Previous Contig 001278:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF027B19Sequence557001278 (3)pir|T46895|T468955e-64acyl-CoA dehydrogenase (EC 1.3.99.3) [validated] - Arabidopsis thaliana>gb:AB017593012008 (2)pir|T46895|T468951e-71acyl-CoA dehydrogenase (EC 1.3.99.3) [validated] - Arabidopsis thaliana>gb:AB017
JMFN009M14Sequence618001278 (3)pir|T46895|T468958e-96acyl-CoA dehydrogenase (EC 1.3.99.3) [validated] - Arabidopsis thaliana>gb:AB017
JMSF018D18Sequence532001278 (3)pir|T46895|T468958e-61acyl-CoA dehydrogenase (EC 1.3.99.3) [validated] - Arabidopsis thaliana>gb:AB017785012008 (2)pir|T46895|T468953e-98acyl-CoA dehydrogenase (EC 1.3.99.3) [validated] - Arabidopsis thaliana>gb:AB017

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN009M14+ TCTTTACTATGAATCC
                      ____________________________________________________________
consensus TCTTTACTATGAATCC
 
. : . : . : . : . : . :
JMFN009M14+ ATTTATCTGGTTTGTACTGGCATTTCTAGCAAAAATGACAAGTATATCTGCAAAAGTACT
                      ____________________________________________________________
consensus ATTTATCTGGTTTGTACTGGCATTTCTAGCAAAAATGACAAGTATATCTGCAAAAGTACT
 
. : . : . : . : . : . :
JMFN009M14+ GTTTCCAATCCACCGTTTTTGGCCTTCAATGATCCAACCTCCTTCAACCTTTGTTGCAAT
                      ____________________________________________________________
consensus GTTTCCAATCCACCGTTTTTGGCCTTCAATGATCCAACCTCCTTCAACCTTTGTTGCAAT
 
. : . : . : . : . : . :
JMFN009M14+ TGTTTTCAATGAACTTGCATCACTCCCATACTCCGGTTCTGTAAGACCCCAACAACCAAT
                      ____________________________________________________________
consensus TGTTTTCAATGAACTTGCATCACTCCCATACTCCGGTTCTGTAAGACCCCAACAACCAAT
 
. : . : . : . : . : . :
JMFN009M14+ AGTGTCAAGCTTGGCCAATGATGGTAAATACTTTTGCTTTTGTATCTCTGACCCACAAAG
JMFF027B19+ ATCTCTGACCCACAAAG
                      ____________________________________________________________
consensus AGTGTCAAGCTTGGCCAATGATGGTAAATACTTTTGCTTTTGTATCTCTGACCCACAAAG
 
. : . : . : . : . : . :
JMFN009M14+ TCCAATGGTTAGCATAGCTAATGAAGAATGAACCAGAATGAAAGTTGAGCAGCTGGCATC
JMSF018D18+ AATGGTTAGCATAGCTAATGAAGAATGAACCAGAATGAAAGTTGAGCAGCTGGCATC
JMFF027B19+ TCCAATGGTTAGCATAGCTAATGAAGAATGAACCAGAATGAAAGTTGAGCAGCTGGCATC
                      ____________________________________________________________
consensus TCCAATGGTTAGCATAGCTAATGAAGAATGAACCAGAATGAAAGTTGAGCAGCTGGCATC
 
. : . : . : . : . : . :
JMFN009M14+ AACTCTAGAAACTTCTGCCGTAGCAATGGCACTTGCAGTCACAGAGAGTCCAGGACAGCC
JMSF018D18+ AACTCTAGAAACTTCTGCCGTAGCAATGGCACTTGCAGTCACAGAGAGTCCAGGACAGCC
JMFF027B19+ AACTCTAGAAACTTCTGCCGTAGCAATGGCACTTGCAGTCACAGAGAGTCCAGGACAGCC
                      ____________________________________________________________
consensus AACTCTAGAAACTTCTGCCGTAGCAATGGCACTTGCAGTCACAGAGAGTCCAGGACAGCC
 
