Previous Contig 001272:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF016I21Sequence644000162 (8)gb:AY505498_16098452e-34Zea mays glossy1 protein gene, complete cds.726001272 (7)gb:AP003565_18308989e-61Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJN
JMFF020H15Sequence428000162 (8)707001272 (7)gb:AP003565_18308982e-63Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJN
JMFF026P10Sequence589001272 (7)gb:AP003565_18308981e-40Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJN578001272 (7)gb:AP003565_18308981e-40Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJN
JMSF033E11Sequence646000162 (8)gb:AB099512_15261447e-37Arabidopsis thaliana FLP1 mRNA for faceless pollen-1, complete cds.>gb:AB116548_749001272 (7)gb:AP003565_18308988e-58Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJN
JMSF043K04Sequence805000162 (8)gb:AB099512_15261443e-32Arabidopsis thaliana FLP1 mRNA for faceless pollen-1, complete cds.>gb:AB116548_777001272 (7)gb:AP003565_18308981e-63Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJN
JMSF050P09Sequence704000162 (8)gb:AB099512_15261445e-75Arabidopsis thaliana FLP1 mRNA for faceless pollen-1, complete cds.>gb:AB116548_706001272 (7)gb:AP003565_18308982e-60Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJN

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF020H15+ TGACATTCCCGGGGACGTGGATGAGGTCTT
rJMSF043K04+ TTAAATGACATTCCCCNGGACGTGGATGAGGTTTT
                      ____________________________________________________________
consensus TTAAATGACATTCCCGGGGACGTGGATGAGGTTTT
 
. : . : . : . : . : . :
rJMFF020H15+ CCTAACAGGTGCCACTTCCAAACTTGGGAGGGCCATTGCGCTCTACCTGGCACGTAGACG
rJMSF043K04+ CCTAACAGGTGCCACTTCCAAACTTGGGAGGGCCATTGCGCTCTACCTGGCACGTAGACG
rJMSF050P09+ TGGCACGTAGACG
rJMSF033E11+ TGGGAGGGCCANTGCGCTCTACCTGGCACGTAGACG
rJMFF016I21+ GCACGTAGACG
                      ____________________________________________________________
consensus CCTAACAGGTGCCACTTCCAAACTTGGGAGGGCCATTGCGCTCTACCTGGCACGTAGACG
 
. : . : . : . : . : . :
rJMFF020H15+ AGTCAGAGTTTTGATGCTTACCCAATCCACTGAGAGATTCGTAAAAATCCAAAGTGAAGC
rJMSF043K04+ AGTTAGAGTTTTGATGCTTACCCAATCCACTGAGAGATTCGTAAAAATCCAAAGTGAAGC
rJMSF050P09+ AGTCAGAGTTTTGATGCTTACCCAATCCACTGAGAGATTCGTAAAAATCCAAAGTGAAGC
rJMSF033E11+ AGTCAGAGTTTTGATGCTTACCCAATCCACTGAGAGATTCGTAAAAATCCAAAGTGAAGC
rJMFF016I21+ AGTCAGAGTTTTGATGCTTACCCAATCCACTGAGAGATTCGTAAAAATCCAAAGTGAAGC
                      ____________________________________________________________
consensus AGTCAGAGTTTTGATGCTTACCCAATCCACTGAGAGATTCGTAAAAATCCAAAGTGAAGC
 
. : . : . : . : . : . :
rJMFF020H15+ CCCGGTGGATTGCCAGAAATTCCTAGTTCAAGTTACCAAGTATCAAGCAGCTAAACACTG
rJMSF043K04+ CCCGGTGGATTGCCAGAAATTCCTAGTTCAAGTTACCAAGTATCAAGCAGCTAAACACTG
rJMSF050P09+ CCCGGTGGATTGCCAGAAATTCCTAGTTCAAGTTACCAAGTATCAAGCAGCTAAACACTG
rJMSF033E11+ CCCGGTGGATTGCCAGAAATTCCTAGTTCAAGTTACCAAGTATCAAGCAGCTAAACACTG
rJMFF016I21+ CCCGGTGGATTGCCAGAAATTCCTAGTTCAAGTTACCAAGTATCAAGCAGCTAAACACTG
                      ____________________________________________________________
consensus CCCGGTGGATTGCCAGAAATTCCTAGTTCAAGTTACCAAGTATCAAGCAGCTAAACACTG
 
