Previous Contig 001266:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF026N04Sequence480001266 (16)gb:AC145396_17444521e-11Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0042F15, complet738010690 (9)sp|Q9XIK4|U202_ARATH5e-19Hypothetical UPF0202 protein At1g10490.>gb:AE005172_890056 Arabidopsis thaliana
JMFF029H13Sequence418001266 (16)gb:AC145396_17444523e-13Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0042F15, complet673003550 (5)pir|T48515|T485157e-38hypothetical protein F15N18.150 - Arabidopsis thaliana>gb:ATF15N18_1548743 Arabi
JMFF032J19Sequence237001266 (16)650010690 (9)sp|Q9XIK4|U202_ARATH4e-07Hypothetical UPF0202 protein At1g10490.>gb:AE005172_890056 Arabidopsis thaliana
JMFF046P22Sequence437001266 (16)gb:AC145396_17444522e-04Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0042F15, complet458010690 (9)
JMFS008B07Sequence636001266 (16)pir|T48515|T485152e-60hypothetical protein F15N18.150 - Arabidopsis thaliana>gb:ATF15N18_1548743 Arabi
JMFS012H01Sequence436001266 (16)gb:AC145396_17444521e-16Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0042F15, complet
JMFS032E06Sequence535001266 (16)pir|T48515|T485152e-50hypothetical protein F15N18.150 - Arabidopsis thaliana>gb:ATF15N18_1548743 Arabi
JMFS063A05Sequence419001266 (16)gb:AC145396_17444522e-11Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0042F15, complet
JMFS065A08Sequence619001266 (16)pir|T48515|T485151e-55hypothetical protein F15N18.150 - Arabidopsis thaliana>gb:ATF15N18_1548743 Arabi
JMFS090H01Sequence627001266 (16)pir|T48515|T485156e-57hypothetical protein F15N18.150 - Arabidopsis thaliana>gb:ATF15N18_1548743 Arabi
JMFS106D09Sequence619001266 (16)pir|T48515|T485158e-56hypothetical protein F15N18.150 - Arabidopsis thaliana>gb:ATF15N18_1548743 Arabi
JMFS110H06Sequence147001266 (16)
JMFS119C01Sequence627001266 (16)gb:AC145396_17444524e-43Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0042F15, complet
JMSF004I13Sequence424001266 (16)gb:AC145396_17444526e-06Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0042F15, complet540003550 (5)gb:AC145396_17444524e-26Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0042F15, complet
JMSF018G23Sequence224001266 (16)gb:AC145396_17444522e-07Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0042F15, complet776003550 (5)pir|T48515|T485151e-52hypothetical protein F15N18.150 - Arabidopsis thaliana>gb:ATF15N18_1548743 Arabi
JMSF042L18Sequence775001266 (16)pir|T48515|T485151e-42hypothetical protein F15N18.150 - Arabidopsis thaliana>gb:ATF15N18_1548743 Arabi837003550 (5)gb:AC145396_17444526e-59Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0042F15, complet

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS032E06+ CCTGTTGGAAGTTAAT
                      ____________________________________________________________
consensus CCTGTTGGAAGTTAAT
 
. : . : . : . : . : . :
JMFS032E06+ TAGTCCATCCTTGAAAATTATAGATACTAGGATTGACCCAGTGGAATCCAGTGCCACCAC
                      ____________________________________________________________
consensus TAGTCCATCCTTGAAAATTATAGATACTAGGATTGACCCAGTGGAATCCAGTGCCACCAC
 
. : . : . : . : . : . :
JMFS032E06+ TTTCTCACTTGTCACTAGTGATATGTCACCAGAAAATCCGCCAGGAAATACCATGCTCTC
                      ____________________________________________________________
consensus TTTCTCACTTGTCACTAGTGATATGTCACCAGAAAATCCGCCAGGAAATACCATGCTCTC
 
. : . : . : . : . : . :
JMFS032E06+ ATGCTTTAGCAGTTCACCCTTCCTAGCATTTATTTTATATGCTACAAACTGGGATGAACT
JMFS008B07+ GCATTTATTTTATATGCTACAAACTGGGATGAACT
                      ____________________________________________________________
consensus ATGCTTTAGCAGTTCACCCTTCCTAGCATTTATTTTATATGCTACAAACTGGGATGAACT
 
