Previous Contig 001282:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF027D20Sequence513001282 (2)gb:AP005192_18491702e-78Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P048717021269sp|Q9ZPN9|TBB2_ELEIN1e-85Tubulin beta-2 chain (Beta-2 tubulin).>gb:AF059288_1764903 Eleusine indica beta-
JMSF041K08Sequence763001282 (2)gb:AP005192_1849170e-121Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P048710023954sp|Q9ZPN9|TBB2_ELEIN8e-78Tubulin beta-2 chain (Beta-2 tubulin).>gb:AF059288_1764903 Eleusine indica beta-

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF041K08+ TGGTTGAGATCACCAAAGGTAGGAGTTGAAAGCTTGAGAGTACGGAAGCAGATGTCA
                      ____________________________________________________________
consensus TGGTTGAGATCACCAAAGGTAGGAGTTGAAAGCTTGAGAGTACGGAAGCAGATGTCA
 
. : . : . : . : . : . :
JMSF041K08+ TAAAGAGCCTCATTATCCAGAACCATACACTCATCTGCATTCTCTACTAGTTGATGAACA
                      ____________________________________________________________
consensus TAAAGAGCCTCATTATCCAGAACCATACACTCATCTGCATTCTCTACTAGTTGATGAACA
 
. : . : . : . : . : . :
JMSF041K08+ GAAAGGGTAGCATTATATGGCTCAACAACTGTATCAGATACTTTCGGTGAAGGGAAGACA
                      ____________________________________________________________
consensus GAAAGGGTAGCATTATATGGCTCAACAACTGTATCAGATACTTTCGGTGAAGGGAAGACA
 
. : . : . : . : . : . :
JMSF041K08+ GAGAATGTCAACATCATACGATCTGGATACTCCTCCCTGATCTTGGAAATGAGAAGGGTG
                      ____________________________________________________________
consensus GAGAATGTCAACATCATACGATCTGGATACTCCTCCCTGATCTTGGAAATGAGAAGGGTG
 
. : . : . : . : . : . :
JMSF041K08+ CCCATACCAGATCCCGTGCCTCCACCTAAAGAATGGCAAACTTGGAAACCTTGTATACAA
JMFF027D20+ ACAA
                      ____________________________________________________________
consensus CCCATACCAGATCCCGTGCCTCCACCTAAAGAATGGCAAACTTGGAAACCTTGTATACAA
 
. : . : . : . : . : . :
JMSF041K08+ TCGCAGTTCTCAGCTTCCTTGCGGACGACATCGAGGACTGAATCAATGAGCTCTGCGCCC
JMFF027D20+ TCGCAGTTCTCAGCTTCCTTGCGGACGACATCGAGGACTGAATCAATGAGCTCTGCGCCC
                      ____________________________________________________________
consensus TCGCAGTTCTCAGCTTCCTTGCGGACGACATCGAGGACTGAATCAATGAGCTCTGCGCCC
 
. : . : . : . : . : . :
JMSF041K08+ TCGGTGTAATGGCCCTTGGCCCAGTTGTTCCCCGCGCCAGACTGACCAAAGACGAAGTTA
JMFF027D20+ TCGGTGTAATGGCCCTTGGCCCAGTTGTTCCCCGCGCCAGACTGACCAAAGACGAAGTTA
                      ____________________________________________________________
consensus TCGGTGTAATGGCCCTTGGCCCAGTTGTTCCCCGCGCCAGACTGACCAAAGACGAAGTTA
 
. : . : . : . : . : . :
JMSF041K08+ TCGGGGCGGAAGATCTGGCCAAAGGGGCCTGATCTGACGGAATCCATGGTACCAGGCTCG
JMFF027D20+ TCGGGGCGGAAGATCTGGCCAAAGGGGCCTGATCTGACGGAATCCATGGTACCAGGCTCG
                      ____________________________________________________________
consensus TCGGGGCGGAAGATCTGGCCAAAGGGGCCTGATCTGACGGAATCCATGGTACCAGGCTCG
 
. : . : . : . : . : . :
JMSF041K08+ AGGTCCATGAGGACGGCACGGGGAACGTATCGGCCGCCGCTGGCCTCATTGTAGTAGACG
JMFF027D20+ AGGTCCATGAGGACGGCACGGGGAACGTATCGGCCGCCGCTGGCCTCATTGTAGTAGACG
                      ____________________________________________________________
consensus AGGTCCATGAGGACGGCACGGGGAACGTATCGGCCGCCGCTGGCCTCATTGTAGTAGACG
 
. : . : . : . : . : . :
JMSF041K08+ TTGATGCGCTCGAGCTGGAGATCGGAGTCACCGCTGTACCTGCCGGTGTGGTCGATGCCG
JMFF027D20+ TTGATGCGCTCGAGCTGGAGATCGGAGTCACCGCTGTACCTGCCGGTGTGGTCGATGCCG
                      ____________________________________________________________
consensus TTGATGCGCTCGAGCTGGAGATCGGAGTCACCGCTGTACCTGCCGGTGTGGTCGATGCCG
 
. : . : . : . : . : . :
JMSF041K08+ TGCTCGTCGCAAATCACCTCCCAGAACTTGGCTCCGATCTGGTTACCGCATTGACCTCCC
JMFF027D20+ TGCTCGTCGCAAATCACCTCCCAGAACTTGGCTCCGATCTGGTTACCGCATTGACCTCCC
                      ____________________________________________________________
consensus TGCTCGTCGCAAATCACCTCCCAGAACTTGGCTCCGATCTGGTTACCGCATTGACCTCCC
 
. : . : . : . : . : . :
JMSF041K08+ TGAATGTG
JMFF027D20+ TGAATGTGAAGAATTTCTCTCATCTTACCTCGCTTTTCTCCTCAAAATCCGATCGCAACA
                      ____________________________________________________________
consensus TGAATGTGAAGAATTTCTCTCATCTTACCTCGCTTTTCTCCTCAAAATCCGATCGCAACA
 
. : . : . : . : . : . :
JMFF027D20+ GGTCAGACGATTCTCTCTCACTCCTTTCTCTCGGTCTGCTCCCAATTCCTTCTCTCTCTT
                      ____________________________________________________________
consensus GGTCAGACGATTCTCTCTCACTCCTTTCTCTCGGTCTGCTCCCAATTCCTTCTCTCTCTT