. : . : . : . : . : . :
rJMFF020H15+ TAAGACGTGGATAATTGGGAAATGGGCTACACCTCGAGAGCAAAGCTGGGCTCCTTCAGG
rJMSF043K04+ TAAGACGTGGATAATTGGGAAATGGGCTACACCTCGAGAGCAAAGCTGGGCTCCTTCAGG
rJMSF050P09+ TAAGACGTGGATAATTGGGAAATGGGCTACACCTCGAGAGCAAAGCTGGGCTCCTTCAGG
rJMSF033E11+ TAAGACGTGGATAATTGGGAAATGGGCTACACCTCGAGAGCAAAGCTGGGCTCCTTCAGG
rJMFF016I21+ TAAGACGTGGATAATTGGGAAATGGGCTACACCTCGAGAGCAAAGCTGGGCTCCTTCAGG
rJMFF026P10+ ATAATTGGGAAATGGGCTACACCTCGAGAGCAAAGCTGGGCTCCTTCAGG
JMFF026P10- ATAATTGGGAAATGGGCTACACCTCGAGAGCAAAGCTGGGCTCCTTCAGG
                      ____________________________________________________________
consensus TAAGACGTGGATAATTGGGAAATGGGCTACACCTCGAGAGCAAAGCTGGGCTCCTTCAGG
 
. : . : . : . : . : . :
rJMFF020H15+ AACACATTTTCATCAATTTGTAGTCCCGCCTATCATCCAATTCCGTAGAGACTGCACTTA
rJMSF043K04+ AACACATTTTCATCAATTTGTAGTCCCGCCTATCATCCAATTCCGTAGAGACTGCACTTA
rJMSF050P09+ AACACATTTTCATCAATTTGTAGTCCCGCCTATCATCCAATTCCGTAGAGACTGCACTTA
rJMSF033E11+ AACACATTTTCATCAATTTGTAGTCCCGCCTATCATCCAATTCCGTAGAGACTGCACTTA
rJMFF016I21+ AACACATTTTCATCAATTTGTAGTCCCGCCTATCATCCAATTCCGTAGAGACTGCACTTA
rJMFF026P10+ AACACATTTTCATCAATTTGTAGTCCCGCCTATCATCCAATTCCGTAGAGACTGCACTTA
JMFF026P10- AACACATTTTCATCAATTTGTAGTCCCGCCTATCATCCAATTCCGTAGAGACTGCACTTA
                      ____________________________________________________________
consensus AACACATTTTCATCAATTTGTAGTCCCGCCTATCATCCAATTCCGTAGAGACTGCACTTA
 
. : . : . : . : . : . :
rJMFF020H15+ CGGGAAGTTGGCAGCAATGAAGCTTCCAAAGGATGTTGAGGGGCTTGGATCATGTGAGTA
rJMSF043K04+ CGGGAAGTTGGCAGCAATGAAGCTTCCAAAGGATGTTGAGGGGCTTGGATCATGTGAGTA
rJMSF050P09+ CGGGAAGTTGGCAGCAATGAAGCTTCCAAAGGATGTTGAGGGGCTTGGATCATGTGAGTA
rJMSF033E11+ CGGGAAGTTGGCAGCAATGAAGCTTCCAAAGGATGTTGAGGGGCTTGGATCATGTGAGTA
rJMFF016I21+ CGGGAAGTTGGCAGCAATGAAGCTTCCAAAGGATGTTGAGGGGCTTGGATCATGTGAGTA
rJMFF026P10+ CGGGAAGTTGGCAGCAATGAAGCTTCCAAAGGATGTTGAGGGGCTTGGATCATGTGAGTA
JMFF026P10- CGGGAAGTTGGCAGCAATGAAGCTTCCAAAGGATGTTGAGGGGCTTGGATCATGTGAGTA
                      ____________________________________________________________
consensus CGGGAAGTTGGCAGCAATGAAGCTTCCAAAGGATGTTGAGGGGCTTGGATCATGTGAGTA
 