. : . : . : . : . : . :
JMFS032E06+ AGTGAGTCCTACAGCATATACATCATCAGTGCCGTCAGGATGAACTATATGTTGAATGTC
JMFS008B07+ AGTGAGTCCTACAGCATATACATCATCAGTGCCGTCAGGATGAACTATATGTTGAATGTC
JMFS106D09+ GGATGAACTATATGTTGAATGTC
JMFS065A08+ GGATGAACTATATGTTGAATGTC
JMFS090H01+ CATATACATCATCAGTGCCTTCGGGATGAACTATATGTTGAATGTC
                      ____________________________________________________________
consensus AGTGAGTCCTACAGCATATACATCATCAGTGCCGTCAGGATGAACTATATGTTGAATGTC
 
. : . : . : . : . : . :
JMFS032E06+ AAGGCCTTCATTTGCTAGCTCTTTCTTCCAGATAACTTCCCCATCGGTGCTTGAAACAGC
JMFS008B07+ AAGGCCTTCATTTGCTAGCTCTTTCTTCCAGATAACTTCCCCATCGGTGCTTGAAACAGC
JMFS106D09+ AAGGCCTTCATNTGCTAGCTCTTTCTTCCAGATAACCTCCCCATCGGTGCTTGAAACAGC
JMFS065A08+ AAGGCCTTCATGTGCTAGCTCTTTCTTCCAGATAACCTCCCCATCGGTGCTTGAAACAGC
JMFS090H01+ AAGGCCTTCATTTGCTAGCTCTTTCTTCCAGATAACCTCCCCATCGGTGCTTGAAACAGC
JMSF042L18+ ATCGGTGCTTGAAACAGC
                      ____________________________________________________________
consensus AAGGCCTTCATTTGCTAGCTCTTTCTTCCAGATAACCTCCCCATCGGTGCTTGAAACAGC
 
. : . : . : . : . : . :
JMFS032E06+ ATGCAAATACCCACTACTATAAATAAGGATCAAACTGTCCCTATCCACTTTCAAATTTGA
JMFS008B07+ ATGCAAATACCCACTACTATAAATAAGGATCAAACTGTCCCTATCCACTTTCAAATTTGA
JMFS106D09+ ATGCAAATACCCACTACTATAAATAAGGATCAAACTGTCCCTGTCCACTTTCAAATTTGA
JMFS065A08+ ATGCAAATACCCACTACTATAAATAAGGATCAAACTGTCCCTGTCCACTTTCAAATTTGA
JMFS090H01+ ATGCAAATACCCACTACTATAAATAAGGATCAAACTGTCCCTGTCCACTTTCAAATTTGA
JMFS119C01+ TGTCCCTATCCACTTTCAAATTTGA
JMSF042L18+ ATGCAAATACCCACTACTATAAATAAGGATCAAACTGTCCCTATCCACTTTCAAATTTGA
                      ____________________________________________________________
consensus ATGCAAATACCCACTACTATAAATAAGGATCAAACTGTCCCTATCCACTTTCAAATTTGA
 
. : . : . : . : . : . :
JMFS032E06+ AGGAACTAATAAAATTGATCTTGAAGGACTTGAGCCAGAAAGGAATGACTCCCACACCAT
JMFS008B07+ AGGAACTAATAAAATTGATCTTGAAGGACTTGAGCCAGAAAGGAATGACTCCCACACCAT
JMFS106D09+ AGGAACTAATAAAATTGATCTTGAAGGACTTGAGCCAGAAAGGAATGACTCCCACACCAT
JMFS065A08+ AGGAACTAATAAAATTGATCTTGAAGGACTTGAGCCAGAAAGGAATGACTCCCACACCAT
JMFS090H01+ AGGAACTAATAAAATTGATCTTGAAGGACTTGAGCCAGAAAGGAATGACTCCCACACCAT
JMFS119C01+ AGGAACTAATAAAATTGATCTTGAAGGACTTGAGCCAGAAAGGAATGACTCCCACACCAT
JMSF042L18+ AGGAACTAATAAAATTGATCTTGAAGGACTTGAGCCAGAAAGGAATGACTCC--CAACAT
                      ____________________________________________________________
consensus AGGAACTAATAAAATTGATCTTGAAGGACTTGAGCCAGAAAGGAATGACTCCCACACCAT
 
