Previous Contig 001288:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF021L20Sequence565001288 (3)pir|G86272|G862721e-11hypothetical protein F7A19.5 [imported] - Arabidopsis thaliana>gb:AE005172_89038746009228 (3)pir|JC6203|JC62031e-35SP8 binding protein homolog - cucumber>gb:CUSSLDB_1674352 Cucumis sativus SPF1-l
JMFF027G22Sequence534001288 (3)gb:AC068197_15403565e-07Genomic sequence for Arabidopsis thaliana BAC F16A14 from chromosome I, complete723009228 (3)pir|JC6203|JC62035e-38SP8 binding protein homolog - cucumber>gb:CUSSLDB_1674352 Cucumis sativus SPF1-l
JMSF031E16Sequence677001288 (3)pir|G86272|G862722e-11hypothetical protein F7A19.5 [imported] - Arabidopsis thaliana>gb:AE005172_89038741009228 (3)pir|JC6203|JC62031e-40SP8 binding protein homolog - cucumber>gb:CUSSLDB_1674352 Cucumis sativus SPF1-l

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF031E16+ ATTGCGAGACCTCTACTGGCTCACTCTTCAAACTCTCCGGGTCCAAC
                      ____________________________________________________________
consensus ATTGCGAGACCTCTACTGGCTCACTCTTCAAACTCTCCGGGTCCAAC
 
. : . : . : . : . : . :
JMSF031E16+ ATGTCATAAACNTGAAGTTGGAACGAATCATTTGGCATCAAATCATGCTCAAACGCATCT
                      ____________________________________________________________
consensus ATGTCATAAACNTGAAGTTGGAACGAATCATTTGGCATCAAATCATGCTCAAACGCATCT
 
. : . : . : . : . : . :
JMFF021L20+ GTGAGGATTGTTGCTGATATTCGGTTTGCATTTGCCTGTAAGACTGGTTTATCGCT
JMSF031E16+ CCAGGTGAGGATTGTTGCTGATATTCGGTTTGCATTTGCCTGTAAGACTGGTTTATCGCT
                      ____________________________________________________________
consensus CCAGGTGAGGATTGTTGCTGATATTCGGTTTGCATTTGCCTGTAAGACTGGTTTATCGCT
 
. : . : . : . : . : . :
JMFF021L20+ GCCTGAGCTGTAACATGCGCCAGTGCTTGTTGGTGAGACATCCCAAAAGGGCTCTGAATC
JMSF031E16+ GCCTGAGCTGTAACATGCGCCAGTGCTTGTTGGTGAGACATCCCAAAAGGGCTCTGAATC
                      ____________________________________________________________
consensus GCCTGAGCTGTAACATGCGCCAGTGCTTGTTGGTGAGACATCCCAAAAGGGCTCTGAATC
 
. : . : . : . : . : . :
JMFF021L20+ GGAGAGAGGAACCCAGGTGAATTGAGCAACCCGGAAGGACTTAACCCCGGCGGGACAACT
JMSF031E16+ GGAGAGAGGAACCCAGGTGAATTGAGCAACCCGGAAGGACTTAACCCCGGCGGGACAACT
                      ____________________________________________________________
consensus GGAGAGAGGAACCCAGGTGAATTGAGCAACCCGGAAGGACTTAACCCCGGCGGGACAACT
 
. : . : . : . : . : . :
JMFF021L20+ AACAACGGCGAAAGAGCAGCCGCCGCCAAGCTCACCGGCCGATTCTGCTTATACCCGGAT
JMSF031E16+ AACAACGGCGAAAGAGCAGCCGCCGCCAAGCTCACCGGCCGATTCTGCTTATACCCGGAT
                      ____________________________________________________________
consensus AACAACGGCGAAAGAGCAGCCGCCGCCAAGCTCACCGGCCGATTCTGCTTATACCCGGAT
 
. : . : . : . : . : . :
JMFF021L20+ TGTTTCTCACTCCCCTTCTTCGATGAGCTATCCTCCAAAAGACAGGGTTTCGCGAGCGGG
JMSF031E16+ TGTTTCTCACTCCCCTTCTTCGATGAGCTATCCTCCAAAAGACAGGGTTTCGCGAGCGGG
JMFF027G22+ GCGAGCGGG
                      ____________________________________________________________
consensus TGTTTCTCACTCCCCTTCTTCGATGAGCTATCCTCCAAAAGACAGGGTTTCGCGAGCGGG
 
. : . : . : . : . : . :
JMFF021L20+ GAAGCCATGGCTCCGGCCAGCAGCTGGGAGAAAGAGCAGGCATCGGAGTCGGCGAAGAAG
JMSF031E16+ GAAGCCATGGCTCCGGCCAGCAGCTGGGAGAAAGAGCAGGCATCGGAGTCGGCGAAGAAG
JMFF027G22+ GAAGCCATGGCTCCGGCCAGCAGCTGGGAGAAAGAGCAGGCATCGGAGTCGGCGAAGAAG
                      ____________________________________________________________
consensus GAAGCCATGGCTCCGGCCAGCAGCTGGGAGAAAGAGCAGGCATCGGAGTCGGCGAAGAAG
 
. : . : . : . : . : . :
JMFF021L20+ CTGGACACAAGGGTCATAGGACCCGGGCTGAAACCGGGTATGAACCC
JMSF031E16+ CTGGACACAAGGGTCATAGGACCCGGGCTGAAACCGGGTATGAACCC
JMFF027G22+ CTGGACACAAGGGTCATAGGACCCGGGCTGAAACCGGGTATGAACCCATCGTTGAAGAAG
                      ____________________________________________________________
consensus CTGGACACAAGGGTCATAGGACCCGGGCTGAAACCGGGTATGAACCCATCGTTGAAGAAG
 
. : . : . : . : . : . :
JMFF027G22+ CTCTCCAATGGCGGCCGGGGTGCAATTGCAAGCGTAGTAGGGCGCGAAGGCCCAGCAATG
                      ____________________________________________________________
consensus CTCTCCAATGGCGGCCGGGGTGCAATTGCAAGCGTAGTAGGGCGCGAAGGCCCAGCAATG
 
. : . : . : . : . : . :
JMFF027G22+ GTTGAACCTCTCTCTCTGATTTCGCTCATTCCAGAAACATAAAACTCTTTCTTCTTCTTC
                      ____________________________________________________________
consensus GTTGAACCTCTCTCTCTGATTTCGCTCATTCCAGAAACATAAAACTCTTTCTTCTTCTTC
 
. : . : . : . : . : . :
JMFF027G22+ GGAGTTTCTGCTACTAATGATCCTATCCTATCCTCCTACTTCTTCTTCTTCTTCTCTTAT
                      ____________________________________________________________
consensus GGAGTTTCTGCTACTAATGATCCTATCCTATCCTCCTACTTCTTCTTCTTCTTCTCTTAT
 
. : . : . : . : . : . :
JMFF027G22+ AGAAACTTCAGTTCATTAATGGAGTACCCTCCCATGGAGTGCTGGTACCGTATACACCCA
                      ____________________________________________________________
consensus AGAAACTTCAGTTCATTAATGGAGTACCCTCCCATGGAGTGCTGGTACCGTATACACCCA
 
. : . : . : . : . : . :
JMFF027G22+ CACCCACTTGTCGACTTCACTTCACACTTGCATTTTTCTTATGTGATGTTATTGTCATCT
                      ____________________________________________________________
consensus CACCCACTTGTCGACTTCACTTCACACTTGCATTTTTCTTATGTGATGTTATTGTCATCT