGAGGGATGTGAA
 
. : . : . : . : . : . :
rJMFF027K15- GTGGTCACCTCATCATCAGTCTTGAAGCCATCCATCACAGTTGTCACAGTTCCATTTACC
JMFF006M10+ GTGGTCACCTCATCATCAGTCTTGAAGCCATCCATCACAGTTGTCACAGTTCCATTTACC
JMFF027K15+ GTGGTCACCTCATCATCAGTCTTGAAGCCATCCATCACAGTTGTCACAGTTCCATTTACC
                      ____________________________________________________________
consensus GTGGTCACCTCATCATCAGTCTTGAAGCCATCCATCACAGTTGTCACAGTTCCATTTACC
 
. : . : . : . : . : . :
rJMFF027K15- TTTGGAGGCGCTTGTGCACTGGCCTTAACTTGCAAATTTCTAGCA
JMFF006M10+ TTTGGAGGCGCTTGTGCACTGGCCTTAACTTGCAAATTTCTAGCAGTGGAGGATTTCAAC
JMFF027K15+ TTTGGAGGCGCTTGTGCACTGGCCTTAACTTGCAAATTTCTAGCAGTGGAGGATTTCAAC
                      ____________________________________________________________
consensus TTTGGAGGCGCTTGTGCACTGGCCTTAACTTGCAAATTTCTAGCAGTGGAGGATTTCAAC
 
. : . : . : . : . : . :
JMFF006M10+ TTAATGCCTTGTGCGTCTATGCTTGCAGGTGCACTTCCTCCAAACTTTGCAGATGTTTTG
JMFF027K15+ TTAATGCCTTGTGCGTCTATGCTTGCAGGTGCACTTCCTCCAAACTTTGCAGATGTTTTG
                      ____________________________________________________________
consensus TTAATGCCTTGTGCGTCTATGCTTGCAGGTGCACTTCCTCCAAACTTTGCAGATGTTTTG
 
. : . : . : . : . : . :
JMFF006M10+ GCACCAGATTCAGGGGGCACATGATGACCAAGGAAAAAAGCAGCAGTGGCAACCATGATG
JMFF027K15+ GCACCAGATTCAGGGGGCACATGATGACCAAGGAAAAAAGCAGCAGTGGCAACCATGATG
                      ____________________________________________________________
consensus GCACCAGATTCAGGGGGCACATGATGACCAAGGAAAAAAGCAGCAGTGGCAACCATGATG
 
. : . : . : . : . : . :
JMFF030E23+ CTTGAAGCATACGTGAGTGGAGTGAGTTAATATTGAGGA
JMFF006M10+ AAGTTATTATACCTCACTAGTCTTGAAGCATACGTGAGTGGAGTGAGTTAATATTGAGGA
JMFF027K15+ AAGTTATTATACCTCACTAGTCTTGAAGCATACGTGAGTGGAGTGAGTTAATATTGAGGA
                      ____________________________________________________________
consensus AAGTTATTATACCTCACTAGTCTTGAAGCATACGTGAGTGGAGTGAGTTAATATTGAGGA
 
. : . : . : . : . : . :
JMFF030E23+ TGAATGCGTGGAAATGTACGAAAACAGAGAGTTCAATTCCTGATCAGCAACCCATATTTC
JMFF006M10+ TGAATGCGTGGAAATGTACGAAAACAGAGAGTTCAATTCCTGATCAGCAACCCATATTTC
JMFF027K15+ TGAATGAGTGGAAATGTACGAAAACAGAGAGTTCAATTCCTGATCAGCAACCCATATTTC
                      ____________________________________________________________
consensus TGAATGCGTGGAAATGTACGAAAACAGAGAGTTCAATTCCTGATCAGCAACCCATATTTC
 
. : . : . : . : . : . :
JMFF030E23+ GAGAAGATTTCTTAGGGTTTGCAATCTTTTTTTCTTTTTTCTTCTTTATTATGAAATATG
JMFF006M10+ GAGAAGATTTCTTAGGGTTTGCAATCTTTTTTTCTTTTTTCTTCTTTATTATGAAATATG
JMFF027K15+ GAGAAGATTTCTTAGGGTTTGCAATCTTTTTTTCTTTTTTCTTCTTTATTATGAAATATG
                      ____________________________________________________________
consensus GAGAAGATTTCTTAGGGTTTGCAATCTTTTTTTCTTTTTTCTTCTTTATTATGAAATATG
 
. : . : . : . : . : . :
JMFF030E23+ ATGATGATATTCTTGTATTCTTCGTTTTCTTAGACTTTTTGAAATAGCTGAGAAAAACTT
JMFF006M10+ ATGATGATATTCTTGTATTCTTCGTTTTCTTAGACTTTTTGAAATAGCTGAGAAAAACTT
JMFF027K15+ ATGATGATATTCTTGTATTCTTCGTTTTCTTAGACTTTTTGAAATAGCTGAGAAAAACTT
                      ____________________________________________________________
consensus ATGATGATATTCTTGTATTCTTCGTTTTCTTAGACTTTTTGAAATAGCTGAGAAAAACTT
 
. : . : . : . : . : . :
JMFF030E23+ TGGCTCGGACTCTCGGAGAGAGAGAGAGAGAGAGAAGAAACAGCGGCTTTTTGAT
JMFF006M10+ TGGCTCGGACTCTCGGAGAGAGAGAGAGAGAGAGAAGAAACAGCGGCTTTTTGAT
JMFF027K15+ TGGCTCGGACTCTCGGAGAGAGAGAGAGAGAGAGAAGAAACAGCGGCTTTTTGATGATAG
                      ____________________________________________________________
consensus TGGCTCGGACTCTCGGAGAGAGAGAGAGAGAGAGAAGAAACAGCGGCTTTTTGATGATAG