. : . : . : . : . : . :
JMFS032E06+ CTGGCCATCTGGAAGGTTCCATGCTCTTAAAGTGCTTCCAGATGACAGAGTAATAACATA
JMFS008B07+ CTGGCCATCTGGAAGGTTCCATGCTCTTAAAGTGCTTCCAGATGACAGAGTAATAACATA
JMFS106D09+ CTGGCCATCTGGAAGGTTCCATGCTCTTAAAGTGCTTCCAGATGACAGAGTAATAACATA
JMFS065A08+ CTGGCCATCTGGAAGGTTCCATGCTCTTAAAGTGCTTCCAGATGACAGAGTAATAACATA
JMFS090H01+ CTGGCCATCTGGAAGGTTCCATGCTCTTAAAGTGCTTCCAGATGACAGAGTAATAACATA
JMFS119C01+ CTGGCCATCTGGAAGGTTCCATGCTCTTAAAGTGCTTCCAGATGACAGAGTAATAACATA
JMSF042L18+ CTGGCCATCTGGAAGGTTCCATGCTCTTAAAGTGCTTCCAGATGACAGAGTAATAACATA
                      ____________________________________________________________
consensus CTGGCCATCTGGAAGGTTCCATGCTCTTAAAGTGCTTCCAGATGACAGAGTAATAACATA
 
. : . : . : . : . : . :
JMFS032E06+ TTTCCCTAGGGCGATATCAATTCCATCAATCACATCTTT
JMFS008B07+ TTTCCCTAGGGCGATATCAATTCCATCAATCACATCTTTGTGCCCCAATACATGCCTCCA
JMFS106D09+ TTTCCCAAGGGCGATATCAATTCCATCAATCACATCTTTGTGCCCCAATACATGCCTCCA
JMFS065A08+ TTTCCCAAGGGCGATATCAATTCCATCAATCACATCTTTGTGCCCCAATACATGCCTCCA
JMFS090H01+ TTTCCCAAGGGCGATATCAATTCCATCAATCACATCTTTGTGCCCCAATACATGCCTCCA
JMFS119C01+ TTTCCCTAGGGCGATATCAATTCCATCAATCACATCTTTGTGCCCCAATACATGCCTCCA
JMSF042L18+ TTTCCCTAGGGCGATATCAATTCCATCAATCACATCTTTGTGCCCCAATACATGCCTCCA
                      ____________________________________________________________
consensus TTTCCCTAGGGCGATATCAATTCCATCAATCACATCTTTGTGCCCCAATACATGCCTCCA
 
. : . : . : . : . : . :
JMFS008B07+ AAAAATATCTCCATGGCGAAGATCGAGGGAGGCGAGGACATTCTCTTCAGTGGAGACAAC
JMFS106D09+ AAAAATATCTCCATGGCGAAGATCGAGGGAGGCGAGGACATTCTCTTCAGTGGAGACAAC
JMFS065A08+ AAAAATATCTCCATGGCGAAGATCGAGGGAGGCGAGGACATTCTCTTCAGTGGAGACAAC
JMFS090H01+ AAAAATATCTCCATGGCGAAGATCGAGGGAGGCGAGGACATTCTCTTCAGTGGAGACAAC
JMFS119C01+ AAAAATATCTCCATGGCGAAGATCGAGGGAGGCGAGGACATTCTCTTCAGTGGAGACAAC
JMFS012H01+ GATCGAGGGAGGCGAGGACATTCTCTTCAGTGGAGACAAC
JMFF029H13+ TCTCTTCAGTGGAGACAAC
JMSF042L18+ AAAAATATCTCCATGGCGAAGATCGAGGGAGGCGAGGACATTCTCTTCAGTGGAGACAAC
JMFS063A05+ GACAAC
JMFF026N04+ GAGACAAC
                      ____________________________________________________________
consensus AAAAATATCTCCATGGCGAAGATCGAGGGAGGCGAGGACATTCTCTTCAGTGGAGACAAC
 