. : . : . : . : . : . :
JMFN009M14+ ATACCCCTTGATGGTGCCACCAGCAACTCCTAAAGCACCAAGTTTTGGAATCACTTCAAA
JMSF018D18+ ATACCCCTTGATGGTGCCACCAGCAACTCCTAAAGCACCAAGTTTTGGAATCACTTCAAA
JMFF027B19+ ATACCCCTTGATGGTGCCACCAGCAACTCCTAAAGCACCAAGTTTTGGAATCACTTCAAA
                      ____________________________________________________________
consensus ATACCCCTTGATGGTGCCACCAGCAACTCCTAAAGCACCAAGTTTTGGAATCACTTCAAA
 
. : . : . : . : . : . :
JMFN009M14+ TGGAAACTCAGCCTTTTCCCAATACTTTGCCATTAAAGGTGCTACATCTCTTTCCATGCA
JMSF018D18+ TGGAAACTCAGCCTTTTCCCAATACTTTGCCATTAAAGGTGCTACATCTCTTTCCATGCA
JMFF027B19+ TGGAAACTCAGCCTTTTCCCAATACTTTGCCATTAAAGGTGCTACATCTCTTTCCATGCA
                      ____________________________________________________________
consensus TGGAAACTCAGCCTTTTCCCAATACTTTGCCATTAAAGGTGCTACATCTCTTTCCATGCA
 
. : . : . : . : . : . :
JMFN009M14+ TTCTCTCACTCTCATTCTGACACTTTGCTCAGCGGGAGTGAGTAGATCATCAAACTGATA
JMSF018D18+ TTCTCTCACTCTCATTCTGACACTTTGCTCAGCGGGAGTGAGTAGATCATCAAACTGATA
JMFF027B19+ TTCTCTCACTCTCATTCTGACACTTTGCTCAGCGGGAGTGAGTAGATCATCAAACTGATA
                      ____________________________________________________________
consensus TTCTCTCACTCTCATTCTGACACTTTGCTCAGCGGGAGTGAGTAGATCATCAAACTGATA
 
. : . : . : . : . : . :
JMFN009M14+ ATAGTCAGATGTGCACGGAGGAAACTTTGAAGCTGGAGTTGCTTGGGGAAATGCAACAGA
JMSF018D18+ ATAGTCAGATGTGCACGGAGGAAACTTTGAAGCTGGAGTTGCTTGGGGAAATGCAACAGA
JMFF027B19+ ATAGTCAGATGTGCACGGAGGAAACTTTGAAGCTGGAGTTGCTTGGGGAAATGCAACAGA
                      ____________________________________________________________
consensus ATAGTCAGATGTGCACGGAGGAAACTTTGAAGCTGGAGTTGCTTGGGGAAATGCAACAGA
 
. : . : . : . : . : . :
JMFN009M14+ AA
JMSF018D18+ AACATCCAAAGCAGGTAAATCAAAATACGAGCTTTTTGCATCCTTGTGCTTTTGCTCTTG
JMFF027B19+ AACATCCAAAGCAGGTAAATCAAAATACGAGCTTTTTGCATCCTTGTGCTTTTGCTCTTG
                      ____________________________________________________________
consensus AACATCCAAAGCAGGTAAATCAAAATACGAGCTTTTTGCATCCTTGTGCTTTTGCTCTTG
 
. : . : . : . : . : . :
JMSF018D18+ GGTTTCAGATGAAGGAACTTTCATGGTGATCTGTGAAGCAGAATGCAGAGAAAGACGCCG
JMFF027B19+ GGTTTCAGATGAAGGAACTTTCATGGTGATCTGTGAAGCAGAATGCAGAGAAAGACGCCG
                      ____________________________________________________________
consensus GGTTTCAGATGAAGGAACTTTCATGGTGATCTGTGAAGCAGAATGCAGAGAAAGACGCCG
 
. : . : . : . : . : . :
JMSF018D18+ GACAAGGAGAAGAAAGAAGAATGCTAACGGAACTGTTTGCTTGTGAGATGTTCC
JMFF027B19+ GACAAGGAGAAGAAAGAAGAATGCTAACGGAACTGTTTGCTTGTGAGATGTTCCAAAGAG
                      ____________________________________________________________
consensus GACAAGGAGAAGAAAGAAGAATGCTAACGGAACTGTTTGCTTGTGAGATGTTCCAAAGAG