Previous Contig 001291:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF027J11Sequence501001291 (2)gb:AC107224_17383862e-79Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0009C08, complet736009507 (2)gb:AJ586807_1811846e-111Setaria viridis tub2 gene for beta tubulin, exons 1-3.
JMFF040G24Sequence533001291 (2)gb:AC107224_17383863e-76Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0009C08, complet692009507 (2)gb:AJ586807_1811846e-104Setaria viridis tub2 gene for beta tubulin, exons 1-3.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF040G24+ TTGAAATCAGAAGGGTCCCCATTCCGGATCCAGTTCCTCCACCCAACGAATGG
                      ____________________________________________________________
consensus TTGAAATCAGAAGGGTCCCCATTCCGGATCCAGTTCCTCCACCCAACGAATGG
 
. : . : . : . : . : . :
JMFF040G24+ CAGACCTGAAACCCTTGCAGACAATCGCAATTTTCCGCTTCCTTGCGAACAACATCCAGA
JMFF027J11+ AACCCTTGCAGACAATCGCAATTTTCCGCTTCCTTGCGAACAACATCCAGA
                      ____________________________________________________________
consensus CAGACCTGAAACCCTTGCAGACAATCGCAATTTTCCGCTTCCTTGCGAACAACATCCAGA
 
. : . : . : . : . : . :
JMFF040G24+ ACGGAATCAATCAGCTCAGCTCCCTCCGTGTAATGCCCCTTAGCCCAGTTGTTACCGGCG
JMFF027J11+ ACGGAATCAATCAGCTCAGCTCCCTCCGTGTAATGCCCCTTAGCCCAGTTGTTACCGGCG
                      ____________________________________________________________
consensus ACGGAATCAATCAGCTCAGCTCCCTCCGTGTAATGCCCCTTAGCCCAGTTGTTACCGGCG
 
. : . : . : . : . : . :
JMFF040G24+ CCGTTCTGTCCGAACACGAAGTTATCGGGCCGGAAAATCTGGCCGTAGGGCCCAGATCTC
JMFF027J11+ CCGTTCTGTCCGAACACGAAGTTATCGGGCCGGAAAATCTGGCCGTAGGGCCCAGATCTC
                      ____________________________________________________________
consensus CCGTTCTGTCCGAACACGAAGTTATCGGGCCGGAAAATCTGGCCGTAGGGCCCAGATCTC
 
. : . : . : . : . : . :
JMFF040G24+ ACGCTGTCCATGGTACCCGGTTCCAGATCCATGAGAACAGCCCGAGGCACATACCGCCCA
JMFF027J11+ ACGCTGTCCATGGTACCCGGTTCCAGATCCATGAGAACAGCCCGAGGCACATACCGCCCA
                      ____________________________________________________________
consensus ACGCTGTCCATGGTACCCGGTTCCAGATCCATGAGAACAGCCCGAGGCACATACCGCCCA
 
. : . : . : . : . : . :
JMFF040G24+ CAGCTAGCCTCGTTGTAATACACATTGACGCGCTCCAGTTGCAGATCCGAATCCCCGTCG
JMFF027J11+ CAGCTAGCCTCGTTGTAATACACATTGACGCGCTCCAGTTGCAGATCCGAATCCCCGTCG
                      ____________________________________________________________
consensus CAGCTAGCCTCGTTGTAATACACATTGACGCGCTCCAGTTGCAGATCCGAATCCCCGTCG
 
. : . : . : . : . : . :
JMFF040G24+ AAGCGTCCGGTGGCGTCGATGCCGTGCTCCGCGCACACCACCTCCCAGAACTTGGACCCG
JMFF027J11+ AAGCGTCCGGTGGCGTCGATGCCGTGCTCCGCGCACACCACCTCCCAGAACTTGGACCCG
                      ____________________________________________________________
consensus AAGCGTCCGGTGGCGTCGATGCCGTGCTCCGCGCACACCACCTCCCAGAACTTGGACCCG
 
. : . : . : . : . : . :
JMFF040G24+ ATCTGGTTGCCGCATTGGCCACCTTGAATGTGAAGAATCTCACGCAT
JMFF027J11+ ATCTGGTTGCCGCATTGGCCACCTTGAATGTGAAGAATCTCACGCATTTTCAGAGGAAGA
                      ____________________________________________________________
consensus ATCTGGTTGCCGCATTGGCCACCTTGAATGTGAAGAATCTCACGCATTTTCAGAGGAAGA
 
. : . : . : . : . : . :
JMFF027J11+ AAAAGGGAACGAGAGATTCTTCGAGAGAGATGGAGGGGCGAAAATGGAGAGCTGTCCGGG
                      ____________________________________________________________
consensus AAAAGGGAACGAGAGATTCTTCGAGAGAGATGGAGGGGCGAAAATGGAGAGCTGTCCGGG