. : . : . : . : . : . :
rJMFF020H15+ CACAATGGGACGAGGCGTTGTTCATGCGTGCCATGCAGGCGGAGTGGTTCATGCTCTCGA
rJMSF043K04+ CACAATGGGACGAGGCGTTGTTCATGCGTGCCATGCAGGCGGAGTGGTTCATGCTCTCGA
rJMSF050P09+ CACAATGGGACGAGGCGTTGTTCATGCGTGCCATGCAGGCGGAGTGGTTCATGCTCTCGA
rJMSF033E11+ CACAATGGGACGAGGCGTTGTTCATGCGTGCCATGCAGGCGGAGTGGTTCATGCTCTCGA
rJMFF016I21+ CACAATGGGACGAGGCGTTGTTCATGCGTGCCATGCAGGCGGAGTGGTTCATGCTCTCGA
rJMFF026P10+ CACAATGGGACGAGGCGTTGTTCATGCGTGCCATGCAGGCGGAGTGGTTCATGCTCTCGA
JMFF026P10- CACAATGGGACGAGGCGTTGTTCATGCGTGCCATGCAGGCGGAGTGGTTCATGCTCTCGA
                      ____________________________________________________________
consensus CACAATGGGACGAGGCGTTGTTCATGCGTGCCATGCAGGCGGAGTGGTTCATGCTCTCGA
 
. : . : . : . : . : . :
rJMFF020H15+ AGGGTGGACGCACCACGAGGTAGGAGCTATCAATGTAGACCAGATTGATGTAGTCTGGGA
rJMSF043K04+ AGGGTGGACGCACCACGAGGTAGGAGCTATCAATGTAGACCAGATTGATGTAGTCTGGGA
rJMSF050P09+ AGGGTGGACGCACCACGAGGCAGGAGCTATCAATGTAGACCAGATTGATGTAGTCTGGGA
rJMSF033E11+ AGGGTGGACGCACCACGAGGTAGGAGCTATCAATGTAGACCAGATTGATGTAGTCTGGGA
rJMFF016I21+ AGGGTGGACGCACCACGAGGTAGGAGCTATCAATGTAGACCAGATTGATGTAGTCTGGGA
rJMFF026P10+ AGGGTGGACGCACCACGAGGTAGGAGCTATCAATGTAGACCAGATTGATGTAGTCTGGGA
JMFF026P10- AGGGTGGACGCACCACGAGGTAGGAGCTATCAATGTAGACCAGATTGATGTAGTCTGGGA
                      ____________________________________________________________
consensus AGGGTGGACGCACCACGAGGTAGGAGCTATCAATGTAGACCAGATTGATGTAGTCTGGGA
 
. : . : . : . : . : . :
rJMFF020H15+ GGCTGCACTGAAGAATGGGTTGAAGCCCTTGTAGAGGATGCCATTTTTGCTCCTCTCCTC
rJMSF043K04+ GGCTGCACTGAAGAATGGGTTGAAGCCCTTGTAGAGGATGCCATTTTTGCTCCTCTCCTC
rJMSF050P09+ GGCTGCACTGAAGAATGGGTTGAAGCCCTTTTAGAGGATGCCATTTTTGCTCCTCTCCTC
rJMSF033E11+ GGCTGCACTGAAGAATGGGTTGAAGCCCTTGTAGAGGATGCCATTTTTGCTCCTCTCCTC
rJMFF016I21+ GGCTGCACTGAAGAATGGGTTGAAGCCCTTGTAGAGGATGCCATTTTTGCTCCTCTCCTC
rJMFF026P10+ GGCTGCACTGAAGAATGGGTTGAAGCCCTTGTAGAGGATGCCATTTTTGCTCCTCTCCTC
JMFF026P10- GGCTGCACTGAAGAATGGGTTGAAGCCCTTGTAGAGGATGCCATTTTTGCTCCTCTCCTC
                      ____________________________________________________________
consensus GGCTGCACTGAAGAATGGGTTGAAGCCCTTGTAGAGGATGCCATTTTTGCTCCTCTCCTC
 