. : . : . : . : . : . :
JMFS008B07+ CACGCGCTTCCTCCCCGCCTTCTGCGTGTGGAACACTGCGTGCTTCACTTTTCCGATGTA
JMFS106D09+ CACGCGCTTCCTCCCCGCCTTCTGCGTGTGGAACACTGCGTGCTTCACTTTTCCGATGTA
JMFS065A08+ CACGCGCTTCCTCCCCGCCTTCTGCGTGTGGAACACTGCGTGCTTCACTTTTCCGATGTA
JMSF018G23+ TCTGCGTGTGGAACACTGCGTGCTTCACTTTTCCGATGTA
JMFS090H01+ CACGCGCTTCCTCCCCGCCTTCTGCGTGTGGAACACTGCGTGCTTCACTTTTCCGATGTA
JMFS119C01+ CACGCGCTTCCTCCCCGCCTTCTGCGTGTGGAACACTGCGTGCTTCACTTTTCCGATGTA
JMFS012H01+ CACGCGCTTCCTCCCCGCCTTCTGCGTGTGGAACACTGCGTGCTTCACTTTTCCGATGTA
JMFF029H13+ CACGCGCTTCCTCCCCGCCTTCTGCGTGTGGAACACTGCGTGCTTCACTTTTCCGATGTA
JMSF042L18+ CACGCGCTTCCTCCCCGCCTTCTGCGTGTGGAACACTGCGTGCTTCACTTTTCCGATGTA
JMFF046P22+ CTGCGTGCTTCACTTNTCCGATGTA
JMSF004I13+ GAACACTGCGTGCTTCACTTTTCCGATGTA
JMFS063A05+ CACGCGCTTCCTCCCCGCCTTTTGCGTGTGGAACATTGCGTGCTTCACTTTTCCGATGTA
JMFF026N04+ CACGCGCTTCCTCCCCGCCTTCTGCGTGTGGAACACTGCGTGCTTCACTTTTCCGATGTA
                      ____________________________________________________________
consensus CACGCGCTTCCTCCCCGCCTTCTGCGTGTGGAACACTGCGTGCTTCACTTTTCCGATGTA
 
. : . : . : . : . : . :
JMFS008B07+ CCGTTGATGCCAGTCCATGAGGCCGACTTGGTCTTCGTAGAGAGAGAAGGTAGTATAGGC
JMFS106D09+ CCGTTGATGCCAGTCCATGAGGCCGACTTGGTCTTCGTAGAGAGAGAAGGTAGTATAGGC
JMFS065A08+ CCGTTGATGCCAGTCCATGAGGCCGACTTGGTCTTCGTAGAGAGAGAAGGTAGTATAGGC
JMSF018G23+ CCGTTGATGCCAGTCCATGAGGCCGACTTGGTCTTCGTAGAGAGAGAAGGTAGTATAGGC
JMFS090H01+ CCGTTGATGCCAGTCCATGAGGCCGACTTGGTCTTCGTAGAGAGAGAAGGTAGTATAGGC
JMFS119C01+ CCGTTGATGCCAGTCCATGAGGCCGACTTGGTCTTCGTAGAGAGAGAAGGTAGTATAGGC
JMFS012H01+ CCGTTGATGCCAGTCCATGAGGCCGACTTGGTCTTCGTAGAGAGAGAAGGTAGTATAGGC
JMFF029H13+ CCGTTGATGCCAGTCCATGAGGCCGACTTGGTCTTCGTAGAGAGAGAAGGTAGTATAGGC
JMSF042L18+ CCGTTGATGCCAGTCCATGAGGCCGACTTGGTCTTCGTAGAGAGAGAAGGTAGTATAGGC
JMFF046P22+ CCGTTGATGCCAGTCCATGAGGCCGACTTGGTCTTCGTAGAGAGAGAAGGTAGTATAGGC
JMSF004I13+ CCGTTGATGCCAGTCCATGAGGCCGACTTGGTCTTCGTAGAGAGAGAAGGTAGTATAGGC
JMFS063A05+ CCGTTGATGCCAGTCCATGAGGCCGACTTGGTCTTCGTAGAGATAGAAGGTAGTATAGGC
JMFF026N04+ CCGTTGATGCCAGTCCATGAGGCCGACTTGGTCTTCGTAGAGAGAGAAGGTAGTATAGGC
                      ____________________________________________________________
consensus CCGTTGATGCCAGTCCATGAGGCCGACTTGGTCTTCGTAGAGAGAGAAGGTAGTATAGGC
 
