Previous Contig 001269:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF026N23Sequence635001269 (3)gb:AF369915_17919973e-21Arabidopsis thaliana putative metal transporter IRT3 gene, complete cds.756010286 (3)sp|O04089|ZIP4_ARATH8e-78Zinc transporter 4, chloroplast precursor (ZRT/IRT-like protein 4).>pir|F86243|F
JMFF043D04Sequence666001269 (3)gb:AF275751_17825631e-27Thlaspi caerulescens ZIP-like zinc transporter (ZNT1-LC) mRNA, complete cds.605010286 (3)sp|O04089|ZIP4_ARATH2e-68Zinc transporter 4, chloroplast precursor (ZRT/IRT-like protein 4).>pir|F86243|F
JMSF009E15Sequence272001269 (3)751010286 (3)sp|O04089|ZIP4_ARATH3e-74Zinc transporter 4, chloroplast precursor (ZRT/IRT-like protein 4).>pir|F86243|F

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF043D04+ TAAATCC
                      ____________________________________________________________
consensus TAAATCC
 
. : . : . : . : . : . :
JMFF043D04+ AGAGAATGGGAATTTCAACCAAGGATATTCAGGTAGACAGGGATTAGTCAGTTGCTCAGT
JMFF026N23+ TATTCAGGTAGACAGGGATTAGTCAGTTGCTCAGT
                      ____________________________________________________________
consensus AGAGAATGGGAATTTCAACCAAGGATATTCAGGTAGACAGGGATTAGTCAGTTGCTCAGT
 
. : . : . : . : . : . :
JMFF043D04+ TGCATCAGGTAACATGTGAACAAAACCGGTGGCAAGGATGACACCAGCTGCAAAGGCTTT
JMFF026N23+ TGCATCAGGTAACATGTGAACAAAACCGGTGGCAAGGATGACACCAGCTGCAAAGGCTTT
                      ____________________________________________________________
consensus TGCATCAGGTAACATGTGAACAAAACCGGTGGCAAGGATGACACCAGCTGCAAAGGCTTT
 
. : . : . : . : . : . :
JMFF043D04+ GGCAGCAACAAAGAGATTAGAATCTGTTTGAAGGAACCGTCGCTTCCTGCCAATTAATGG
JMFF026N23+ GGCAGCAACAAAGAGATTAGAATCTGTTTGAAGGAACCGTCGCTTCCTGCCAATTAATGG
                      ____________________________________________________________
consensus GGCAGCAACAAAGAGATTAGAATCTGTTTGAAGGAACCGTCGCTTCCTGCCAATTAATGG
 
. : . : . : . : . : . :
JMFF043D04+ GACTGAAACTCCAAATGCACCAGCAATGAGAATAGCTGCAATAGCAATCATTTTAAGGAT
JMFF026N23+ GACTGAAACTCCAAATGCACCAGCAATGAGAATAGCTGCAATAGCAATCATTTTAAGGAT
                      ____________________________________________________________
consensus GACTGAAACTCCAAATGCACCAGCAATGAGAATAGCTGCAATAGCAATCATTTTAAGGAT
 
. : . : . : . : . : . :
JMFF043D04+ GAAAGCAGATCCGCTGTCTTGGCAGTCCCCTAACTCTTTTTCAGAATTGCCACAGCTGTG
JMSF009E15+ TTTCAGAATTGCCACAGCTGTG
JMFF026N23+ GAAAGCAGATCCGCTGTCTTGGCAGTCCCCTAACTCTTTTTCAGAATTGCCACAGCTGTG
                      ____________________________________________________________
consensus GAAAGCAGATCCGCTGTCTTGGCAGTCCCCTAACTCTTTTTCAGAATTGCCACAGCTGTG
 
. : . : . : . : . : . :
JMFF043D04+ GTTAGACAAAGATTGAGAGACATTCTGCAAAAAGGAGTCTGTGAAGACCTTCGTCTTCGC
JMSF009E15+ GTTAGACAAAGATTGAGAGACATTCTGCAAAAAGGAGTCTGTGAAGACCTTCGTCTTCGC
JMFF026N23+ GTTAGACAAAGATTGAGAGACATTCTGCAAAAAGGAGTCTGTGAAGACCTTCGTCTTCGC
                      ____________________________________________________________
consensus GTTAGACAAAGATTGAGAGACATTCTGCAAAAAGGAGTCTGTGAAGACCTTCGTCTTCGC
 
. : . : . : . : . : . :
JMFF043D04+ TCTAATTTGATCCATGCAAAACGGAAGAAGGCCCTCAACGAGTGACATGATTAGAGAAGA
JMSF009E15+ TCTAATTTGATCCATGCAAAACGGAAGAAGGCCCTCAACGAGTGACATGATTAGAGAAGA
JMFF026N23+ TCTAATTTGATCCATGCAAAACGGAAGAAGGCCCTCAACGAGTGACATGATTAGAGAAGA
                      ____________________________________________________________
consensus TCTAATTTGATCCATGCAAAACGGAAGAAGGCCCTCAACGAGTGACATGATTAGAGAAGA
 
. : . : . : . : . : . :
JMFF043D04+ GAACAGAAAACTCTATTCTGTTGTTATATTTGCGGTGGCGAATCTCGATGCAGTGGAAAC
JMSF009E15+ GAACAGAAAACTCTATTCTGTTGTTATATTTGCGGTGGCGAATCTCGATGCAGTGGAAAC
JMFF026N23+ GAACAGAAAACTCTATTCTGTTGTTATATTTGCGGTGGCGAATCTCGATGCAGTGGAAAC
                      ____________________________________________________________
consensus GAACAGAAAACTCTATTCTGTTGTTATATTTGCGGTGGCGAATCTCGATGCAGTGGAAAC
 
. : . : . : . : . : . :
JMFF043D04+ TCGGCCTGAGAGAGTGATAGCCGATAGGCAGATTATAGATTGAAGATTCTGGGTGGAGAG
JMSF009E15+ TCGGCCTGAGAGAGTGATAGCCGATAGGCAGATTATAGATTGAAGATTCTGGGTGGAGAG
JMFF026N23+ TCGGCCTGAGAGAGTGATAGCCGATAGGCAGATTATAGATTGAAGATTCTGGGTGGAGAG
                      ____________________________________________________________
consensus TCGGCCTGAGAGAGTGATAGCCGATAGGCAGATTATAGATTGAAGATTCTGGGTGGAGAG
 
. : . : . : . : . : . :
JMFF043D04+ GGGCTTTTATGATTTATCGTGCGTAGCGGCGCACAGATTACCGGTAACGTATGGATATAG
JMSF009E15+ GGGCTTTT
JMFF026N23+ GGGCTTTTATGATTTATCGTGCGTAGCGGCGCACAGATTACCGGTAACGTATGGATATAG
                      ____________________________________________________________
consensus GGGCTTTTATGATTTATCGTGCGTAGCGGCGCACAGATTACCGGTAACGTATGGATATAG
 
. : . : . : . : . : . :
JMFF043D04+ AGAGAGAGATGAGAGAGAAAGAGAGATGTCGACATTTTGATGAAGAAATGGTGTCAACT
JMFF026N23+ AGAGAGAGATGAGAGAGAAAGAGAGATGTCGACATTTTGATGAAGAAATGGTGTCAACTT
                      ____________________________________________________________
consensus AGAGAGAGATGAGAGAGAAAGAGAGATGTCGACATTTTGATGAAGAAATGGTGTCAACTT