. : . : . : . : . : . :
rJMFF020H15+ TCACCTGATGAAGATAAGATTGCTCAATATGGATCACCTAAGCTAATAGCTTGAAGTTGC
rJMSF043K04+ TCACCTGATGAAGATAAGATTGCTCAATATGGATCACCTAAGCTAATAGCTTGAAGTTGC
rJMSF050P09+ TCACCTGATGAAGATAAGATTGCTCAATATGGATCACCTAAGCTAATAGCTTGAAGTTGC
rJMSF033E11+ TCACCTGATGAAGATAAGATTGCTCAATATGGATCACCTAAGCTAATAGCTTGAAGTTGC
rJMFF016I21+ TCACCTGATGAAGATAAGATTGCTCAATATGGATCACCTAAGCTAATAGCTTGAAGTTGC
rJMFF026P10+ TCACCTGATGAAGATAAGATTGCTCAATATGGATCACCTAAGCTAATAGCTTGAAGTTGC
JMFF026P10- TCACCTGATGAAGATAAGATTGCTCAATATGGATCACCTAAGCTAATAGCTTGAAGTTGC
                      ____________________________________________________________
consensus TCACCTGATGAAGATAAGATTGCTCAATATGGATCACCTAAGCTAATAGCTTGAAGTTGC
 
. : . : . : . : . : . :
rJMFF020H15+ TTGGAGTTCATAGATTAACACTATTCTTGTTTGTTTTCTTGTACCCCTGCTCCCACTCAC
rJMSF043K04+ TTGGAGTTCATAGATTAACACTATTCTTGTTTGTTTTCTTGTACCCCTGCTCCCACTCAC
rJMSF050P09+ TTGGAGTTCATAGATTAACACTATTCTTGTTTGTTTTCTTGTACCCCTGCTCCCACTCAC
rJMSF033E11+ TTGGAGTTCATAGATTAACACTATTCTTGTTTGTTTTCTTGTACCCCTGCTCCCACTCAC
rJMFF016I21+ TTGGAGTTCATAGATTAACACTATTCTTGTTTGTTTTCTTGTACCCCTGCTCCCACTCAC
rJMFF026P10+ TTGGAGTTCATAGATTAACACTATTCTTGTTTGTTTTCTTGTACCCCTGCTCCCACTCAC
JMFF026P10- TTGGAGTTCATAGATTAACACTATTCTTGTTTGTTTTCTTGTACCCCTGCTCCCACTCAC
                      ____________________________________________________________
consensus TTGGAGTTCATAGATTAACACTATTCTTGTTTGTTTTCTTGTACCCCTGCTCCCACTCAC
 
. : . : . : . : . : . :
rJMFF020H15+ CCACAAAACTTTTAAAA
rJMSF043K04+ CCACAAAACTTTTAAAAATAAATAAAAAATCTTTTACAGTTCTACATTATGCTGTTACAA
rJMSF050P09+ CCACAAAACTTTTAAAAATAAATAAAAAATCTTTTACAGTTCTACATTATGCTGTTAC-A
rJMSF033E11+ CCACAAAACTTTTAAAAATAAATAAAAAATCTTTTACAGTTCTACATTATGCTGTTAC-A
rJMFF016I21+ CCACAAAACTTTTAAAAATAAATAAAAAATCTTTTACAGTTCTACATTATGCTGTTAC-A
rJMFF026P10+ CCACAAAACTTTTAAAAATAAATAAAAAATCTTTTACAGTTCTACATTATGCTGTTAC-A
JMFF026P10- CCACAAAACTTTTAAAAATAAATAAAAAATCTTTTACAGTTCTACATTATGCTGTTAC-A
                      ____________________________________________________________
consensus CCACAAAACTTTTAAAAATAAATAAAAAATCTTTTACAGTTCTACATTATGCTGTTAC-A
 
. : . : . : . : . : . :
rJMSF043K04+ AACCTGTGTAAACTGATAGTAT
rJMSF050P09+ AACCTGTGTAAACTGATAGTATGTTTGTAT
rJMSF033E11+ AACCTGTGTAAACTGATAGTATGTTTGTATTGCTTATGAAGAAAAGAACA
rJMFF016I21+ AACCTGTGTAAACTGATAGTATGTTTGTATTGCTTATGAAGAAAAGAACA
rJMFF026P10+ AACCTGTGTAAACTGATAGTATGTTTGTATTGCTTA-GAAGAAAAGAACA
JMFF026P10- AACCTGTGTAAACTGATAGTATGTTTGTATTGCTTATGAAGAAAAGAACATGCTATTTCA
                      ____________________________________________________________
consensus AACCTGTGTAAACTGATAGTATGTTTGTATTGCTTATGAAGAAAAGAACATGCTATTTCA