. : . : . : . : . : . :
JMFS008B07+ GGAAGAGAAAATGAGAACGAGGAGAAGAAAAGCTCTAATCGCCATGGCTGATGGCGATTT
JMFS106D09+ GGAAGAGAAGATGAGAAAGACGAGAAGAGAAGCTCTAATCGCCATGGCTGATGGCGATTT
JMFS065A08+ GGAAGAGAAGATGAGAAAGACGAGAAGAGAAGCTCTAATCGCCATGGCTGATGGCGATTT
JMSF018G23+ GGAAGAGAAGATGAGAAAGACGAGAAGAGAAGCTCTAATCGCCATGGCTGATGGCGATTT
JMFS090H01+ GGAAGAGAAGATGAGAAAGACGAGAAGAGAAGCTCTAATCGCCATGGCTGATGGCGATTT
JMFS119C01+ GGAAGAGAAAATGAGAACGAGGAGAAGAAAAGCTCTAATCGCCATGGCTGATGGCGATTT
JMFS012H01+ GGAAGAGAAAATGAGAACGAGGAGAAGAAAAGCTCTAATCGCCATGGCTGATGGCGATTT
JMFF029H13+ GGAAGAGAAAATGAGAACGAGGAGAAGAAAAGCTCTAATCGCCATGGCTGATGGCGATTT
JMSF042L18+ GGAAGAGAAAATGAGAACGAGGAGAAGAAAAGCTCTAATCGCCATGGCTGATGGCGATTT
JMFF046P22+ GGAAGAGAAAATGAGAACGAGGAGAAGAAAAGCTCTAATCGCCATGGCTGATGGCGATTT
JMSF004I13+ GGAAGAGAAAATGAGAACGAGGAGAAGAAAAGCTCTAATCGCCATGGCTGATGGCGATTT
JMFS063A05+ GGAAGAGAAAATGAGAACGAGGAGAAGATAAGCTCTAATCGCCATGGCTGATGGCGATTT
JMFF026N04+ GGAAGAGAAAATGAGAACGAGGAGAAGAAAAGCTCTAATCGCCATGGCTGATGGCGATTT
                      ____________________________________________________________
consensus GGAAGAGAAAATGAGAACGAGGAGAAGAAAAGCTCTAATCGCCATGGCTGATGGCGATTT
 
. : . : . : . : . : . :
JMFS008B07+ G
JMFS106D09+ GCTCGTTACTTTCTCGCTCTG
JMFS065A08+ GCTCGTTACTTTCTCGCTCTG
JMSF018G23+ GCTCGTTACTTTCTCGCTCTG
JMFS090H01+ GCTCGTTACTTTCTCGCTCTGCAAGGAGGAGGCGATACAAA
JMFS119C01+ GAACGTTACTTTCTAGCTCT--------GAGGCTATAATAAATCTATAACGGTGGACGAA
JMFS012H01+ GAACGTTACTTTCTAGCTCT--------GAGGCTATAATAAATCTATAACGGTGGACGAA
JMFF029H13+ GAACGTTACTTTCTAGCTCT--------GAGGCTATAATAAATCTATAACGGTGGACGAA
JMSF042L18+ GAACGTTACTTTCTAGCTCT--------GAGGCTATAATAAATCTATAACGGTGGACGAA
JMFF046P22+ GAACGTTACTTTCTAGCTCT--------GAGGCTATAATAAATCTATAACGGTGGACGAA
JMSF004I13+ GAACGTTACTTTCTAGCTCT--------GAGGCTATAATAAATCTATAACGGTGGACGAA
JMFS063A05+ GAACGTTACTTTCTAGCTCT--------GAGGCTATAATAAATCTATAACGGTGGACGAA
JMFS110H06- AA
JMFF026N04+ GAACGTTACTTTCTAGCTCT--------GAGGCTATAATAAATCTATAACGGTGGACGAA
                      ____________________________________________________________
consensus GAACGTTACTTTCTAGCTCT--------GAGGCTATAATAAATCTATAACGGTGGACGAA
 
. : . : . : . : . : . :
JMFS119C01+ TGGTGAACGGACGGAGCCACGGAGGACAATAGCCGGACGACGGTGGTCGGTGGAGGCGTG
JMFS012H01+ TGGTGAACGGACGGAGCCACGGAGGACAATAGCCGGACGACGGTGGTCGGTGGAGGCGTG
JMFF029H13+ TGGTGAACGGACGGAGCCACGGAGGACAATAGCCGGACGACGGTGGTCGGTGGAGGCGTG
JMSF042L18+ TGGTGAACGGACGGAGCCACGGAGGACAATAGCCGGACGACGGTGGTCGGTGGAGGCGTG
JMFF046P22+ TGGTGAACGGACGGAGCCACGGAGGACAATAGCCGGACGACGGTGGTCGGTGGAGGCGTG
JMSF004I13+ TGGTGAACGGACGGAGCCACGGAGGACAATAGCCGGACGACGGTGGTCGGTGGAGGCGTG
JMFS063A05+ TGGTGAACGGACGGAGCCACGGAGGACAATAGCCGGACGACGGTGGTCGGTGGAGGCGTG
JMFF032J19+ TGAACGGACGGAGCCACGGAGGACAATAGCCGGACGACGGTGGTCGGTGGAGGCGTG
JMFS110H06- TGGTGAACGGACGGAGCCACGGAGGAGAATAGCCGGACGACGGTGGCCGGTGGAGGC
JMFF026N04+ TGGTGAACGGACGGAGCCACGGAGGACAATAGCCGGACGACGGTGGTCGGTGGAGGCGTG
                      ____________________________________________________________
consensus TGGTGAACGGACGGAGCCACGGAGGACAATAGCCGGACGACGGTGGTCGGTGGAGGCGTG
 
. : . : . : . : . : . :
JMFS119C01+ GAGTAATGGGCCGCGAATCTGCAAATCTTCGATGAAGAGTTCTGATGGACTGATGGAGTG
JMFS012H01+ GAGTAATGGGCCGCGAATCTGCAAATCTTCGATGAAGAGTTCTGATGGACTGATGGAGTG
JMFF029H13+ GAGTAATGGGCCGCGAATCTGCAAATCTTCGATGAAGAGTTCTGATGGACTGATGGAGTG
JMSF042L18+ GAGTAATGGGCCGCGAATCTGCAAATCTTCGATGAAGAGTTCTGATGGACTGATGGAGTG
JMFF046P22+ GAGTAATGGGCCGCGAATCTGCAAATCTTCGATGAAGAGTTCTGATGGACTGATGGAGTG
JMSF004I13+ GAGTAATGGGCCGCGAATCTGCAAATCTTCGATGAAGAGTTCTGATGGACTGATGGAGTG
JMFS063A05+ AAGTAATGGGCCGCGAATCTGCAAATCTTCGATGAAGAGTTCTGATGGACTGATGGAGTG
JMFF032J19+ GAGTAATGGGCCGCGAATCTGCAAATCTTCGATGAAGAGTTCTGATGGACTGATGGAGTG
JMFF026N04+ GAGTAATGGGCCGCGAATCTGCAAATCTTCGATGAAGAGTTCTGATGGACTGATGGAGTG
                      ____________________________________________________________
consensus GAGTAATGGGCCGCGAATCTGCAAATCTTCGATGAAGAGTTCTGATGGACTGATGGAGTG
 
. : . : . : . : . : . :
JMFS119C01+ ATAGAGCGTC
JMFS012H01+ ATAGAGCGTCTGTCTAATTTTTGGCAGCCATCTCCGTCCCTGGA
JMFF029H13+ ATAGAGCGTCTGTCTAATTTTTGGCAGCCATCTCCGTCCCTGGATCT
JMSF042L18+ ATAGAGCGTCTGTCTAATTTTTGGCAGCCATCTCCGTCCCTGGATCTGAGCAATACAAGT
JMFF046P22+ ATAGAGCGTCTGTCTAATTTTTGGCAGCCATCTCCGTCCCTGGATCTGAGCAATACAAGT
JMSF004I13+ ATAGAGCGTCTGTCTAATTTTTGGCAGCCATCTCCGTCCCTGGATCTGAGCAATACAAGT
JMFS063A05+ ATAGAGCGTCTGTCTAATTTTTGGCAGCCATCTCCGTCCCTGGATTTGAGCAATACAAGT
JMFF032J19+ ATAGAGCGTCTGTCTAATTTTTGGCAGCCATCTCCGTCCCTGGATCTGAGCAATACAAGT
JMFF026N04+ ATAGAGCGTCTGTCTAATTTTTGGCAGCCATCTCCGTCCCTGGATCTGAGCAATACAAGT
                      ____________________________________________________________
consensus ATAGAGCGTCTGTCTAATTTTTGGCAGCCATCTCCGTCCCTGGATCTGAGCAATACAAGT
 
. : . : . : . : . : . :
JMSF042L18+ AGAAGATGGAGACGTGTTATGACTTCAGTGTCCAACTCGTCGAGC
JMFF046P22+ AGAAGATGGAGACGTGTTATGACTTCAGTGTCCAACTCGTCGAGCAGTGAAGCCTGAACT
JMSF004I13+ AGAAGATGGAGACGTGTTATGACTTCAGTGTCCAACTCG
JMFF032J19+ AGAAGATGGAGACGTGTTATGACTTCAGTGTCCAACTCGTCGAGCAGTGAAGCCTGAACT
JMFF026N04+ AGAAGATGGAGACGTGTTATGACTTCAGTGTCCAACTCGTCGAGCAGTGAAGCCTGAACT
                      ____________________________________________________________
consensus AGAAGATGGAGACGTGTTATGACTTCAGTGTCCAACTCGTCGAGCAGTGAAGCCTGAACT